ID: 922101587

View in Genome Browser
Species Human (GRCh38)
Location 1:222481815-222481837
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 777
Summary {0: 16, 1: 9, 2: 27, 3: 59, 4: 666}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922101587_922101603 29 Left 922101587 1:222481815-222481837 CCCCACCCAGCAACTCCCTGGCC 0: 16
1: 9
2: 27
3: 59
4: 666
Right 922101603 1:222481867-222481889 TCTCAACACCACCACGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922101587 Original CRISPR GGCCAGGGAGTTGCTGGGTG GGG (reversed) Intergenic
900016078 1:151058-151080 GGCCAGGGAGTTGCTGGGCTGGG - Intergenic
900046342 1:509652-509674 GGCCAGGGAGTTGCTGGGCTGGG - Intergenic
900068543 1:751364-751386 GGCCAGGGAGTTGCTGGGCTGGG - Intergenic
900104387 1:976137-976159 GGCCAGGGAGATGCAGGATGAGG - Exonic
900158329 1:1212342-1212364 GGACAGGGAGGTGCTGGTGGGGG - Intronic
900187230 1:1338093-1338115 GGCCAGGGGGCAGCCGGGTGGGG + Exonic
900299942 1:1971943-1971965 GCCAAGGGAGAGGCTGGGTGGGG + Intronic
900578201 1:3394482-3394504 GGAGAGGGAGGTGGTGGGTGGGG + Intronic
900597581 1:3489542-3489564 GGGCAGGGACTCCCTGGGTGAGG - Intergenic
900598034 1:3491262-3491284 GGGCAGTGTGTTGCTGGGCGTGG - Intronic
900785651 1:4648422-4648444 GGCCAGGCTGATGTTGGGTGGGG - Intergenic
901373945 1:8824076-8824098 AGGCATGGAGGTGCTGGGTGTGG + Intergenic
901632378 1:10654261-10654283 GGCCATGGTGTAGCAGGGTGGGG - Intronic
902156793 1:14494176-14494198 GGACAGGGACTTGCTGGCTCTGG - Intergenic
902243058 1:15101505-15101527 AGCCAGAGAGTGGATGGGTGGGG - Intronic
903015428 1:20358490-20358512 GGGCAGGCAATTGCAGGGTGGGG - Intergenic
903351147 1:22717248-22717270 GGCCAGGCAGTTGTTGATTGTGG + Intronic
903373501 1:22851815-22851837 GGACAGGGTGTTGCAGGGAGAGG - Intronic
903670171 1:25030879-25030901 GGCCAGGGTGGGGCTGGGTGGGG - Intergenic
903791280 1:25894860-25894882 AGCCAGCCTGTTGCTGGGTGTGG - Intronic
904842847 1:33384646-33384668 GGCCAGGGAGATGGAGAGTGAGG - Intronic
904873668 1:33636993-33637015 GGCCAGGAGGCTGCTGAGTGTGG - Intronic
905561305 1:38929408-38929430 TGCCAGGGCCTTCCTGGGTGAGG - Intronic
905562770 1:38940604-38940626 GGTGAGGGAGTTGCTGGTTAGGG + Intronic
905916827 1:41690317-41690339 GGGCAGGGGATGGCTGGGTGTGG + Intronic
906199027 1:43947486-43947508 GCCCAGGGAGTGGTGGGGTGAGG - Exonic
906251484 1:44314071-44314093 AGCCAGGGACATGCTGGGGGTGG - Intronic
906327305 1:44855134-44855156 GGCCAGGGAGTTCCTGTGGCAGG + Intronic
906505453 1:46375814-46375836 GGCCAGTGCGTGGCTGGGCGCGG + Intergenic
906713661 1:47951473-47951495 GGCCAGGGAGTTCCTTTGTCAGG + Intronic
906962541 1:50427141-50427163 GGCCAGGGAAGGGGTGGGTGCGG - Intergenic
907243108 1:53091474-53091496 GGCCAGGGGGCTGCTGGCTCTGG + Intronic
907418738 1:54332351-54332373 GAGCAGGGAGCTGCTGGGAGGGG + Intronic
907576896 1:55534726-55534748 GCCCTGGGTGATGCTGGGTGTGG - Intergenic
909457377 1:75865554-75865576 TGCCAGGAAGTTGCTAGGTAGGG + Intronic
911045467 1:93624113-93624135 TGGCTGGGAGGTGCTGGGTGTGG - Intronic
912471813 1:109911545-109911567 CGCCAGGGACTTGCTGGCAGAGG + Intronic
912558196 1:110531334-110531356 GGCCCTGCAGCTGCTGGGTGAGG + Intergenic
913182354 1:116334335-116334357 GGGCTGGGAGGTGCTGGGAGAGG - Intergenic
915288475 1:154867724-154867746 GGGCAGGGGGTGGCTTGGTGGGG - Intronic
915479588 1:156175739-156175761 AGCCAGGCAGGTGCTGGGGGAGG - Intronic
915580370 1:156809507-156809529 GGCCAGGGAGGAGTGGGGTGAGG + Intronic
915658280 1:157380049-157380071 GGAAGGGGAGGTGCTGGGTGAGG + Intergenic
917498764 1:175566698-175566720 GGCCAGGCAGCTGCTGAATGAGG + Intronic
917505243 1:175621413-175621435 GGGCAGTGAGTAGCTGAGTGTGG - Intronic
917980044 1:180263485-180263507 GGCCAAGGAGGTGCTGCATGCGG + Intronic
918367711 1:183826310-183826332 GGATAGGGAGTTGCAGGGTTAGG - Intronic
918620316 1:186596168-186596190 GTTCAGGGAGTTGATGTGTGAGG + Intergenic
919265508 1:195259259-195259281 TGTCAGGGAGTTGGTGGGTGGGG - Intergenic
919685439 1:200479642-200479664 GGCCATGGAGAGGCTGGGTTGGG - Intergenic
919802937 1:201364454-201364476 GGCAAGGGAATTCCTGGGGGAGG + Intronic
919907100 1:202085593-202085615 GGGCAGGGCAGTGCTGGGTGAGG + Intergenic
920051675 1:203168144-203168166 GGCCAGAGAGGTGCAGAGTGGGG + Intronic
920262582 1:204699317-204699339 GGCCAGGAAGTGGCAGGGTCAGG - Intergenic
920387101 1:205576909-205576931 GTCCAGGGAGATGCAGGGAGGGG + Intronic
920547019 1:206826619-206826641 AGCCAGGGAGTTCCTGGGGAGGG - Intronic
920565146 1:206967140-206967162 GGCCTGAGAGAAGCTGGGTGAGG + Intronic
920747729 1:208644761-208644783 GGGGAGGGAGCTGCTGGGGGAGG - Intergenic
920747735 1:208644777-208644799 GGGGAGGGAGCTGCTGGGGGAGG - Intergenic
920747741 1:208644793-208644815 GGGGAGGGAGCTGCTGGGGGAGG - Intergenic
922101587 1:222481815-222481837 GGCCAGGGAGTTGCTGGGTGGGG - Intergenic
922101644 1:222482118-222482140 AGCCAGGGAGTTGCTGGGTGGGG - Intergenic
922103899 1:222496736-222496758 GGCCAGGGAGTTGCTGGGCTGGG - Intergenic
922262668 1:223956931-223956953 GGCCAGGGAGTTGCTGGGTGGGG - Intergenic
922262724 1:223957234-223957256 AGCCAGGGAGTTGCTGGGTGGGG - Intergenic
922264220 1:223969267-223969289 GGCCAGGGAGTTGCTGGGCTGGG - Intergenic
922515318 1:226203762-226203784 GGCCTGGTGATTGCTGGGTGGGG - Intergenic
922757840 1:228106311-228106333 GGGCAGGGAGCTGCAGGCTGTGG + Intergenic
923013680 1:230109257-230109279 GTGCAGGGAGGTGCGGGGTGGGG + Intronic
924344507 1:243061932-243061954 GGCCAGGGAGTTGCTGGGTGGGG - Intergenic
924344562 1:243062235-243062257 AGCCAGGGAGTTGCTGGGTGGGG - Intergenic
924346069 1:243074260-243074282 GGCCAGGGAGTTGCTGGGCTGGG - Intergenic
1063299605 10:4840010-4840032 AGCCAGGGAGTGGCTGTGAGTGG + Intronic
1066281496 10:33922549-33922571 GGACAGGTAGTTGCGGGGGGAGG + Intergenic
1066730277 10:38430560-38430582 GGCCAGGGAGTTGCTGGGCTGGG + Intergenic
1066731769 10:38442837-38442859 AGCCAGGGAGTTGCTGGGTGGGG + Intergenic
1066731826 10:38443140-38443162 GGCCAGGGAGTTGCTGGGTGGGG + Intergenic
1067432948 10:46255898-46255920 GGCCAGGCAGTTGCTGGCCCTGG - Intergenic
1067574775 10:47402278-47402300 GGCGTGGGAGTTCCTCGGTGGGG + Intergenic
1067616724 10:47762834-47762856 GGCCAGGGACTGGCTGGGGCGGG - Intergenic
1067630475 10:47960070-47960092 AGCCAGGCAGTTGTTGTGTGGGG - Intergenic
1067936772 10:50619534-50619556 GGCCTGGGGGGTGCTGGGAGGGG + Intronic
1069855652 10:71439588-71439610 GGCCTGTGAGTCACTGGGTGAGG - Intronic
1070100571 10:73382162-73382184 GCCAAGGGAGGGGCTGGGTGTGG - Intronic
1070717357 10:78732440-78732462 GGCTAGGGAGATGCGGAGTGAGG - Intergenic
1070803051 10:79254746-79254768 GGCGGGGGCGTTGGTGGGTGAGG + Intronic
1071136950 10:82464595-82464617 GACCAGGGTGCTGCTGGCTGCGG - Intronic
1071430225 10:85601371-85601393 GGGCAGGGAGTTGCGAGGTGGGG - Exonic
1071503763 10:86221024-86221046 GGCCAGGGAGGTGCTGGCCATGG - Intronic
1072893708 10:99347688-99347710 GGTCAGGGAGTTGAGGGGTAGGG - Intronic
1073036601 10:100568024-100568046 GACCAGGGAGCTGGTGGGGGAGG - Intergenic
1073043248 10:100621515-100621537 CGCCAGGGAGGGGCTGGGCGGGG - Intergenic
1073289914 10:102408509-102408531 GGCCAGAGAGTTGCGGAGTGAGG - Intronic
1073332019 10:102676362-102676384 CGACAGGAAGCTGCTGGGTGGGG - Exonic
1074323972 10:112429952-112429974 GGCCAAGCAGTTGTTGGGGGGGG + Intergenic
1074416505 10:113271960-113271982 GGCCAGGGGGTTGTGGGGTGAGG + Intergenic
1075378354 10:121997729-121997751 GGCCAGGGACATGCTGGGGTAGG + Intronic
1075453786 10:122571569-122571591 GCACAGGGATTTGCTGGGTTGGG - Intronic
1075968421 10:126632559-126632581 GCCCAGTGAATTGCTGGGTGTGG + Intronic
1076207552 10:128615250-128615272 TGCAAGGGTGGTGCTGGGTGAGG + Intergenic
1076609398 10:131711798-131711820 GGCCAGTGTGTGGCTGGGTGCGG - Intergenic
1076890485 10:133280879-133280901 GGCCAGGGCGGTGCTGGGCAGGG + Intronic
1076972668 11:146125-146147 GGCCAGGGAGTTGCTGGGCTGGG - Intergenic
1077119588 11:900695-900717 GGCCAAGGAGGTGCTGGCTTTGG + Intronic
1077120061 11:903172-903194 TGGAAGGGACTTGCTGGGTGGGG - Intronic
1077182945 11:1224548-1224570 GGCCAGGGAGGGGCTGCCTGGGG + Intronic
1077207553 11:1352119-1352141 GGGAGGGGAGTTGGTGGGTGTGG - Intergenic
1077207728 11:1352537-1352559 GGGAGGGGAGTTGGTGGGTGTGG - Intergenic
1078188774 11:9074668-9074690 GGCCCCTGAGCTGCTGGGTGAGG - Intronic
1078737072 11:14030068-14030090 GGCCTCTTAGTTGCTGGGTGAGG + Intronic
1079130761 11:17745630-17745652 GCAGAGGGAGATGCTGGGTGTGG - Intronic
1079993090 11:27266979-27267001 GGCCAGGGAGAAGCTGGAGGAGG - Intergenic
1081410066 11:42747278-42747300 GGCCAGTGAGTGGCCGGGTGCGG + Intergenic
1081540663 11:44032459-44032481 GTCCAGGCAGCTGCAGGGTGCGG + Intergenic
1081954870 11:47082721-47082743 GGACTGGGAGTTTGTGGGTGGGG - Intronic
1082847584 11:57739152-57739174 GGGTAGGGAGTTGCTTGGTGAGG - Exonic
1083511494 11:63213129-63213151 GGTCAGGGAATTTCTAGGTGTGG + Intronic
1083625087 11:64068290-64068312 GGACAGGCGGGTGCTGGGTGGGG - Intronic
1083712637 11:64558694-64558716 GGGCAGGGAGTGGCTGGCAGGGG - Intronic
1083871441 11:65490691-65490713 GGCCAGGTGGGTGCTGGGTGTGG - Intergenic
1084180963 11:67445632-67445654 GACCAAAGAGTGGCTGGGTGAGG - Intergenic
1084265738 11:68004261-68004283 GGCCAGGAGGTGGCTGAGTGGGG - Intronic
1084431403 11:69113483-69113505 GAACAGGGAGTTGCCGGGAGGGG - Intergenic
1084700695 11:70784731-70784753 GTCCAGGGAGATGCTGGGTGGGG + Intronic
1084934262 11:72578672-72578694 AGGCAGGGAGTGGCTGGGTTGGG + Intronic
1084984419 11:72855318-72855340 GACCAAAAAGTTGCTGGGTGTGG + Intronic
1085304389 11:75476892-75476914 GGCCAGGGGGTGGCAGGGTGTGG - Intronic
1085316040 11:75545426-75545448 GGTCATGGAGATGCTGGGTGAGG + Intergenic
1086743122 11:90392036-90392058 GGCTAGGTAGGAGCTGGGTGAGG + Intergenic
1086942556 11:92813556-92813578 GTGCAGGGAGTGGGTGGGTGTGG - Intronic
1087483727 11:98734465-98734487 GGCCAGGCAGTGGGAGGGTGGGG - Intergenic
1087845016 11:102962950-102962972 GGCCAGGGAGGACCTGGCTGAGG + Intergenic
1088123256 11:106394403-106394425 GGGCAGGGTGTTGCAGGATGTGG - Intergenic
1088282713 11:108151551-108151573 GGCCAGGGAGGTGGAGGTTGTGG + Intergenic
1089255618 11:117192454-117192476 GGCCCTGGAGTCACTGGGTGAGG + Intronic
1089390473 11:118098465-118098487 GGCTAGGGACTTGCTGTTTGTGG + Intronic
1090022542 11:123140678-123140700 GGCCAGGGAATTCCTTGCTGTGG + Intronic
1090414146 11:126529160-126529182 GGCGCGGGAGGTACTGGGTGAGG + Intronic
1090437470 11:126698613-126698635 GGCCAGGGTTCTGCTGCGTGAGG + Intronic
1090659010 11:128867731-128867753 GACCAGGGAGGTGGTGGGGGAGG + Intergenic
1091635140 12:2191153-2191175 TGCCAGGGAGATGTGGGGTGTGG + Intronic
1092371102 12:7917114-7917136 GGCCAGGGTGTGGCTGGGGCAGG - Intergenic
1092529341 12:9331699-9331721 GGCCGGGGAGTCACTGTGTGGGG + Intergenic
1093087450 12:14882406-14882428 GAACAGGGAGAGGCTGGGTGCGG + Intronic
1093164299 12:15788506-15788528 GGGCAGGGAGTACATGGGTGGGG + Intronic
1094667255 12:32533093-32533115 GGGCAGTGAATTGCTGGGTTAGG - Intronic
1096069080 12:48764744-48764766 GGCCAAGCAGTTGCTGGGCTGGG + Intergenic
1096773867 12:53952493-53952515 GGCCTGGGAGTTGCCTGCTGGGG + Intergenic
1097189482 12:57212627-57212649 GGCCAGGGAAGGGCTGGCTGGGG - Exonic
1100879868 12:99004650-99004672 AGCCAGGTGGGTGCTGGGTGGGG + Intronic
1101956536 12:109216989-109217011 GGCCAGAAAGTGGCTGGGTGCGG + Intronic
1102043780 12:109817182-109817204 GGCCAGGGGGTTGCTGAGGCAGG + Intronic
1102082804 12:110112134-110112156 GGGAAGGGAGAGGCTGGGTGTGG - Intergenic
1102173263 12:110858263-110858285 TGCCAGGGAGTTGCTGGCAAAGG + Intronic
1102504462 12:113374886-113374908 GGCCAGGGAGCAGCTTGATGAGG - Exonic
1104221111 12:126785909-126785931 GGCCTGGGAGGCACTGGGTGGGG + Intergenic
1104267153 12:127244275-127244297 GGGCAGGGAGCAGCTGGGAGGGG + Intergenic
1104284619 12:127413765-127413787 AGCCATGGAGTAGCTGTGTGAGG + Intergenic
1104745996 12:131210878-131210900 GGCCTGTGAGCAGCTGGGTGGGG + Intergenic
1104748977 12:131226633-131226655 AGCCAGCGAGCTGCTGAGTGTGG + Intergenic
1104899736 12:132182362-132182384 GCCCAGGGTGTTGGTGGGAGAGG + Intergenic
1104967384 12:132514355-132514377 GGCCAGAGAGATCCTGGGTCAGG - Intronic
1105922949 13:24982507-24982529 GGCCAGTGCTTTGCAGGGTGGGG - Intergenic
1106665532 13:31847016-31847038 TGCCGGGGAGTGGGTGGGTGGGG + Intergenic
1107553695 13:41499420-41499442 GGCTAGTGAGTAGCTGGGGGAGG - Intergenic
1108727877 13:53201531-53201553 GGCCAGGTAGGCGCTGGGCGGGG - Intergenic
1109070774 13:57764183-57764205 GACCAGGGAGTTGGTGGGGTCGG - Intergenic
1110251427 13:73384957-73384979 GGACAGCCAGTTGCGGGGTGGGG + Intergenic
1111976139 13:94968450-94968472 GGCCCGGGAGTTGCAGGGCCTGG - Intergenic
1113577108 13:111402631-111402653 GCCCAGGGAGTGGCTCTGTGAGG + Intergenic
1113642363 13:111967064-111967086 GGCTGGGGAGCTGCAGGGTGAGG - Intergenic
1114517383 14:23308679-23308701 GGCCAGAGAGGAGCTGGGTATGG + Intronic
1114522632 14:23348606-23348628 GGCAGGGGAGTTGGTGGGGGTGG - Exonic
1117060385 14:51956461-51956483 GGCCAGAGAATTGCTTGGTGTGG + Intronic
1117163446 14:53011337-53011359 AGCGAGGGAGTGGCTGGCTGGGG - Intergenic
1119437947 14:74610543-74610565 GGGCAGTGAGGGGCTGGGTGGGG - Intronic
1119492782 14:75051188-75051210 GGCCAGGGAGGGGCTGGGCCTGG - Intronic
1119539460 14:75428667-75428689 GGCCAGGGAGGTGCGGGGTTGGG + Intronic
1120022700 14:79548613-79548635 GGCCTGGGAGTTGCAGTGAGTGG + Intronic
1120828434 14:88976038-88976060 AGCCTGGGAGCTCCTGGGTGAGG + Intergenic
1121439010 14:93937113-93937135 TGCCAGGGCCTTGCTGGGTGAGG - Intronic
1121529352 14:94641544-94641566 GGCCAGGGAGATGCTCACTGGGG - Intergenic
1121650169 14:95552350-95552372 TGCCAGTGATTTGTTGGGTGGGG + Intergenic
1122378693 14:101286339-101286361 GGCAGGGGAGTGGCGGGGTGTGG + Intergenic
1122689053 14:103522956-103522978 GGCCAGGGTGTTGGGGGCTGCGG - Exonic
1122757961 14:103997565-103997587 GGCCAGGGAGCAGCTGGCGGGGG + Intronic
1122873351 14:104651365-104651387 GGCCAGGGAGGTGAGGGCTGTGG - Intergenic
1122899930 14:104778225-104778247 GGACAGGGCCTTGCTGGGGGTGG - Intronic
1123019603 14:105391523-105391545 GGCCAGGCAGCTCCTGGGGGTGG - Intronic
1202929009 14_KI270725v1_random:22855-22877 AGCCAGGGAGGTGCCGGGAGGGG - Intergenic
1123684251 15:22786428-22786450 GGCCGGTGAGGCGCTGGGTGGGG - Intronic
1123885349 15:24721498-24721520 GGCCAGGAAGTGTGTGGGTGTGG + Intergenic
1123990042 15:25676339-25676361 GGCCAGGGAGGCGCGGGGAGAGG - Intergenic
1125064720 15:35468775-35468797 GGCCAGGCAGAGGCTGGGCGCGG + Intronic
1127158057 15:56150021-56150043 GGTCGGGGGGTTGCGGGGTGGGG + Intronic
1127498087 15:59531191-59531213 GGCCAGAGGGTTCCTGGGTGAGG - Intergenic
1127816305 15:62612088-62612110 GGGCAGGTAGATGCTGGGTCAGG - Intronic
1127823466 15:62682092-62682114 GGCCAGGGAGTTGGGAAGTGTGG - Intronic
1127978738 15:64018481-64018503 GGGCAGGGAGTTGGAGTGTGGGG - Intronic
1128245126 15:66127794-66127816 GGGCAGGGTGTTGCTGGGGAAGG - Intronic
1128709469 15:69860953-69860975 AGCCAGGGAGGCGCTGGCTGGGG - Intergenic
1128741868 15:70089376-70089398 GGACTGGGATGTGCTGGGTGTGG - Intronic
1129104415 15:73296307-73296329 GGCCAGGGAGAAGCTGGGCAGGG - Intronic
1129182698 15:73887095-73887117 GGGCAGGGCATTGATGGGTGGGG - Intronic
1129270216 15:74415656-74415678 GGCTGGGCTGTTGCTGGGTGTGG - Intronic
1129365522 15:75051612-75051634 TGCCAAGGAGGTGCTGAGTGGGG + Intronic
1129756896 15:78104173-78104195 GGCCTGGGGGTTGTTGGGAGTGG - Exonic
1129813282 15:78528510-78528532 GGCAAGGAACTGGCTGGGTGTGG + Intronic
1129840305 15:78739576-78739598 GGCCAGGTGGCTGTTGGGTGGGG - Intergenic
1129937569 15:79463419-79463441 GCCCAGGGAGTTGAAGGGTGTGG - Intronic
1130540512 15:84817889-84817911 AGCCAGGGAGTAGCAGGGTAGGG - Intronic
1131077301 15:89503368-89503390 AGCCAGGGAGAGGCAGGGTGTGG + Intergenic
1131087148 15:89586702-89586724 TGGCAGGGAGTTGCTGGTAGAGG + Intronic
1131282532 15:91033049-91033071 GGCAAGGGAGTTACTGAGGGCGG - Intergenic
1131508775 15:93037416-93037438 GGCCAGGGCGTGGCGGGGTAGGG + Intronic
1132577468 16:670597-670619 GGCCCAGGGGGTGCTGGGTGGGG + Intronic
1132670119 16:1099074-1099096 GGCCAGGGAGGGGGAGGGTGTGG - Intergenic
1132712069 16:1273342-1273364 GGCCAGTGTGTTCCTGAGTGTGG - Intergenic
1132744278 16:1430281-1430303 AGCCAGGGAGTCGGTGGGAGCGG + Intergenic
1132847161 16:2005923-2005945 GGCCAGGGAGCAGCTGGGGGTGG + Intronic
1132855905 16:2044443-2044465 GGCCAAGGAGCTGCTGGGACTGG + Intronic
1132957315 16:2601804-2601826 GGGCAGGGAGTTGGGGGGGGCGG - Exonic
1133283780 16:4681262-4681284 AGCCAGGGAGGGGCTGGTTGAGG + Intronic
1133737551 16:8627452-8627474 GGCCAGGGAGGGGCTGTCTGTGG - Intronic
1133976269 16:10601754-10601776 GGCCAGGGAGGGGCAGGGTGGGG - Intergenic
1135158008 16:20070861-20070883 GGGAAGGGAGGTGATGGGTGGGG + Intronic
1135197341 16:20405184-20405206 GGCCAGGGTGGTGATGCGTGAGG - Intergenic
1135877262 16:26214295-26214317 GGCCAGGGAGTTGAAAGGTTGGG + Intergenic
1135880283 16:26249009-26249031 GGCCGGGGAGTTGAGGGGAGAGG - Intergenic
1136294704 16:29294992-29295014 GGCCATGCAGGGGCTGGGTGAGG + Intergenic
1136625510 16:31459590-31459612 GGCCGGGGAGGCTCTGGGTGGGG + Exonic
1136712718 16:32253361-32253383 GGGCTGGGAGATGCAGGGTGAGG - Exonic
1136755198 16:32676068-32676090 GGGCTGGGAGATGCAGGGTGAGG + Exonic
1136777993 16:32881790-32881812 GGCCCTGGATTTGCAGGGTGGGG + Intergenic
1136812915 16:33194301-33194323 GGGCTGGGAGATGCAGGGTGAGG - Exonic
1136819391 16:33304381-33304403 GGGCTGGGAGATGCAGGGTGAGG - Exonic
1136825954 16:33360916-33360938 GGGCTGGGAGATGCAGGGTGAGG - Exonic
1136831020 16:33459687-33459709 GGGCTGGGAGATGCAGGGTGAGG - Exonic
1136892629 16:33979724-33979746 GGCCCTGGATTTGCAGGGTGGGG - Intergenic
1137566854 16:49538644-49538666 GGCCAGGAGGAAGCTGGGTGCGG - Intronic
1138460725 16:57146216-57146238 TGCCATGGAGTTCCTGGATGGGG + Exonic
1138530278 16:57630996-57631018 CGCCAGGCAGGTGCTGTGTGGGG + Intronic
1139827184 16:69766522-69766544 GGTCAGGGTGGTGGTGGGTGTGG - Intronic
1140482170 16:75267582-75267604 GGCCAGGGTGGTGGTGGGTGGGG - Intronic
1141539161 16:84705519-84705541 GGCACAGGAGTGGCTGGGTGTGG - Intronic
1141620604 16:85235059-85235081 GGGCGGGGTGTTCCTGGGTGGGG + Intergenic
1141637153 16:85320210-85320232 GACCAGGGCCCTGCTGGGTGGGG - Intergenic
1141639197 16:85331836-85331858 AGACAGGGAGTAGCTGGGCGCGG - Intergenic
1141771895 16:86094501-86094523 GGCCTGGGAGCTGCTGGATTGGG + Intergenic
1142126255 16:88412060-88412082 GGCTAGGGAGGTGCAGGGGGCGG + Intergenic
1142235350 16:88919840-88919862 GGCCCAGGAGTTGCAGTGTGGGG - Intronic
1142288336 16:89180658-89180680 GACCAGTGGGTTGCTGGCTGTGG - Intronic
1142318322 16:89363980-89364002 AGCCCGGGAGTTGGAGGGTGTGG + Intronic
1142359243 16:89619013-89619035 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142359270 16:89619074-89619096 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142359282 16:89619104-89619126 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142359310 16:89619165-89619187 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142359351 16:89619256-89619278 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142359379 16:89619316-89619338 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142359464 16:89619498-89619520 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142447581 16:90151397-90151419 GGCCAGGGAGTTGCTGGGCTGGG + Intergenic
1202991492 16_KI270728v1_random:17271-17293 GGGCTGGGAGATGCAGGGTGAGG - Intergenic
1203057340 16_KI270728v1_random:936407-936429 GGGCTGGGAGATGCAGGGTGAGG + Intergenic
1203080411 16_KI270728v1_random:1143899-1143921 GGCCCTGGATTTGCAGGGTGGGG + Intergenic
1142459912 17:83926-83948 GGCCAGGGAGTTGCTGGGCTGGG - Intergenic
1142605965 17:1081179-1081201 GTCCAGGTAGTTCCTGGGTTGGG + Intronic
1142877776 17:2862516-2862538 GGGCAGGGAGTTGGGGGGCGTGG - Intronic
1143555076 17:7654929-7654951 GGCCAGGGCGTTGGTGGAGGAGG - Intronic
1143633170 17:8150275-8150297 GGCAATGGAACTGCTGGGTGGGG + Exonic
1143776762 17:9204687-9204709 GGGTAGGGAGTTGCTTAGTGGGG - Intronic
1144728875 17:17515367-17515389 GGCCAGGGAGCGGGTGGGAGAGG + Intronic
1144798588 17:17910139-17910161 GGTCAGGGAGTAGCAGGGTGGGG + Intronic
1144860620 17:18299133-18299155 GGCCAAGCAGTGGTTGGGTGTGG + Intronic
1146331688 17:31933118-31933140 GGCATGAGAATTGCTGGGTGTGG - Intergenic
1146883687 17:36457388-36457410 GGCCTGGGCGGTGGTGGGTGAGG - Intergenic
1147245292 17:39116335-39116357 CGCTAGGGAGGTGCTGGGGGCGG - Intronic
1147341085 17:39753767-39753789 GGCCAGGGGGTGGCTGGGTAAGG + Intergenic
1147384889 17:40075290-40075312 GGCCAGGGAGAGGGTGGGGGTGG + Intronic
1149579702 17:57741088-57741110 AGCCAAGGAGAGGCTGGGTGTGG - Intergenic
1150140667 17:62725717-62725739 TGCCAGGAAGTTGGTGGGGGTGG + Intronic
1150207697 17:63421272-63421294 GGCCTGGGAGTTGGCGGGTGCGG - Exonic
1150738392 17:67759813-67759835 GGTCAGGGGGTGACTGGGTGTGG - Intergenic
1151624879 17:75270599-75270621 GCCCAGGAAGATGCCGGGTGAGG + Intronic
1152589575 17:81204789-81204811 GGCCAGGCTGGTGCTGGGCGTGG - Intronic
1152786592 17:82251140-82251162 GTCCATGGAATTCCTGGGTGTGG - Intronic
1152814005 17:82397013-82397035 GGCCAGGGAGCAGCTGAGGGAGG + Intronic
1153018158 18:602922-602944 GGTCAGAGAGTTTCAGGGTGGGG + Intronic
1153836683 18:8970015-8970037 GCCAAGGAAATTGCTGGGTGAGG + Intergenic
1154172314 18:12060902-12060924 GTGCAGGGAGGTGCTTGGTGGGG + Intergenic
1155791172 18:29972119-29972141 TGGAAGGGAGTTGCTGGGAGGGG - Intergenic
1156760614 18:40584100-40584122 GGGCAGGGAGGTGCTGGGAAGGG - Intergenic
1157535101 18:48452143-48452165 GGCCAGGGAAATGCTGGGAAGGG - Intergenic
1158494478 18:57942144-57942166 GGCCAGGGAGCTGCAGGGATGGG + Intergenic
1158583622 18:58708261-58708283 AGACAGGGAGTTGGTGAGTGAGG + Intronic
1159629756 18:70736061-70736083 GGAAAGGGAATTCCTGGGTGAGG - Intergenic
1160649627 19:216434-216456 GGCCAGGGAGTTGCTGGGCTGGG - Intergenic
1160824785 19:1074531-1074553 GACCAGGGAGCTGGTGGCTGGGG + Intronic
1160989456 19:1854522-1854544 GGGCAGCGAGTCGCTGGGGGAGG + Exonic
1161129335 19:2579004-2579026 GGCCAGGAAATGGCTGGGAGAGG + Intronic
1161199324 19:3005807-3005829 GGCCAGGGCGTAGCAGGCTGGGG + Exonic
1161249881 19:3274847-3274869 GGACAGGGAGTAGCGAGGTGGGG + Intronic
1161389264 19:4012742-4012764 GGGCAGGGCTTTGCTGGGAGGGG + Intronic
1161619574 19:5291043-5291065 GCTCAGGGAGGGGCTGGGTGGGG + Intronic
1161654759 19:5507440-5507462 GGCCAGGGAGTTCCTGGACCCGG - Intergenic
1161983122 19:7640823-7640845 GCCTAGGGTGTTGGTGGGTGGGG + Intronic
1162030196 19:7914015-7914037 GGCCAGGGGTCTGCCGGGTGGGG + Exonic
1162054133 19:8052699-8052721 GGGCAGGGGGTGGCTGGGTGGGG + Intronic
1162057247 19:8071996-8072018 GGCCAGGGAATGGGTGAGTGTGG - Intronic
1162464834 19:10833360-10833382 AGCCAGTGAGTGGCAGGGTGAGG - Intronic
1162470322 19:10869273-10869295 GGTCCTGGAGTTGCTGGGGGTGG - Exonic
1162675523 19:12295234-12295256 GGACAGGGGGTGGGTGGGTGGGG + Intergenic
1162985559 19:14267111-14267133 GCCCAGGGGGTCTCTGGGTGGGG + Intergenic
1163050214 19:14677516-14677538 GGCCAGAGAGATGAGGGGTGGGG + Intronic
1163251296 19:16127819-16127841 GGGCATGGAGTTGCTGGGGATGG - Intronic
1163322082 19:16580811-16580833 GGTCAGAGAGATGCCGGGTGAGG - Intronic
1163428014 19:17249807-17249829 TCCCAGGGAGATGCTGGGTTTGG - Exonic
1163617793 19:18340187-18340209 GGCCAGGAAGTTGGCGGGGGTGG - Intergenic
1163679066 19:18670142-18670164 GGCCAGGGAGTGGCAGGGCGCGG - Exonic
1163718391 19:18885863-18885885 GGCCAGGGATTTGCAGGGAGTGG - Intronic
1165095555 19:33407928-33407950 GGCCCGGGGGTGGCTGGCTGGGG + Intronic
1165135007 19:33662403-33662425 GGCAAGGATGTAGCTGGGTGTGG - Intronic
1165674361 19:37708569-37708591 AGCCTGGGATTGGCTGGGTGCGG + Intronic
1165826019 19:38706238-38706260 GGCCAGGGAGGGGCTGACTGAGG - Intronic
1166008455 19:39924258-39924280 GGCCATGGAGTTGGAGGGTGGGG - Intronic
1166075801 19:40413250-40413272 GTCCCGGGAGGTGCTGGGAGGGG - Intronic
1166104546 19:40590829-40590851 GGTGAGGGAGATGCGGGGTGAGG - Exonic
1166214671 19:41327531-41327553 GGGCAGGAAGCTGCTGGGGGAGG - Intronic
1166299452 19:41905832-41905854 GACCAGAGGGATGCTGGGTGAGG + Intronic
1166317641 19:41997986-41998008 GGCCAGTGAGCTGTTGAGTGTGG - Intergenic
1166631234 19:44409872-44409894 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1166631355 19:44410461-44410483 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1166632114 19:44415987-44416009 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1166665964 19:44680615-44680637 GACCAGTGAGGAGCTGGGTGTGG - Intronic
1166668747 19:44697478-44697500 GGCCAGGGAGGTGGAGGATGGGG + Intergenic
1166768525 19:45266413-45266435 GGTCAAGGGGGTGCTGGGTGTGG - Intronic
1166934344 19:46321917-46321939 GGCCAGCGGGGTGCTGGGAGTGG - Exonic
1167342739 19:48925467-48925489 GGCCAGGGATGGGCAGGGTGGGG + Intergenic
1167587770 19:50384524-50384546 GGCCAGGGGTTTCCTGGGCGAGG + Intronic
1167780204 19:51594098-51594120 GGGCAAGGACTTGCGGGGTGGGG - Intergenic
1168277793 19:55286746-55286768 GGCCAGGGGGTGGCTGGCAGAGG + Intronic
1168545360 19:57245318-57245340 GGTCAGGGAAGGGCTGGGTGAGG - Intronic
1168723695 19:58569460-58569482 TCCCTGGAAGTTGCTGGGTGGGG - Intronic
1202648893 1_KI270706v1_random:163153-163175 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1202649244 1_KI270706v1_random:165847-165869 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1202649373 1_KI270706v1_random:166435-166457 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
925100840 2:1244028-1244050 GGCCAGGGTGGTGGTGGGGGTGG + Intronic
925389226 2:3484217-3484239 GGCTAGGGGCTTGCTGGGTGGGG - Intronic
925642578 2:6000451-6000473 GGACACAGAGGTGCTGGGTGGGG - Intergenic
927824909 2:26301595-26301617 GGTCAGGGAATTTCTAGGTGCGG + Intergenic
927865249 2:26583755-26583777 GGGCTGGGAGTTGGTGGCTGGGG - Intronic
927886705 2:26723276-26723298 TTCCAGGGAGATGCGGGGTGGGG - Intronic
928006434 2:27566389-27566411 GGCAATGTAGTTTCTGGGTGGGG + Intronic
928317562 2:30257870-30257892 AGCCAGGGGGTTAGTGGGTGAGG + Exonic
931875609 2:66508497-66508519 GCCCAGGAAGTTGCAGGGAGAGG + Intronic
932722498 2:74148033-74148055 GGCCAGGGGATGGCGGGGTGGGG - Intergenic
932759448 2:74429917-74429939 GCCCAGGGAGCTGCTGAGTTTGG + Exonic
932766699 2:74475054-74475076 GGTCAGGGAGTTGCTGGAAGAGG - Exonic
934541440 2:95178515-95178537 CCACAGGGAGATGCTGGGTGTGG + Intronic
934708409 2:96500433-96500455 GGCCATCGAGCTGCTGGGTGAGG - Exonic
934715267 2:96539356-96539378 GGCCAGGCAGTGGGTGGATGCGG - Intronic
934762723 2:96865280-96865302 GCCCAGGAAGTTGTTGAGTGTGG + Exonic
935617641 2:105102561-105102583 GGCCAGGGCATTGCTGGGGAGGG + Intergenic
935618371 2:105108534-105108556 GCGCAGGGAGTTGCTGGGGCCGG - Intergenic
935670758 2:105555231-105555253 GGGTAGGGAGTTGTTGGGTTTGG + Intergenic
935754925 2:106269725-106269747 GGGCAGGAAGTTCCTGGGAGTGG + Intergenic
935785100 2:106541521-106541543 GGCCAGGTGATTGCTGGTTGTGG - Intergenic
936071088 2:109371806-109371828 GGCCAGAGAGCTGCTATGTGTGG + Intronic
937225904 2:120368551-120368573 TGCCAGGCAGTGGCTGGGTGAGG + Intergenic
937272297 2:120660851-120660873 GGCCGGGGAGGAGCTGGGTCAGG + Intergenic
937911115 2:127076017-127076039 GGGCCGGGAGTAGCTGGGAGAGG - Intronic
937911125 2:127076057-127076079 GGCCTGGGAGTAGCTGGGAGAGG - Intronic
938541627 2:132288037-132288059 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
938806761 2:134813404-134813426 GGCCAAGGAGTGGCTGTTTGTGG - Intergenic
940677814 2:156746571-156746593 GGGGAGGCAGTTTCTGGGTGTGG - Intergenic
940911803 2:159216012-159216034 TGCAAGTGGGTTGCTGGGTGGGG + Intronic
941099573 2:161281627-161281649 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
942173668 2:173310653-173310675 GGCCAGGGAGAGGTTGGGTTGGG + Intergenic
942602728 2:177657953-177657975 GGCCAGGAAGCTGCTGGGGGTGG + Intronic
943588999 2:189774849-189774871 GGCCAGGTAGGAGTTGGGTGGGG + Intronic
946238804 2:218341618-218341640 GGTCAGGGACTTACTGGGTGAGG - Exonic
946374428 2:219299518-219299540 GGCAAGGAAGATGCTGGGTGGGG + Intronic
946412248 2:219521243-219521265 GGCCACGGGGCTGCTGAGTGGGG - Intronic
946627406 2:221628588-221628610 GGCCAGGCAGTAGCTGGAGGTGG - Intergenic
947765129 2:232633223-232633245 GGCCCGGGACAGGCTGGGTGGGG - Exonic
947828120 2:233120191-233120213 GACCTGAAAGTTGCTGGGTGTGG + Intronic
948189003 2:236044224-236044246 GGCCTGGGACATGCTGGGTTGGG - Intronic
948426929 2:237894449-237894471 GGCCAGGGCGAGGCTGGCTGTGG + Intronic
948684593 2:239662417-239662439 GGGCAGGGAGGCGGTGGGTGTGG + Intergenic
948709240 2:239815210-239815232 GGCATGGGAGGTGCTGGTTGTGG + Intergenic
948711311 2:239827404-239827426 TGGCAGGGAGCTGCTGGGGGTGG - Intergenic
948829565 2:240591692-240591714 TGCCAGAGAGTTTCTGTGTGTGG + Intronic
949021721 2:241744538-241744560 GGGCAGTGAGCTGCTGTGTGTGG + Intronic
949030903 2:241796829-241796851 GGTCAGCTAGTGGCTGGGTGGGG + Intronic
1168764224 20:371108-371130 GGCCAGGCAGGTGCTGAGTCAGG - Intronic
1169091123 20:2862028-2862050 GGGAAGGGAGTTGGTGAGTGAGG - Intronic
1169411876 20:5377841-5377863 GCCTGGGGAGTTGCTGGGGGTGG + Intergenic
1169663292 20:8005455-8005477 GGGCAGGGAAGTGCTGGGAGGGG + Intronic
1169689232 20:8311756-8311778 GGCCAAGGAGGTGGTGGCTGAGG + Intronic
1170435052 20:16317961-16317983 GGCTGTGGAGTTGCTGGCTGTGG - Intronic
1170912011 20:20582065-20582087 GGCCATGGAGGAGCTGGGTTTGG - Intronic
1171392910 20:24812455-24812477 GGCATGGGAGCTGCTGGGTGGGG - Intergenic
1171494963 20:25548934-25548956 GGCCTGGGTGAGGCTGGGTGTGG - Intronic
1171494995 20:25549034-25549056 GGCCTGGGTGAGGCTGGGTGTGG - Intronic
1171495013 20:25549084-25549106 GGCCTGGGTGAGGCTGGGTGTGG - Intronic
1171495031 20:25549134-25549156 GGCCTGGGTGAGGCTGGGTGTGG - Intronic
1171495049 20:25549184-25549206 GGCCTGGGTGAGGCTGGGTGTGG - Intronic
1172321124 20:33995567-33995589 GGCAAGGGAGTTTCTGGGCCAGG + Intronic
1172583257 20:36064832-36064854 GGGCAGAGAGTTGCTGGAGGCGG - Intergenic
1172591184 20:36119310-36119332 GGGCAAGGTGTGGCTGGGTGTGG + Intronic
1172700663 20:36851996-36852018 GGCCTGGGTGTTGCTGGGCTGGG - Intronic
1172767595 20:37359020-37359042 GGCCTGGGCCATGCTGGGTGGGG + Intronic
1172964805 20:38826803-38826825 GGCCATGGAGTTCCTGGTAGTGG + Intronic
1173373305 20:42459844-42459866 GGCAGGTGAATTGCTGGGTGTGG - Intronic
1173555739 20:43964320-43964342 GGCCAGGAAGATGCCGGGGGAGG - Intronic
1173928474 20:46798620-46798642 GGACAGAGGGTTCCTGGGTGAGG - Intergenic
1173938298 20:46888093-46888115 GGCCAGCGTGGAGCTGGGTGAGG + Intergenic
1174342416 20:49906216-49906238 GGCCGGGCCGTTGCTGGGGGAGG + Exonic
1174369562 20:50077488-50077510 GGCCAGGCAGGGGCCGGGTGCGG + Intergenic
1174476955 20:50802369-50802391 GGCAAGGCAGGTGCTGGGAGAGG + Intronic
1174656751 20:52178091-52178113 AGCCAGGGAGTGGTTGGGTCAGG - Intronic
1175207293 20:57321039-57321061 GTTCAGGGAGTTGGTGGGGGTGG + Intergenic
1175296661 20:57913384-57913406 GGCCAGGGAGTCTGTGGGAGTGG + Intergenic
1175497021 20:59422362-59422384 TGCAAGGCAGGTGCTGGGTGGGG + Intergenic
1175550850 20:59816484-59816506 AGCCAGTGAGTAGCTGAGTGAGG + Intronic
1175721945 20:61293009-61293031 GGCCTGGCTGTGGCTGGGTGTGG + Intronic
1175722018 20:61293327-61293349 GGACAGGGAGGTGCAGAGTGAGG + Intronic
1175953991 20:62598892-62598914 GGGCTGGGTGTGGCTGGGTGTGG + Intergenic
1176074277 20:63241384-63241406 CGCCTGGGGGGTGCTGGGTGGGG + Exonic
1176151862 20:63595565-63595587 GGCCAGGGTGGGGCTGGGTCAGG + Intronic
1176165672 20:63672218-63672240 GGGCAGGGAACTGCTGGGTCTGG + Intronic
1176204170 20:63879141-63879163 GGCCAGGGAGGCGCTGGTGGTGG + Intronic
1176591030 21:8651442-8651464 AGCCAGGGAGGTGCCGGGAGGGG - Intergenic
1176602448 21:8806111-8806133 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1176602929 21:8809388-8809410 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1176611780 21:8990636-8990658 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1178199777 21:30390593-30390615 GGGCAGGGAAGTGCTGGGTAGGG + Intronic
1178702048 21:34841817-34841839 GGCTAGGGACTGGCTGGATGTGG - Intronic
1179326028 21:40346895-40346917 TGCCAGGTGTTTGCTGGGTGGGG - Intronic
1179543766 21:42100913-42100935 GGGCATGGGGTTGGTGGGTGGGG - Intronic
1179646523 21:42779422-42779444 GGGCAGGGAGTCCCAGGGTGGGG - Intergenic
1179932988 21:44583224-44583246 GGGGAGGGAGGTGCTGGGAGGGG + Intronic
1180030543 21:45203511-45203533 AGCCTGGGAGTTGCTGTGTCTGG - Intronic
1180071264 21:45436856-45436878 GACTGGGGAGTTGCTGGCTGGGG + Intronic
1180158589 21:45989336-45989358 TGCCAGGGAGGGGCTGGGTGGGG + Intronic
1180246329 21:46550478-46550500 GGCTGGGGAGATGCTGGGTGGGG - Intronic
1180273858 22:10628475-10628497 AGCCAGGGAGGTGCCGGGAGGGG - Intergenic
1180297941 22:10961583-10961605 AGCCAGGGAGCAGCTGCGTGAGG - Intergenic
1180344733 22:11697664-11697686 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1180345215 22:11700945-11700967 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1180352556 22:11816658-11816680 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1180352687 22:11817246-11817268 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1180352995 22:11819186-11819208 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1180385250 22:12173171-12173193 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1180385376 22:12173757-12173779 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1180385565 22:12175111-12175133 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1180385699 22:12175699-12175721 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1181490688 22:23259078-23259100 GGCCAGGGAGTAGGCGGGAGTGG + Intronic
1181571240 22:23768617-23768639 GGCCAGGGACTAGGTGGGGGCGG - Intronic
1182023418 22:27099769-27099791 GTCCAGGGCGTTGCTGAGTAGGG + Intergenic
1182443581 22:30377701-30377723 GGCCTGGGAGTTCCTGAGGGAGG + Intronic
1182488206 22:30652209-30652231 GCCCAGTCAGTTCCTGGGTGGGG + Intronic
1182490090 22:30665924-30665946 TTCCAGGGAGGGGCTGGGTGGGG + Intronic
1182522102 22:30890557-30890579 GGCCAGGGAGGTGATGGCTTGGG + Intronic
1182635702 22:31725103-31725125 AGAAAGGGACTTGCTGGGTGCGG + Intronic
1182689231 22:32144986-32145008 GGCCAGGGATATGCGGGTTGGGG + Intergenic
1183270527 22:36859897-36859919 TGGCAGGGAGTTACTGGGTGTGG + Intergenic
1183348499 22:37320831-37320853 GGCCAGGGCATTTCTGGATGGGG - Intergenic
1183356373 22:37361982-37362004 GACCAAGGAGTAGCTGCGTGTGG - Intergenic
1183371321 22:37434045-37434067 CTCCAGGGAGATGCTGGGGGTGG + Intergenic
1183603956 22:38857971-38857993 GGCCTGAGAGTTGTAGGGTGGGG - Intergenic
1184155414 22:42663572-42663594 GCTCTGGGAGCTGCTGGGTGAGG + Intergenic
1184164347 22:42719008-42719030 GGCTTGGGAGTTGCTAGCTGGGG + Intronic
1184493716 22:44825412-44825434 AGCCACGGAGGCGCTGGGTGGGG - Intronic
1184504751 22:44893893-44893915 GTCCAGTGAGCTGCAGGGTGAGG + Intronic
1185057640 22:48589246-48589268 GGCCAGGGGGTGACTGGCTGGGG + Intronic
1185173712 22:49307465-49307487 GAGCAGGGAGTTGCTGGGCCTGG + Intergenic
1185344592 22:50305791-50305813 GGCGAGGGGGTCCCTGGGTGGGG + Intronic
1185398839 22:50605718-50605740 TGCCAAGGACCTGCTGGGTGAGG + Exonic
950172893 3:10851759-10851781 GGTCAGGGAGGAGCTGGGAGGGG + Intronic
950358945 3:12436965-12436987 TTCCAGGGAGGTGCTGGGGGAGG - Intergenic
950457281 3:13100191-13100213 GCACAGGGAGTTGGGGGGTGTGG + Intergenic
951102994 3:18710841-18710863 GGCAAAGGAGTTGTGGGGTGGGG + Intergenic
951823142 3:26836535-26836557 GGTCAGGGAGGTGCTGGTGGTGG + Intergenic
952199435 3:31111175-31111197 GGCCAGGGGGTGGCTGGTTAGGG - Intergenic
953452384 3:43015700-43015722 AGGCAGGGAGGTGCTGTGTGAGG + Intronic
954034409 3:47843260-47843282 GTCCAGGAAGGTCCTGGGTGTGG + Intronic
954259726 3:49429779-49429801 GGCTGGGCAGTTGCTGGGCGCGG - Intergenic
954305307 3:49722426-49722448 TGCCATGGAGTTACAGGGTGAGG - Exonic
954379010 3:50209787-50209809 GGCCAGGGAGCTGGGGGCTGAGG + Intronic
954459569 3:50618482-50618504 GGTCAGGGGGATGCTGGGGGCGG + Intronic
955379398 3:58424787-58424809 GGCAAGGGAGCTGCTGGTGGTGG - Exonic
955751333 3:62187809-62187831 GGCCAGGGCTTTGCAGGCTGAGG - Intronic
955825869 3:62946989-62947011 GCCCAGGGAGTCACTGGCTGTGG - Intergenic
955930223 3:64048836-64048858 TGGCAGGAAGTTGTTGGGTGAGG - Intergenic
956453496 3:69397302-69397324 TGCCAGGGAGTTGGGGCGTGAGG + Intronic
958420528 3:93925465-93925487 GGACAGGGAGTGGTTGGGTAGGG + Intronic
961263337 3:125620192-125620214 AACCAGGGACTGGCTGGGTGCGG + Intergenic
961465495 3:127078603-127078625 GGCCAGGCCAGTGCTGGGTGGGG + Intergenic
963074171 3:141330908-141330930 GGCCAGGAAGTTCCAGGTTGAGG - Intronic
966221392 3:177555015-177555037 GGGCAAGGAGCTGGTGGGTGGGG + Intergenic
966715119 3:183006748-183006770 GGCCTGGCACTAGCTGGGTGGGG + Intergenic
967023389 3:185542605-185542627 GCACAGGAAGTGGCTGGGTGTGG - Intronic
967473435 3:189889392-189889414 GGGGAGGGAGTGCCTGGGTGGGG - Exonic
967977665 3:195044524-195044546 CGTCGGGGAGTAGCTGGGTGAGG - Intergenic
967996844 3:195173340-195173362 GGCCAGGCAGATGCTGGGGGAGG - Intronic
968368222 3:198203697-198203719 GGCCAGGGAGTTGCTGGGCTGGG + Intergenic
968496936 4:923677-923699 GGGCAGGGAGTGGAGGGGTGGGG + Intronic
968502419 4:957112-957134 GGGCAGGAAGTTGCTGGGAGGGG - Intronic
968810957 4:2799509-2799531 GGGCAGGAAGTTGCTGGGGAAGG + Intronic
968823837 4:2878076-2878098 GGCCTGGGAGTGGCAGAGTGAGG + Intronic
968952972 4:3704071-3704093 GGCCAGGCAGCAGGTGGGTGGGG + Intergenic
969446391 4:7247059-7247081 GGCCAGTGAGATGTTTGGTGAGG + Intronic
969535690 4:7755071-7755093 GGCCAGGGCCTGGCTGGGGGTGG + Intergenic
969685986 4:8674592-8674614 GGCCGGGGAGGTGGTGGGTCTGG - Intergenic
970610650 4:17722076-17722098 GGCCAGTGACTCACTGGGTGTGG + Intronic
970823837 4:20251629-20251651 GGCCAAGGAGTTGGGGGCTGGGG + Intergenic
971209415 4:24601468-24601490 GGCCAGGGAGTCACTGAGTCTGG + Intergenic
971303833 4:25463430-25463452 GGCCAGTTTGTTGATGGGTGAGG + Intergenic
972106540 4:35494990-35495012 GGTCAGGGAGCTGCTAGGTCTGG - Intergenic
972636645 4:40890346-40890368 GGCCGGTGAGTCCCTGGGTGGGG - Exonic
973375098 4:49280972-49280994 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
973375223 4:49281560-49281582 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
973375997 4:49286994-49287016 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
973376922 4:49293157-49293179 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
973377842 4:49299312-49299334 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
973378786 4:49305592-49305614 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
973379432 4:49310062-49310084 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
973380182 4:49315470-49315492 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
973380305 4:49316058-49316080 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
973381228 4:49322224-49322246 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
973382188 4:49328681-49328703 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
973382313 4:49329269-49329291 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
973385723 4:49513293-49513315 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
973385852 4:49513881-49513903 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
974088413 4:57285324-57285346 GGGCAGAGAGTTGCCTGGTGGGG - Intergenic
975754754 4:77561746-77561768 GGCCAAGGAGGTGCTGAGAGTGG - Intronic
977142985 4:93399023-93399045 GATTCGGGAGTTGCTGGGTGGGG - Intronic
978292334 4:107156651-107156673 GGACTGGGAGTTGCTGTGGGTGG - Intronic
979256650 4:118613425-118613447 GGCCAGGGAGTTGCTGGGCTGGG + Intergenic
979258155 4:118625464-118625486 AGCCAGGGAGTTGCTGGGTGGGG + Intergenic
979258212 4:118625767-118625789 GGCCAGGGAGTTGCTGGGTGGGG + Intergenic
979330137 4:119414801-119414823 GGCCAGGGAGTTGCTGGGTGGGG - Intergenic
979330194 4:119415104-119415126 AGCCAGGGAGTTGCTGGGTGAGG - Intergenic
979331698 4:119427120-119427142 GGCCAGGGAGTTGCTGGGCTGGG - Intergenic
980286296 4:130782732-130782754 GGACAGGGAGGTGCTGGGAAAGG + Intergenic
982606489 4:157523222-157523244 GGGCAGGGTGTTGCTGGCTGGGG - Intergenic
984853080 4:184170350-184170372 AGCCAGGGAGTTGAAGGTTGTGG + Intronic
985758425 5:1732790-1732812 GGAGCGGGAGTTGGTGGGTGGGG + Intergenic
988307746 5:29515199-29515221 AACCAGGGAGTTGCAGGTTGCGG + Intergenic
988361359 5:30240047-30240069 GGCCAGGGCATTGCTGGCTGTGG + Intergenic
988547313 5:32170869-32170891 GTCCAGAGAGTTGAGGGGTGGGG - Intronic
988681489 5:33488653-33488675 GGCAAGGGTGTCGCTGGCTGTGG - Intergenic
990300203 5:54442030-54442052 GGAAAGGGAGTTGCTGGGGCTGG + Intergenic
990798600 5:59573406-59573428 GTACAGGGAGTTGCTAGGGGTGG - Intronic
991437588 5:66612510-66612532 GGCGTAGGAGTTGGTGGGTGGGG + Intronic
993856877 5:93087434-93087456 AGCCTGGGAGTGGCTGGGAGTGG - Intergenic
994214027 5:97116834-97116856 GCTCAGTGAGTTGCTGAGTGGGG - Intronic
995332029 5:110956742-110956764 GGCCAAGGGGGTGCTGAGTGTGG + Intergenic
995854609 5:116578089-116578111 GGGCAGGGGGTGGCTGGGCGCGG - Intergenic
996088076 5:119324354-119324376 GGGCTGGGAGCTCCTGGGTGAGG + Intronic
996249972 5:121317477-121317499 GGGCAGAGTGTTACTGGGTGTGG + Intergenic
996408931 5:123135597-123135619 GGCTAGGGAGTTGCAGGGGGTGG - Intronic
997439530 5:133899466-133899488 TGCCAGGGAGAGGCGGGGTGTGG - Intergenic
998229116 5:140348227-140348249 GGCCAGGCAGCTGCTGAGGGAGG - Intergenic
998380053 5:141717858-141717880 GGCCAGGGTGGTGATGGGGGAGG + Intergenic
998876579 5:146606215-146606237 GTGCAGGCTGTTGCTGGGTGTGG + Intronic
999136426 5:149322915-149322937 TGACAGGGAGTTGGGGGGTGGGG + Intronic
999314151 5:150573496-150573518 GGTCAGGGAGACCCTGGGTGGGG + Intergenic
999439896 5:151593096-151593118 GCCCAGGGAGTTGCAGGGTGAGG + Intergenic
999492769 5:152067899-152067921 GACCAGGGAGGTGCTGGGCATGG - Intergenic
999768238 5:154756253-154756275 GGCCCTGGAGGTGCTGGGGGAGG - Intronic
1000532756 5:162444393-162444415 GGGCAGGGAGGTGCTGGGAAGGG + Intergenic
1001823234 5:174725667-174725689 TGCCGGGGAGGTGCTGGCTGCGG - Intronic
1002194388 5:177494460-177494482 GGGCAGGGAGTGGCTGGGCCAGG - Intronic
1002727443 5:181308928-181308950 GGCCAGGGAGTTGCTGGGCTGGG + Intergenic
1002978809 6:2113316-2113338 AGCTAGGAAGTTGCTGGATGAGG - Intronic
1003609101 6:7592177-7592199 GGCTAGGGGGTTGGCGGGTGCGG + Intronic
1004289687 6:14355073-14355095 GGTCAGGGTGTGGCTGGGTGAGG - Intergenic
1004869938 6:19894596-19894618 GGCCATGGAGTAGGGGGGTGTGG + Intergenic
1006986441 6:38178726-38178748 GGCCTGGGAGCAGCAGGGTGTGG + Intronic
1007701529 6:43769109-43769131 GGCCAGGGGGCTGGTGGGGGCGG - Intergenic
1007749441 6:44063056-44063078 GGCCAGGGCGTGCCTGTGTGGGG + Intergenic
1007756352 6:44102158-44102180 GGGCAGGAAGAAGCTGGGTGGGG - Intergenic
1007774652 6:44218292-44218314 GGCCTGGCAGTTGGTGGGGGTGG + Intergenic
1007940069 6:45772125-45772147 GGCCAGGGAGTGGGTGGTTAGGG + Intergenic
1008059785 6:46985030-46985052 GGCCATGGAGTTCATGGCTGAGG - Intergenic
1008535594 6:52504326-52504348 GGCAGGGCAGTGGCTGGGTGGGG - Intronic
1008882414 6:56394495-56394517 AGCCAGGTAGGTGCTGGGTCAGG - Intergenic
1011410179 6:87059632-87059654 GGCCAGGGAGGTGGGGGGAGGGG + Intergenic
1013722557 6:113048476-113048498 GGCCAGAGAGATGCAGGGTGAGG - Intergenic
1017769664 6:157635281-157635303 GACCAGGCAGTGGCTGGGCGCGG - Intronic
1017869920 6:158478640-158478662 GGCCAGGCAGTTGCAGGGTGGGG - Intronic
1017907505 6:158767154-158767176 GGCAAGAGGGGTGCTGGGTGGGG + Intronic
1018367534 6:163137340-163137362 GGGCAGGGAGTTGCAGTGTTGGG - Intronic
1018507905 6:164491235-164491257 GGCCAGGCAGCAGCAGGGTGGGG - Intergenic
1018841304 6:167518962-167518984 TGCCAGGGAGTTGATGGCTTTGG - Intergenic
1019350051 7:550340-550362 GGCCCGGGAGCCGCTGTGTGAGG - Exonic
1019519613 7:1454755-1454777 TGCCTGGGAGCTTCTGGGTGGGG + Intronic
1019706977 7:2501614-2501636 GGCCAGGGAGGAGCTGGCTCAGG - Intergenic
1019723436 7:2587264-2587286 GGCCAGGCAGTGGCTGTGTGGGG + Intronic
1019729745 7:2623347-2623369 GGCCAGGGAGGGGCTGGCAGGGG + Intergenic
1019758344 7:2789723-2789745 GGCCAGGGAGATGCTGTGCGTGG - Intronic
1021971289 7:25968082-25968104 GGCCTGGGACTGGCTGGGTTTGG + Intergenic
1022130494 7:27400562-27400584 GCTCAGGGAGATGGTGGGTGGGG - Intergenic
1022241896 7:28520467-28520489 TGCCAGGGAGTTGCAGGAAGTGG - Intronic
1023041190 7:36174549-36174571 CGCCAGGCAGCTGCTGGATGAGG + Intronic
1023110926 7:36809706-36809728 GGCCAGGGTGTCACTTGGTGTGG - Intergenic
1023340798 7:39217324-39217346 TGGCAGGGAGTGGGTGGGTGGGG + Intronic
1023347919 7:39290382-39290404 GTACAGGGAGTGGCTTGGTGGGG - Intronic
1023398625 7:39774716-39774738 GGCCAGGGAGTTGCTGGGCTGGG + Intergenic
1023400140 7:39786757-39786779 GGCCAGGGAGTTGCTGGGTGGGG + Intergenic
1023400197 7:39787061-39787083 GGCCAGGGAGTTACTGGGTGGGG + Intergenic
1024044216 7:45576038-45576060 GGCTGGGGAGTTGGGGGGTGGGG + Intronic
1024073125 7:45802812-45802834 GGCCAGGGAGTTACTGGGTGGGG + Intergenic
1024232126 7:47370741-47370763 AGCCAGGGAGCTGCTGGTGGTGG + Intronic
1024650206 7:51397376-51397398 GGCCAGGGAGTTACTGGGTGGGG - Intergenic
1024650264 7:51397680-51397702 GGCCAGGGAGTTGCTGGGTGGGG - Intergenic
1024651812 7:51409989-51410011 GGCCAGGGAGTTGCTGGGCTGGG - Intergenic
1025054353 7:55753025-55753047 GGCCAGGGAGTTGCTGGGTGGGG - Intergenic
1025054408 7:55753330-55753352 GGCCAGGGAGTTGCTGGGTGGGG - Intergenic
1025132403 7:56383178-56383200 GGCCAGGGAGTTGCTGGGTGGGG - Intergenic
1025132460 7:56383482-56383504 GGCCAGGGAGTTGCTGGGTGGGG - Intergenic
1025134022 7:56395770-56395792 GGCCAGGGAGTTGCTGGGCTGGG - Intergenic
1025185610 7:56855991-56856013 AGCCAGGGAGTTGCTGGGCTGGG - Intergenic
1025686319 7:63720959-63720981 AGCCAGGGAGTTGCTGGGCTGGG + Intergenic
1025910003 7:65820600-65820622 GGCCAGGGAGTTGCTGGGCTGGG + Intergenic
1025911529 7:65832546-65832568 GGCCAGGGAGTTGCTGGGCAGGG + Intergenic
1025911575 7:65832830-65832852 GGCCAGGGAGTCGGTGGGTGGGG + Intergenic
1025978074 7:66385446-66385468 GGCCAGGGAGTTGCTGGGTGGGG - Intronic
1025978125 7:66385730-66385752 GGCCAGAGATTTGCTGGGCAGGG - Intronic
1025998193 7:66541767-66541789 GGCCAGGGACCTGCAGGGTTTGG + Intergenic
1026236905 7:68535071-68535093 GGCCACGGTGGTGGTGGGTGGGG + Intergenic
1026675848 7:72427264-72427286 GGCAGGGTAGTGGCTGGGTGAGG - Intronic
1026946393 7:74318991-74319013 GGCGAGGAAGCTGCAGGGTGAGG + Intronic
1026991147 7:74586563-74586585 GGCCAGGGACCTGCAGGGTTTGG + Intronic
1027050124 7:75016558-75016580 GGCCAGGAAAAGGCTGGGTGGGG - Intronic
1027203655 7:76080110-76080132 GGCCAGGGAGTTGCTGGGTGGGG - Intergenic
1027203704 7:76080394-76080416 GGCCAGAGATTTGCTGGGCAGGG - Intergenic
1027424764 7:78051552-78051574 GGTCAGGGCTTTGCTGGGTGTGG + Intronic
1029382911 7:100225110-100225132 GGCCAGGAAAAGGCTGGGTGGGG + Intronic
1029515185 7:101019302-101019324 GGGCAGGGAGTTCTTGGGTTTGG - Intergenic
1029604140 7:101588448-101588470 AGACAGGGAGATGCTGGGTCTGG + Intergenic
1030076190 7:105739094-105739116 GGCAAGGGAGATGCTGGCAGAGG + Intronic
1030846496 7:114420085-114420107 TCCCAGGGAGTTGCTGTGGGCGG + Intronic
1030958779 7:115889043-115889065 GGGGAGGGAGTTCCTGGGTGAGG - Intergenic
1032048962 7:128634191-128634213 GGCCAGGGAGTTGCTGGGCTGGG + Intergenic
1032050455 7:128646202-128646224 GGCCAGGGAGTTGCTGGGTGGGG + Intergenic
1032050512 7:128646506-128646528 GGCCAGGGAGTTGCTGGGTGGGG + Intergenic
1032084445 7:128876707-128876729 CACCAGGGAGTGGCTGGGTGGGG + Intronic
1032192654 7:129773502-129773524 AGCCAGGGAGTGCCCGGGTGGGG - Intergenic
1032703574 7:134403369-134403391 TGCCAGGGTGTGGCTAGGTGTGG + Intergenic
1033579677 7:142720733-142720755 GTCCTGGGAGTTGCTGGGTCTGG + Intergenic
1033949823 7:146771112-146771134 GGGCAGGGAGTTTGGGGGTGAGG - Intronic
1034426768 7:151018152-151018174 GTCTAGGGAGTGACTGGGTGGGG - Intronic
1034959838 7:155358336-155358358 GGCGAGGGAGAGGCTGGGGGAGG + Exonic
1035187561 7:157138618-157138640 GGCGCGGGAGGTGTTGGGTGCGG - Intergenic
1035375586 7:158404857-158404879 GGCCAGGGAGCTGGGGGCTGGGG - Intronic
1035470592 7:159106593-159106615 GGCCAGGTAGGTGCTGAGAGAGG + Intronic
1035470696 7:159106955-159106977 GGCCAGGGAGGTGCAGAGAGAGG + Intronic
1035758992 8:2055520-2055542 GGACAGGGAGGTGCGAGGTGAGG + Intronic
1036263491 8:7257872-7257894 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036264794 8:7265494-7265516 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036266093 8:7273116-7273138 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036267396 8:7280738-7280760 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036268698 8:7288360-7288382 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036270000 8:7295982-7296004 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036297894 8:7551073-7551095 GCCCAAGGAGCTCCTGGGTGTGG + Intergenic
1036299198 8:7558721-7558743 GCCCAAGGAGCTCCTGGGTGTGG + Intergenic
1036300503 8:7566371-7566393 GCCCAAGGAGCTCCTGGGTGTGG + Intergenic
1036301806 8:7574015-7574037 GCCCAAGGAGCTCCTGGGTGTGG + Intergenic
1036315533 8:7716411-7716433 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036316841 8:7724059-7724081 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036318148 8:7731707-7731729 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036319457 8:7739355-7739377 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036320764 8:7747002-7747024 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036322074 8:7754650-7754672 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036323383 8:7762298-7762320 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036324679 8:7769945-7769967 GCCCAAGGAGCTCCTGGGTGTGG - Intergenic
1036351355 8:8014362-8014384 GCCCAAGGAGCTCCTGGGTGTGG + Intergenic
1036352660 8:8022008-8022030 GCCCAAGGAGCTCCTGGGTGTGG + Intergenic
1036775474 8:11608961-11608983 GGCCAGTGTCTTGCAGGGTGGGG + Intergenic
1037019725 8:13955212-13955234 GACCAGGAAGTGGTTGGGTGTGG + Intergenic
1037579670 8:20236952-20236974 GCCCAGGCACTGGCTGGGTGTGG + Intergenic
1038021855 8:23557692-23557714 GGCCAGGGGGCTGCAGGGTGAGG + Intronic
1039236674 8:35509710-35509732 TGCCAGAAAGTTGCTTGGTGTGG - Intronic
1039840676 8:41290770-41290792 GGACAGGGAGTCTCTGAGTGAGG - Intronic
1039880294 8:41621385-41621407 TGCCAGGGATGTGCTGGGGGCGG + Exonic
1040540337 8:48347927-48347949 GGGCAGGGTGTTGGTGGGGGTGG - Intergenic
1040891667 8:52323728-52323750 GGCGAGGGGGAGGCTGGGTGGGG + Intronic
1042465006 8:69119008-69119030 AGTCAGGGAGTAGCTGGATGTGG - Intergenic
1045219389 8:100182575-100182597 GGCAAGGGTGCTGCTGGATGAGG - Intronic
1047502354 8:125452077-125452099 GGCCAGGGAGGTGCCTGGTGGGG + Intergenic
1047942277 8:129837252-129837274 GGCCAGAGAGGGGCGGGGTGAGG - Intergenic
1049007289 8:139863537-139863559 GACCCGGGACTTGCGGGGTGAGG + Intronic
1049274488 8:141712978-141713000 GGCCTGGGTGTGGGTGGGTGGGG + Intergenic
1049427443 8:142543716-142543738 GGGCAGGGAGGGGCGGGGTGGGG + Intronic
1049542391 8:143214534-143214556 GGCTAGGGAGGGGCTGTGTGTGG - Intergenic
1049639934 8:143710992-143711014 TTCCATGGAGTTGGTGGGTGAGG - Intronic
1049708964 8:144055220-144055242 GGCCAGGCTGTGGGTGGGTGGGG - Intronic
1050258581 9:3817742-3817764 GGCCATGGAGTGGCTGTTTGTGG - Intergenic
1050277613 9:4016200-4016222 GGCCATTGACTTTCTGGGTGAGG - Intronic
1050896343 9:10888922-10888944 AGCCAGGGAGTAGGTGGGAGTGG - Intergenic
1051609539 9:18947927-18947949 GTCCAGGGCTTTGCTGGGTTTGG - Intronic
1052829684 9:33204935-33204957 GGACATGGACTTGATGGGTGAGG - Intergenic
1053407012 9:37886135-37886157 GGGTAGGGAGTTGATTGGTGAGG - Intronic
1057083026 9:92187016-92187038 GGCCTGGGATTTGCTGGAGGAGG + Intergenic
1057815241 9:98289546-98289568 GGGGAGAGAGTTGCTGGCTGAGG - Exonic
1057885104 9:98823833-98823855 GGCAGGGGAGGGGCTGGGTGAGG + Intronic
1057934655 9:99226707-99226729 GGAAGGGTAGTTGCTGGGTGGGG + Intronic
1058065185 9:100540628-100540650 GGCCAAGGAGGTGCTGAGAGCGG + Intronic
1058677174 9:107410202-107410224 GTCCAGGGAGAGGCTGGCTGGGG + Intergenic
1059390905 9:113999127-113999149 GGCCAGGGAGGTGAGAGGTGGGG - Intronic
1060660893 9:125404751-125404773 AGCCAGGCATTGGCTGGGTGTGG - Intergenic
1060945930 9:127569236-127569258 GGCCCTGGAGGGGCTGGGTGGGG - Intronic
1061135819 9:128732721-128732743 GCCCAGGAAGTGGCTGGCTGAGG + Intronic
1061664380 9:132151911-132151933 GCCCAGGTAGCTGCTGGGTTTGG + Intergenic
1062234736 9:135502388-135502410 GGCCAGGGAGGAGGTTGGTGTGG + Intronic
1062253052 9:135607969-135607991 GGGGAGGGAGCTGGTGGGTGAGG + Intergenic
1062323949 9:136003736-136003758 GGCCCTGGAGAGGCTGGGTGGGG + Intergenic
1062637453 9:137498987-137499009 GGCAAGACAGTGGCTGGGTGAGG + Intronic
1062752563 9:138266402-138266424 GGCCAGGGAGTTGCTGGGCTGGG + Intergenic
1203698816 Un_GL000214v1:119221-119243 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203698941 Un_GL000214v1:119809-119831 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203699772 Un_GL000214v1:125519-125541 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203699899 Un_GL000214v1:126107-126129 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203700671 Un_GL000214v1:131511-131533 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203700800 Un_GL000214v1:132099-132121 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203479506 Un_GL000224v1:109-131 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203479633 Un_GL000224v1:697-719 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203480472 Un_GL000224v1:6405-6427 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203480601 Un_GL000224v1:6993-7015 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203481439 Un_GL000224v1:12733-12755 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203481566 Un_GL000224v1:13321-13343 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203482403 Un_GL000224v1:19042-19064 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203548992 Un_KI270743v1:152906-152928 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203549121 Un_KI270743v1:153494-153516 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203549329 Un_KI270743v1:155055-155077 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1203549458 Un_KI270743v1:155643-155665 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1203550291 Un_KI270743v1:161367-161389 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1203550416 Un_KI270743v1:161955-161977 GGAGAGGGAGAAGCTGGGTGAGG - Intergenic
1203568540 Un_KI270744v1:111233-111255 GGAGAGGTAGATGCTGGGTGAGG + Intergenic
1203568663 Un_KI270744v1:111821-111843 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203569111 Un_KI270744v1:115467-115489 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203569239 Un_KI270744v1:116055-116077 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203570060 Un_KI270744v1:121756-121778 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203570188 Un_KI270744v1:122344-122366 GGAGAGGGAGAAGCTGGGTGAGG + Intergenic
1203575077 Un_KI270745v1:1177-1199 GGCCAGGGAGTTGCTGGGCTGGG + Intergenic
1203621045 Un_KI270749v1:130166-130188 AGCCAGGGAGGTGCCGGGAGGGG - Intergenic
1187119625 X:16391826-16391848 GGCTAGGGAGTTGATGTGTAGGG - Intergenic
1187272791 X:17793802-17793824 TGACAGGGAGGTGCTGGGGGAGG + Intergenic
1189084016 X:38001143-38001165 GGGCAGGGAAGTGCTGGGTAGGG - Intronic
1189992255 X:46606612-46606634 GGCGAGGCAGGTGCTGGGTGGGG - Exonic
1190066804 X:47247228-47247250 GGCCAGGGAGAGGATGGCTGGGG + Intronic
1190116624 X:47629684-47629706 GGCCAGGGGATGGGTGGGTGGGG + Intronic
1190248516 X:48706081-48706103 GGCCAGGCAGTTGCCAGCTGAGG + Intronic
1190333988 X:49251763-49251785 GGCCTGGAAGTTGGGGGGTGGGG + Exonic
1191851326 X:65588288-65588310 GGCCAGGGTCCTGCTGGCTGGGG + Intergenic
1192037767 X:67584183-67584205 AGACAGGGAGTTTCTGGGTAGGG - Intronic
1195037371 X:100982198-100982220 GGCCTGGAGGTGGCTGGGTGTGG + Intronic
1196867802 X:120085500-120085522 GGCCAGGGAATTTCTAGGCGTGG - Intergenic
1196875300 X:120150781-120150803 GGCCAGGGAATTTCTAGGCGTGG + Intergenic
1197603777 X:128560930-128560952 AGCCAGGGTGTTGCAGGCTGTGG - Intergenic
1197671692 X:129284586-129284608 GGACAGGGAGCTGTTGGTTGGGG - Intergenic
1197770140 X:130084378-130084400 TGCCAGGGAGCTGGTGGGGGAGG + Intronic
1197945144 X:131830754-131830776 GCCCAGGAAGTTGTAGGGTGGGG - Intergenic
1198699451 X:139382087-139382109 GGGCAGAGAGATGCTGGGAGGGG - Intergenic
1199692541 X:150319669-150319691 AGCCAGGGAGGTGCTGTGTTGGG - Intergenic
1200099751 X:153684712-153684734 GACCGGGGAGGGGCTGGGTGAGG - Intronic
1200101840 X:153692250-153692272 GGCCCTGGATTTGCAGGGTGGGG - Intronic
1200133129 X:153862255-153862277 GGCTGGGGAGTGGCTGGGGGAGG + Exonic
1200141903 X:153906688-153906710 GGCCAGGGAGGAGCTGGCGGTGG - Exonic
1200988433 Y:9326869-9326891 GGGCAGGGTGTTGTTGTGTGAGG - Intergenic
1201179471 Y:11332068-11332090 GGCCGGGGGGTTGTGGGGTGGGG - Intergenic
1201765364 Y:17569518-17569540 GTCCAGGGCTTTGCTGGGGGAGG - Intergenic
1201836188 Y:18336471-18336493 GTCCAGGGCTTTGCTGGGGGAGG + Intergenic
1202187911 Y:22207291-22207313 ATCCAGGAAGTGGCTGGGTGAGG - Intergenic
1202203449 Y:22379105-22379127 ATCCAGGAAGTGGCTGGGTGAGG + Intronic