ID: 922076855

View in Genome Browser
Species Human (GRCh38)
Location 1:222253659-222253681
Sequence GCAGAGACAGCAGAAGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922076841_922076855 21 Left 922076841 1:222253615-222253637 CCCTACCCCTGATCCTGTGCCCA No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076839_922076855 25 Left 922076839 1:222253611-222253633 CCCACCCTACCCCTGATCCTGTG No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076842_922076855 20 Left 922076842 1:222253616-222253638 CCTACCCCTGATCCTGTGCCCAT No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076848_922076855 2 Left 922076848 1:222253634-222253656 CCCATAAAACCCCCAGGCTTAGC No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076845_922076855 14 Left 922076845 1:222253622-222253644 CCTGATCCTGTGCCCATAAAACC No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076852_922076855 -9 Left 922076852 1:222253645-222253667 CCCAGGCTTAGCCAGCAGAGACA No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076851_922076855 -8 Left 922076851 1:222253644-222253666 CCCCAGGCTTAGCCAGCAGAGAC No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076849_922076855 1 Left 922076849 1:222253635-222253657 CCATAAAACCCCCAGGCTTAGCC No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076840_922076855 24 Left 922076840 1:222253612-222253634 CCACCCTACCCCTGATCCTGTGC No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076844_922076855 15 Left 922076844 1:222253621-222253643 CCCTGATCCTGTGCCCATAAAAC No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076853_922076855 -10 Left 922076853 1:222253646-222253668 CCAGGCTTAGCCAGCAGAGACAG No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076843_922076855 16 Left 922076843 1:222253620-222253642 CCCCTGATCCTGTGCCCATAAAA No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076846_922076855 8 Left 922076846 1:222253628-222253650 CCTGTGCCCATAAAACCCCCAGG No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data
922076850_922076855 -7 Left 922076850 1:222253643-222253665 CCCCCAGGCTTAGCCAGCAGAGA No data
Right 922076855 1:222253659-222253681 GCAGAGACAGCAGAAGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922076855 Original CRISPR GCAGAGACAGCAGAAGCAGT TGG Intergenic
No off target data available for this crispr