ID: 922068843 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:222170803-222170825 |
| Sequence | AGATATCTGCACAGGATGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 922068843_922068852 | 12 | Left | 922068843 | 1:222170803-222170825 | CCACCCATCCTGTGCAGATATCT | No data | ||
| Right | 922068852 | 1:222170838-222170860 | ACCCTCTCTGCTCCACACCCAGG | No data | ||||
| 922068843_922068856 | 24 | Left | 922068843 | 1:222170803-222170825 | CCACCCATCCTGTGCAGATATCT | No data | ||
| Right | 922068856 | 1:222170850-222170872 | CCACACCCAGGCAGATCTCCAGG | 0: 24 1: 53 2: 144 3: 229 4: 556 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 922068843 | Original CRISPR | AGATATCTGCACAGGATGGG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||