ID: 922085652

View in Genome Browser
Species Human (GRCh38)
Location 1:222344509-222344531
Sequence TGCTATTAGATTGCAGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922085652_922085657 -5 Left 922085652 1:222344509-222344531 CCCTATGCTGCAATCTAATAGCA No data
Right 922085657 1:222344527-222344549 TAGCAAAGGGAGGTTAGTCAAGG No data
922085652_922085659 19 Left 922085652 1:222344509-222344531 CCCTATGCTGCAATCTAATAGCA No data
Right 922085659 1:222344551-222344573 TGCAGACCATCCAAACCCACAGG No data
922085652_922085660 20 Left 922085652 1:222344509-222344531 CCCTATGCTGCAATCTAATAGCA No data
Right 922085660 1:222344552-222344574 GCAGACCATCCAAACCCACAGGG No data
922085652_922085658 -4 Left 922085652 1:222344509-222344531 CCCTATGCTGCAATCTAATAGCA No data
Right 922085658 1:222344528-222344550 AGCAAAGGGAGGTTAGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922085652 Original CRISPR TGCTATTAGATTGCAGCATA GGG (reversed) Intergenic
No off target data available for this crispr