ID: 922074750

View in Genome Browser
Species Human (GRCh38)
Location 1:222232487-222232509
Sequence GCTGCAGCCCTCACCTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922074750_922074751 -2 Left 922074750 1:222232487-222232509 CCAGCTTAGGTGAGGGCTGCAGC No data
Right 922074751 1:222232508-222232530 GCATCATGAACTGCAACACCTGG No data
922074750_922074752 11 Left 922074750 1:222232487-222232509 CCAGCTTAGGTGAGGGCTGCAGC No data
Right 922074752 1:222232521-222232543 CAACACCTGGAGTTCACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922074750 Original CRISPR GCTGCAGCCCTCACCTAAGC TGG (reversed) Intergenic
No off target data available for this crispr