ID: 922092927

View in Genome Browser
Species Human (GRCh38)
Location 1:222414704-222414726
Sequence GCTGAGGATGGGCCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922092927_922092934 1 Left 922092927 1:222414704-222414726 CCTGCTTGTGGCCCATCCTCAGC No data
Right 922092934 1:222414728-222414750 GAGGATACAGCCGGAGGCTTAGG No data
922092927_922092933 -5 Left 922092927 1:222414704-222414726 CCTGCTTGTGGCCCATCCTCAGC No data
Right 922092933 1:222414722-222414744 TCAGCAGAGGATACAGCCGGAGG No data
922092927_922092931 -8 Left 922092927 1:222414704-222414726 CCTGCTTGTGGCCCATCCTCAGC No data
Right 922092931 1:222414719-222414741 TCCTCAGCAGAGGATACAGCCGG No data
922092927_922092936 22 Left 922092927 1:222414704-222414726 CCTGCTTGTGGCCCATCCTCAGC No data
Right 922092936 1:222414749-222414771 GGCCATGACAAAACGAGTAATGG No data
922092927_922092938 27 Left 922092927 1:222414704-222414726 CCTGCTTGTGGCCCATCCTCAGC No data
Right 922092938 1:222414754-222414776 TGACAAAACGAGTAATGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922092927 Original CRISPR GCTGAGGATGGGCCACAAGC AGG (reversed) Intergenic
No off target data available for this crispr