ID: 922068843

View in Genome Browser
Species Human (GRCh38)
Location 1:222170803-222170825
Sequence AGATATCTGCACAGGATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922068843_922068852 12 Left 922068843 1:222170803-222170825 CCACCCATCCTGTGCAGATATCT No data
Right 922068852 1:222170838-222170860 ACCCTCTCTGCTCCACACCCAGG No data
922068843_922068856 24 Left 922068843 1:222170803-222170825 CCACCCATCCTGTGCAGATATCT No data
Right 922068856 1:222170850-222170872 CCACACCCAGGCAGATCTCCAGG 0: 24
1: 53
2: 144
3: 229
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922068843 Original CRISPR AGATATCTGCACAGGATGGG TGG (reversed) Intergenic
No off target data available for this crispr