ID: 922093315

View in Genome Browser
Species Human (GRCh38)
Location 1:222418523-222418545
Sequence TGGGTTCTAAGGCATTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922093309_922093315 23 Left 922093309 1:222418477-222418499 CCCATCCAAAGACTGTGATCAAC No data
Right 922093315 1:222418523-222418545 TGGGTTCTAAGGCATTTTGTAGG No data
922093308_922093315 24 Left 922093308 1:222418476-222418498 CCCCATCCAAAGACTGTGATCAA No data
Right 922093315 1:222418523-222418545 TGGGTTCTAAGGCATTTTGTAGG No data
922093311_922093315 18 Left 922093311 1:222418482-222418504 CCAAAGACTGTGATCAACAAATG No data
Right 922093315 1:222418523-222418545 TGGGTTCTAAGGCATTTTGTAGG No data
922093310_922093315 22 Left 922093310 1:222418478-222418500 CCATCCAAAGACTGTGATCAACA No data
Right 922093315 1:222418523-222418545 TGGGTTCTAAGGCATTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922093315 Original CRISPR TGGGTTCTAAGGCATTTTGT AGG Intergenic
No off target data available for this crispr