ID: 922076845

View in Genome Browser
Species Human (GRCh38)
Location 1:222253622-222253644
Sequence GGTTTTATGGGCACAGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922076845_922076856 21 Left 922076845 1:222253622-222253644 CCTGATCCTGTGCCCATAAAACC No data
Right 922076856 1:222253666-222253688 CAGCAGAAGCAGTTGGACGTTGG No data
922076845_922076855 14 Left 922076845 1:222253622-222253644 CCTGATCCTGTGCCCATAAAACC No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922076845 Original CRISPR GGTTTTATGGGCACAGGATC AGG (reversed) Intergenic
No off target data available for this crispr