ID: 922063068

View in Genome Browser
Species Human (GRCh38)
Location 1:222110021-222110043
Sequence CTGGTTAGATACATCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922063065_922063068 8 Left 922063065 1:222109990-222110012 CCACTAGTGTGGTGGGTAGGGCA No data
Right 922063068 1:222110021-222110043 CTGGTTAGATACATCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922063068 Original CRISPR CTGGTTAGATACATCTGCCC TGG Intergenic
No off target data available for this crispr