ID: 922082771

View in Genome Browser
Species Human (GRCh38)
Location 1:222313793-222313815
Sequence TTGACCAATTGACAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922082771_922082776 0 Left 922082771 1:222313793-222313815 CCCACCAACTGTCAATTGGTCAA No data
Right 922082776 1:222313816-222313838 GGCTCCTCCCAGCCCTGGCCTGG No data
922082771_922082775 -5 Left 922082771 1:222313793-222313815 CCCACCAACTGTCAATTGGTCAA No data
Right 922082775 1:222313811-222313833 GTCAAGGCTCCTCCCAGCCCTGG No data
922082771_922082785 19 Left 922082771 1:222313793-222313815 CCCACCAACTGTCAATTGGTCAA No data
Right 922082785 1:222313835-222313857 CTGGTTCTGCCCCAGCAGGGAGG No data
922082771_922082782 15 Left 922082771 1:222313793-222313815 CCCACCAACTGTCAATTGGTCAA No data
Right 922082782 1:222313831-222313853 TGGCCTGGTTCTGCCCCAGCAGG No data
922082771_922082783 16 Left 922082771 1:222313793-222313815 CCCACCAACTGTCAATTGGTCAA No data
Right 922082783 1:222313832-222313854 GGCCTGGTTCTGCCCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922082771 Original CRISPR TTGACCAATTGACAGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr