ID: 922097511

View in Genome Browser
Species Human (GRCh38)
Location 1:222454962-222454984
Sequence GTGTCAGTACAGAGGAACGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922097506_922097511 12 Left 922097506 1:222454927-222454949 CCTGGGTGACTCGTGACTCGACA No data
Right 922097511 1:222454962-222454984 GTGTCAGTACAGAGGAACGTCGG No data
922097505_922097511 17 Left 922097505 1:222454922-222454944 CCGTGCCTGGGTGACTCGTGACT No data
Right 922097511 1:222454962-222454984 GTGTCAGTACAGAGGAACGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922097511 Original CRISPR GTGTCAGTACAGAGGAACGT CGG Intergenic
No off target data available for this crispr