ID: 922098785

View in Genome Browser
Species Human (GRCh38)
Location 1:222465257-222465279
Sequence CCCTTGCCTGCTTTTTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922098785_922098799 21 Left 922098785 1:222465257-222465279 CCCCAACAAAAAGCAGGCAAGGG No data
Right 922098799 1:222465301-222465323 CCGGCAGCCCCAGTATTACCTGG No data
922098785_922098796 2 Left 922098785 1:222465257-222465279 CCCCAACAAAAAGCAGGCAAGGG No data
Right 922098796 1:222465282-222465304 GGAGGAGGGGGAAACTGGCCCGG No data
922098785_922098795 -3 Left 922098785 1:222465257-222465279 CCCCAACAAAAAGCAGGCAAGGG No data
Right 922098795 1:222465277-222465299 GGGCAGGAGGAGGGGGAAACTGG No data
922098785_922098803 30 Left 922098785 1:222465257-222465279 CCCCAACAAAAAGCAGGCAAGGG No data
Right 922098803 1:222465310-222465332 CCAGTATTACCTGGACCTGCAGG No data
922098785_922098794 -10 Left 922098785 1:222465257-222465279 CCCCAACAAAAAGCAGGCAAGGG No data
Right 922098794 1:222465270-222465292 CAGGCAAGGGCAGGAGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922098785 Original CRISPR CCCTTGCCTGCTTTTTGTTG GGG (reversed) Intergenic
No off target data available for this crispr