ID: 922100471

View in Genome Browser
Species Human (GRCh38)
Location 1:222474010-222474032
Sequence CATCCAGAGAGGCCGCCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922100469_922100471 6 Left 922100469 1:222473981-222474003 CCTGGAGAGGCTGACTCGAGGAA No data
Right 922100471 1:222474010-222474032 CATCCAGAGAGGCCGCCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922100471 Original CRISPR CATCCAGAGAGGCCGCCGAG AGG Intergenic
No off target data available for this crispr