ID: 922094715

View in Genome Browser
Species Human (GRCh38)
Location 1:222433502-222433524
Sequence CTGTACATACAGGTTAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922094715_922094721 19 Left 922094715 1:222433502-222433524 CCACCCTTAACCTGTATGTACAG No data
Right 922094721 1:222433544-222433566 TTCTCTTACTGTTTCTACTTGGG No data
922094715_922094720 18 Left 922094715 1:222433502-222433524 CCACCCTTAACCTGTATGTACAG No data
Right 922094720 1:222433543-222433565 TTTCTCTTACTGTTTCTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922094715 Original CRISPR CTGTACATACAGGTTAAGGG TGG (reversed) Intergenic
No off target data available for this crispr