ID: 922067521

View in Genome Browser
Species Human (GRCh38)
Location 1:222158514-222158536
Sequence CTCCCAAGGGACCAAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922067515_922067521 -10 Left 922067515 1:222158501-222158523 CCCATTTTTTATTCTCCCAAGGG No data
Right 922067521 1:222158514-222158536 CTCCCAAGGGACCAAGGGAAGGG No data
922067510_922067521 21 Left 922067510 1:222158470-222158492 CCAGTAACTCTCTTCCTTCTTCA No data
Right 922067521 1:222158514-222158536 CTCCCAAGGGACCAAGGGAAGGG No data
922067512_922067521 -8 Left 922067512 1:222158499-222158521 CCCCCATTTTTTATTCTCCCAAG No data
Right 922067521 1:222158514-222158536 CTCCCAAGGGACCAAGGGAAGGG No data
922067511_922067521 7 Left 922067511 1:222158484-222158506 CCTTCTTCAAAAAGTCCCCCATT No data
Right 922067521 1:222158514-222158536 CTCCCAAGGGACCAAGGGAAGGG No data
922067509_922067521 26 Left 922067509 1:222158465-222158487 CCACTCCAGTAACTCTCTTCCTT No data
Right 922067521 1:222158514-222158536 CTCCCAAGGGACCAAGGGAAGGG No data
922067513_922067521 -9 Left 922067513 1:222158500-222158522 CCCCATTTTTTATTCTCCCAAGG No data
Right 922067521 1:222158514-222158536 CTCCCAAGGGACCAAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922067521 Original CRISPR CTCCCAAGGGACCAAGGGAA GGG Intergenic
No off target data available for this crispr