ID: 922101590

View in Genome Browser
Species Human (GRCh38)
Location 1:222481820-222481842
Sequence GAGGAGGCCAGGGAGTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 658
Summary {0: 31, 1: 18, 2: 13, 3: 67, 4: 529}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922101590_922101603 24 Left 922101590 1:222481820-222481842 CCCAGCAACTCCCTGGCCTCCTC 0: 31
1: 18
2: 13
3: 67
4: 529
Right 922101603 1:222481867-222481889 TCTCAACACCACCACGACCCTGG No data
922101590_922101604 29 Left 922101590 1:222481820-222481842 CCCAGCAACTCCCTGGCCTCCTC 0: 31
1: 18
2: 13
3: 67
4: 529
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922101590 Original CRISPR GAGGAGGCCAGGGAGTTGCT GGG (reversed) Intergenic
900016080 1:151063-151085 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
900046344 1:509657-509679 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
900068545 1:751369-751391 GAGGTGGCCAGGGAGTTGCTGGG - Intergenic
900326652 1:2111492-2111514 GAGGCGGACAGGGAGGGGCTGGG + Intronic
900536379 1:3179708-3179730 GCGGAGGCCAGCGAGGTGCCAGG - Intronic
900630829 1:3634285-3634307 GAAGAGGCCAGTGAGTGGCTGGG - Intronic
900739987 1:4325069-4325091 GAGGTGGCCAGGGAGATGCTGGG + Intergenic
900782456 1:4626877-4626899 GAGGAGCCCAGGGCTGTGCTGGG + Intergenic
900795523 1:4705986-4706008 AAAGAGCCCAGAGAGTTGCTGGG - Intronic
901123736 1:6914760-6914782 CATGTGGCCAGGGAGATGCTGGG + Intronic
901390945 1:8945680-8945702 GAGGAGATCAGGCAGGTGCTGGG + Intergenic
901798950 1:11696175-11696197 GTGGGGGCCAGGGAGTTTCCTGG - Intronic
902542044 1:17162669-17162691 AAGGGGTCCAGGGAGTTCCTAGG + Intergenic
902571789 1:17351926-17351948 GAGGCGGTCAGGGAGGTGATGGG + Intronic
902571800 1:17351960-17351982 GAGGCGGCCAGGGAGGTGATGGG + Intronic
902571816 1:17352014-17352036 GAGGCGGCCAGGGAGGTGATGGG + Intronic
902768461 1:18631829-18631851 GCGGAACCCAGGGAGTTTCTGGG + Intronic
903214853 1:21838336-21838358 CAGGAGGCCATGGAAATGCTGGG + Intronic
903942825 1:26943305-26943327 GACGAGGCGAGAGAATTGCTTGG - Intronic
904456965 1:30653714-30653736 GATGGGGCCAGGGAGTGACTTGG - Intergenic
905507881 1:38494538-38494560 CAGTAGGCCAGGAAGTGGCTTGG - Intergenic
905838436 1:41151392-41151414 AAGGAGGCAAGGGTGTTACTTGG + Intronic
905929623 1:41778027-41778049 CAGGAGGACAGGGATTTGGTTGG - Intronic
906690600 1:47790416-47790438 GAGCAGGCCTGGGTGATGCTGGG - Intronic
906696747 1:47828330-47828352 GGGGACGCCAGGGACTTGGTGGG - Intronic
907038352 1:51236433-51236455 GCGGCGGCCACGGAGCTGCTGGG - Exonic
908026030 1:59952428-59952450 GAGGAGGCATGGGACTTGTTAGG + Intergenic
908431248 1:64060642-64060664 GAGGAGACCAGGAAGTCACTTGG + Intronic
908523910 1:64969407-64969429 GAGGAGGGTGGGGAGTTGCGGGG - Intergenic
910218370 1:84864870-84864892 GATGAGGTCAGGGAGCTGGTGGG - Intronic
910477080 1:87619362-87619384 GAGGTGGGCAGGGAAGTGCTGGG + Intergenic
911230841 1:95359987-95360009 GAGGGAGCCAGGGATTTGGTAGG + Intergenic
912690922 1:111804157-111804179 GCGGAAGCCAGGGAGGAGCTGGG - Intronic
912697078 1:111849592-111849614 GAGGAGTCCAGGTAGCAGCTCGG + Intronic
912975395 1:114324620-114324642 GAGGAGGCCAAGGAGCTGAGAGG - Intergenic
914995911 1:152543317-152543339 GAGGCGGGCAGGGAAGTGCTGGG + Intronic
915358875 1:155273527-155273549 GCGGAGCCCAGGGGGTAGCTGGG - Intronic
915447072 1:155979861-155979883 AAGGAGGTGAAGGAGTTGCTAGG - Intronic
915526820 1:156481090-156481112 GGAGGGGCCAGGGAGATGCTGGG - Intronic
916056873 1:161074076-161074098 GAGGTGGGCAGGGTGTTTCTAGG - Intronic
916292143 1:163178469-163178491 CAGGAGTCCAGGGAGGTGGTAGG + Intronic
917656533 1:177131856-177131878 GAGGAAGCCAGGGTGATGATGGG + Intronic
918332052 1:183471195-183471217 GAGGAGGCCAGGGTGAGGGTGGG - Intergenic
918613549 1:186518660-186518682 GAGGATGCCAGGGAGGTCATGGG - Intergenic
918719659 1:187836831-187836853 GAGGAGAACAGGGAAGTGCTGGG - Intergenic
919183825 1:194118511-194118533 GAGGGGGCCAGGTAAGTGCTGGG - Intergenic
919644106 1:200075727-200075749 GAGGAGGGCAAAGAGCTGCTGGG - Intronic
919763149 1:201110937-201110959 GAGGAAGCGAGGGAGTTGTTTGG + Intronic
920133021 1:203747191-203747213 GAGTAGGTCAGGGAGTTGCCTGG - Intergenic
920897910 1:210075796-210075818 AAGGAGGGCAGGGAAGTGCTGGG - Intronic
921403467 1:214753107-214753129 GAGGGGGTCAGGGAAGTGCTGGG + Intergenic
921991627 1:221373021-221373043 GAGGAGGGCAGGGAAGTGCTGGG - Intergenic
922101590 1:222481820-222481842 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
922101647 1:222482123-222482145 GAGGGAGCCAGGGAGTTGCTGGG - Intergenic
922103901 1:222496741-222496763 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
922262671 1:223956936-223956958 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
922262727 1:223957239-223957261 GAGGGAGCCAGGGAGTTGCTGGG - Intergenic
922264222 1:223969272-223969294 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
923464659 1:234237523-234237545 CAGGAAGGCAGGGAGATGCTGGG - Intronic
924344510 1:243061937-243061959 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
924344565 1:243062240-243062262 GAGGGAGCCAGGGAGTTGCTGGG - Intergenic
924346071 1:243074265-243074287 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
924510137 1:244723248-244723270 GAAGCACCCAGGGAGTTGCTTGG - Intergenic
924908783 1:248486303-248486325 CAGGAGGGCAGGGAGATGCGGGG - Intergenic
924915324 1:248561759-248561781 CAGGAGGGCAGGGAGATGCGGGG + Intergenic
1063376615 10:5558081-5558103 GAGGTGGCCGGGGAGGGGCTGGG + Intergenic
1063961208 10:11306915-11306937 AAGGGGCCCAGGGAGTTTCTAGG + Intronic
1064125706 10:12658427-12658449 GAGGGGGGCAGGGAAGTGCTTGG + Intronic
1064424911 10:15222063-15222085 CAGAAGGCCAGGGAGAGGCTGGG + Intronic
1064795882 10:19010400-19010422 GAGGGGGCCAGGGAAGTGCTTGG - Intergenic
1064851603 10:19714628-19714650 GAGGGGGACAGGGAAGTGCTGGG - Intronic
1065137089 10:22682307-22682329 GAGTAGGCCTGATAGTTGCTAGG - Intronic
1065513858 10:26505946-26505968 GATGAGGCCAGGGAGGTGACTGG - Intronic
1066054506 10:31667927-31667949 GAGGAGGCAAGGGAGTGTTTTGG - Intergenic
1066730275 10:38430555-38430577 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1066731766 10:38442832-38442854 GAGGGAGCCAGGGAGTTGCTGGG + Intergenic
1066731823 10:38443135-38443157 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1067215239 10:44296095-44296117 GAGGTGGCCAGGGAGAAGTTTGG - Intergenic
1067459081 10:46444261-46444283 CAGGGGACCAGGGAGGTGCTAGG - Intergenic
1067628116 10:47940369-47940391 CAGGGGACCAGGGAGGTGCTAGG + Intergenic
1067761992 10:49055368-49055390 AAGGAGGCCATAGAGCTGCTTGG - Intronic
1068607840 10:59025882-59025904 AAGGAGGGCAGGGGATTGCTGGG + Intergenic
1068956086 10:62819219-62819241 GGGGAGGCCAGGGAATGCCTGGG + Intronic
1069794378 10:71042883-71042905 GAGCTGGCCAGGGAGCAGCTGGG - Intergenic
1070720256 10:78752059-78752081 GAGGAGGGCAGGGAGAGGCTGGG - Intergenic
1070839416 10:79473256-79473278 GAGGAAACCAGAGAGTTGCGAGG + Intergenic
1071003359 10:80855795-80855817 GAAGAGGCACAGGAGTTGCTGGG + Intergenic
1071195349 10:83153244-83153266 GAGGGGGGCAGGGAAGTGCTGGG + Intergenic
1073328304 10:102655242-102655264 CAGGAGGCCAAGAAGCTGCTGGG + Exonic
1073603692 10:104871804-104871826 GGTGAGGGCAGGGAGTTCCTGGG + Intronic
1073641638 10:105258439-105258461 GAGGAAGCCTGGTGGTTGCTGGG + Intronic
1074047611 10:109852775-109852797 GATGAGTACAGGGAGATGCTTGG - Intergenic
1074096437 10:110317787-110317809 GAGGGGGGCAGGGAAGTGCTGGG + Intergenic
1074178027 10:111030391-111030413 GAGGGGGGCAGGGAAGTGCTGGG - Intergenic
1074323967 10:112429947-112429969 GAAGAGGCCAAGCAGTTGTTGGG + Intergenic
1074376703 10:112946843-112946865 GAGGAAGGCAGGGAGAAGCTGGG - Intergenic
1074996959 10:118766128-118766150 GAGGAGGCCAGGGAGGTAAGAGG + Intergenic
1075182649 10:120225581-120225603 GAGGGGGGCAGGGAAGTGCTGGG - Intergenic
1076209921 10:128632318-128632340 GGGGAGGCCAGGGAGCACCTAGG - Intergenic
1076448255 10:130533855-130533877 GAGGAGGCTGGGGAGATGGTGGG - Intergenic
1076745215 10:132509570-132509592 AAGGAGGCCTGGGTGTTGCCGGG + Intergenic
1076972670 11:146130-146152 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1077139053 11:1015546-1015568 GGGGAGGCCAGGCACTTGCTTGG + Intronic
1077484837 11:2833909-2833931 TGGGAGGGCAGGAAGTTGCTGGG - Intronic
1077487996 11:2847935-2847957 TAGGTGGGCAGGGTGTTGCTGGG - Exonic
1078171026 11:8929341-8929363 GAGCACGCCAGGGAGATACTGGG + Intronic
1078669355 11:13351439-13351461 GAGGACGTCAGGGAGGTGGTCGG + Intronic
1079544239 11:21613556-21613578 CAGGAGGCCTGGGGGCTGCTGGG - Intergenic
1079968416 11:27006633-27006655 GAGGGAGCCAGGGAACTGCTAGG + Intergenic
1082087063 11:48058863-48058885 GAAGAGGCCAGGGAGCTGCCGGG - Intronic
1082261953 11:50083275-50083297 GAGAAGGCCAGGGAGTTGCTGGG - Intergenic
1082790187 11:57341750-57341772 TAGGAGGCCAGGGACTTCCCAGG + Intronic
1082810023 11:57474142-57474164 GCTGAGGCCAGGGAGGTGCAAGG + Intronic
1082847585 11:57739157-57739179 GATCAGGGTAGGGAGTTGCTTGG - Exonic
1083228950 11:61302995-61303017 GGGGAGGGCTGGGAGTTCCTTGG - Intronic
1083304374 11:61754913-61754935 GAGAAGGCCTGGGAGTGGCAGGG + Intronic
1083651809 11:64208544-64208566 CAGGAGGCCAGGGACTGGCCCGG - Intronic
1083680631 11:64350133-64350155 GAGGAGGCCATGCAGGGGCTTGG + Intronic
1083687032 11:64382667-64382689 GAGGAGGGGTGGGAGATGCTGGG - Intergenic
1084736289 11:71107822-71107844 GAGGAAGCCAGGGGGAGGCTTGG + Intronic
1085307687 11:75497456-75497478 GAGGCAGGCAGGGAGTGGCTAGG - Intronic
1086284271 11:85227775-85227797 GATGAGGCCAGGTAGGTGGTAGG - Intronic
1087140078 11:94756351-94756373 GAGGAGGGCAGGGAAGTGCTGGG - Intronic
1087397042 11:97611746-97611768 GAGGGGGGCAGGGAAGTGCTGGG - Intergenic
1088193899 11:107255369-107255391 GAGGAGGTCGGGGAGAAGCTGGG + Intergenic
1088507380 11:110539695-110539717 GAGGGGGGCAGGGAAGTGCTGGG - Intergenic
1088779723 11:113122682-113122704 GCTGAGGCAAGGGAATTGCTTGG + Intronic
1088968488 11:114749988-114750010 GAGGAGGGCAGGGAGCATCTTGG - Intergenic
1089336106 11:117725102-117725124 GGGGAGGCAAGGGAAGTGCTTGG - Intronic
1089373533 11:117978569-117978591 GAGGAGCCCATGGAGTGGGTGGG + Intergenic
1089662509 11:119994547-119994569 GAGAAGGCCAGAGACATGCTGGG - Intergenic
1089906654 11:122046836-122046858 GAGGAGGAGAGGGAGTAGGTGGG + Intergenic
1090405394 11:126473222-126473244 TAGGTGGACAGGGAGTTGATGGG - Intronic
1090732046 11:129580497-129580519 TAGGAGGCCAGTGAGGGGCTGGG + Intergenic
1091818902 12:3459704-3459726 GAGAAGGGCAGGGGGTTGGTTGG + Intronic
1094361671 12:29638053-29638075 GAGGCGGGCAGGGAAGTGCTGGG + Intronic
1095490492 12:42728430-42728452 GAGGAGGTCAGAGAGTAACTTGG - Intergenic
1095785165 12:46101837-46101859 GAGGGGGACAGGGACGTGCTGGG + Intergenic
1096463090 12:51833581-51833603 GAGGAGGCCAGGGTGTGGAAGGG - Intergenic
1097352450 12:58563033-58563055 GAGGAGGGCAGGGAAATGCTGGG - Intronic
1097806142 12:63967105-63967127 GAGGAGGGCAGGCAGTAGCCTGG + Intronic
1098388993 12:69949433-69949455 AGGGAGCCCAGGGAGTGGCTAGG - Intronic
1099653208 12:85456380-85456402 GAGGCGGGCAGGGAAGTGCTGGG + Intergenic
1100551793 12:95652880-95652902 GAGGCATCCAGGGAGTTTCTGGG + Intergenic
1101310387 12:103573555-103573577 GAGAAGGTGAGAGAGTTGCTAGG - Intergenic
1101379908 12:104205431-104205453 TAGGAGGGCAGGGAAATGCTGGG - Intergenic
1101589232 12:106111470-106111492 GAGGAGGGCAGGGATTCTCTTGG - Intronic
1101731860 12:107433342-107433364 GAGGAGGCAAGGGGGTTTGTTGG + Intronic
1102012699 12:109628470-109628492 GAGGGGGCCAGGGAGGTGATGGG + Intergenic
1103443543 12:120980015-120980037 GTGGAGGTCAGGGAGCCGCTGGG - Intronic
1103927742 12:124433131-124433153 GAGGTGGCCAGGCTGGTGCTGGG + Intronic
1104949490 12:132432808-132432830 GGGAGGGCCAGGGAGCTGCTAGG - Intergenic
1105256244 13:18745435-18745457 GAGGAGGCCAGGGAATAGGCAGG - Intergenic
1105377914 13:19862548-19862570 TAAGAGGCCAAGGAGTTCCTGGG + Intronic
1105429695 13:20325763-20325785 GAGGGGGGCAGGGAAGTGCTGGG + Intergenic
1105818876 13:24062351-24062373 CAGGAGGCCAGGGACTGACTGGG + Intronic
1105997395 13:25685718-25685740 GAGGAGGTCAGAGGGGTGCTGGG + Intronic
1105998296 13:25694083-25694105 GAGGAGGAGAGGGACTAGCTTGG - Intronic
1106169614 13:27277807-27277829 AAAGAGGCCAGGGAGATGGTTGG - Intergenic
1106183572 13:27388405-27388427 GTGAGGGCCAGGGACTTGCTGGG + Intergenic
1106231683 13:27825774-27825796 TAGGAGGCCAGTGAGTTTCCAGG + Intergenic
1108617209 13:52145275-52145297 GAGCAGGCCTGGCAGTTTCTGGG - Intronic
1109378595 13:61527053-61527075 GAGGGGGACAGGGAAGTGCTGGG - Intergenic
1110078834 13:71286101-71286123 GTGGTGGCCAGAGGGTTGCTTGG - Intergenic
1110164992 13:72431072-72431094 AAGGAGGTGAGGGATTTGCTGGG + Intergenic
1110385649 13:74907238-74907260 GAGGAGGGCAGGGAAGTGCTGGG - Intergenic
1111206656 13:85020073-85020095 GAGGGGGGCAGGGAAGTGCTGGG + Intergenic
1112058867 13:95716970-95716992 GAGGGGGGCAGGGAAGTGCTGGG - Intronic
1112941323 13:104866135-104866157 GAGGCGGGCAGGGAAGTGCTGGG + Intergenic
1113770189 13:112903303-112903325 GTGGAGTCTTGGGAGTTGCTGGG + Intronic
1114318120 14:21525492-21525514 GAGGAGGCCGAAGAGTTGTTGGG + Exonic
1114696707 14:24632829-24632851 CAGGAGCCCAGGGAGCTCCTTGG + Intronic
1115389947 14:32842899-32842921 GAGGAGGCAAGGGAGATGCCAGG - Intergenic
1115447315 14:33506076-33506098 GAGGAGGATAGGGAGTGGCAGGG - Intronic
1116345446 14:43786826-43786848 GAGGAGGGCAGGGAAATGCTGGG - Intergenic
1117553363 14:56858570-56858592 CAGGAAGCTAGGGAGGTGCTAGG + Intergenic
1118137598 14:63045969-63045991 GAGCAGGGCAGGGACTGGCTGGG + Intronic
1118465273 14:66024920-66024942 GAGGAGACCAGGGCATTTCTTGG + Intergenic
1118983267 14:70732892-70732914 GAGGAGCCCATGCTGTTGCTAGG - Exonic
1119207565 14:72806022-72806044 AAGGAGGCCAAGGAGTTTCAAGG - Intronic
1120211970 14:81642047-81642069 GAGCAGGGCAGGGAAGTGCTGGG - Intergenic
1120779742 14:88476376-88476398 GAGGACCCCAGAGAGTTGTTGGG - Intronic
1121313913 14:92949996-92950018 CCGGAGTCCAGGGAGTTCCTGGG - Intronic
1122153204 14:99735594-99735616 GAGGAGGACAGAGAATTCCTAGG + Intergenic
1122314158 14:100815827-100815849 GAGGAGGTCAGGAAGTGGCCAGG - Intergenic
1123103300 14:105820091-105820113 GAGGCGCACAGGCAGTTGCTGGG + Intergenic
1123775280 15:23573489-23573511 GAGAAGGCAAAGGAGTTGCCAGG - Intronic
1124201725 15:27684310-27684332 GCTGAGGCCAGGGAGTTACAGGG - Intergenic
1125535483 15:40439585-40439607 GAGCAGCCCAGGGAGGGGCTGGG - Intergenic
1126278789 15:46918570-46918592 GAGGGGGACAGGGAAGTGCTGGG + Intergenic
1126341438 15:47645363-47645385 GAGAAGGCCAGGGAGTGGGCTGG - Intronic
1127390938 15:58504575-58504597 GAGAAGGCCAGGTCGATGCTGGG - Intronic
1127816306 15:62612093-62612115 GAGGTGGGCAGGTAGATGCTGGG - Intronic
1129252248 15:74315438-74315460 GAGGAGGCTAGGGAAGTTCTTGG - Intronic
1129592778 15:76931988-76932010 GAGGCGGCCAGGCCGGTGCTGGG + Intronic
1129747793 15:78037174-78037196 GAGGAGGCCAGGGACTCCCAGGG - Intronic
1129769878 15:78196099-78196121 GAGGGTGCCAGAGAGGTGCTTGG + Intronic
1130927421 15:88396058-88396080 GAGGAAGGCAGGGAAGTGCTGGG - Intergenic
1131557823 15:93414619-93414641 GAGGAGGACAGGGAAGTGCTGGG - Intergenic
1132009773 15:98265906-98265928 GAGGAGGCCGTGGATTTTCTCGG - Intergenic
1132157232 15:99504179-99504201 GAGGATGCCAGTGAGAAGCTTGG - Intergenic
1132732922 16:1371720-1371742 CAGAAGGCGTGGGAGTTGCTGGG + Intronic
1133160335 16:3907696-3907718 GAGGAGCCAAGGGAGTTGCCTGG + Intergenic
1133393596 16:5428730-5428752 GAGGAGGCCAGGAGGTTTCTGGG + Intergenic
1135068142 16:19328997-19329019 GCTGAGGCCAGAGAGTCGCTTGG - Intergenic
1135623313 16:23974592-23974614 GAAGAGTGCAGGGAGCTGCTTGG + Intronic
1135877260 16:26214290-26214312 GATGTGGCCAGGGAGTTGAAAGG + Intergenic
1135965879 16:27034564-27034586 GAGAAGGTCAGGGAATGGCTAGG - Intergenic
1136139078 16:28277153-28277175 GAGGAGGTCAGGGAGCTGAGAGG + Intergenic
1136398730 16:30006548-30006570 AGGGAGGCCAGGGAGGGGCTGGG - Intronic
1136570550 16:31094117-31094139 GAGGAGGCGAGTGAGTGGCCAGG - Intronic
1136778166 16:32882426-32882448 GAGGGGACCAGGGTGTTTCTTGG - Intergenic
1136892455 16:33979088-33979110 GAGGGGACCAGGGTGTTTCTTGG + Intergenic
1137054663 16:35738491-35738513 GAGGGGGACAGGAAGTTGTTCGG + Intergenic
1137273404 16:46917934-46917956 GAGGAGGACAGGGCCTGGCTTGG + Intronic
1138217025 16:55213325-55213347 GAGGAGACCAGGCAGTAGCCAGG - Intergenic
1138395075 16:56697784-56697806 GAGGATGCCAGGGAGCTGCTGGG + Intronic
1138505670 16:57477114-57477136 GAGGAGGCCAGGGGGCCTCTAGG + Intronic
1139284389 16:65797716-65797738 GAGGGGGGCAGGGAAGTGCTGGG + Intergenic
1139303970 16:65967721-65967743 GAGGAGGCCAGGAAGAAGCAGGG - Intergenic
1139663573 16:68439335-68439357 GAGGAGACCAGGGTCTGGCTGGG - Intronic
1139827185 16:69766527-69766549 GAGGAGGTCAGGGTGGTGGTGGG - Intronic
1140748198 16:77999505-77999527 GAGGGGGGCAGGGAAATGCTAGG - Intergenic
1141064466 16:80902696-80902718 GAGGAGAGCAGGCAGTAGCTGGG + Intergenic
1141380152 16:83569044-83569066 GAGGAGGCCAGACAGTGGTTTGG - Intronic
1141462356 16:84185003-84185025 GAGGTGGCCAGTGTGGTGCTTGG - Exonic
1141665596 16:85463655-85463677 GATGGGGCCAGGGAGGTGATCGG - Intergenic
1142008685 16:87702507-87702529 GAGGAGGCCACGGACATGCCTGG - Intronic
1142301031 16:89257833-89257855 GAGGGGGGCAGGGAAGTGCTGGG - Intergenic
1142447579 16:90151392-90151414 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1203080585 16_KI270728v1_random:1144535-1144557 GAGGGGACCAGGGTGTTTCTTGG - Intergenic
1142459914 17:83931-83953 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1142605963 17:1081174-1081196 GGGGAGTCCAGGTAGTTCCTGGG + Intronic
1143109834 17:4546879-4546901 GAGGAGGACGGGGACCTGCTTGG - Intronic
1143188479 17:5024323-5024345 GAAGAGGGCACGGAGTTGCCAGG + Exonic
1143421221 17:6794150-6794172 GAGGAGGCTAGTGAGATTCTTGG - Intronic
1144768166 17:17744209-17744231 GGGGAGGCCAGGGGGTAGCATGG + Intronic
1145210363 17:21008620-21008642 GAGGAGGCACTGGAGATGCTGGG + Intronic
1145274907 17:21423460-21423482 GTGGAGGCCGGGGAGGAGCTGGG - Intergenic
1145778935 17:27549336-27549358 CAGAAGACCAGGGAGTTGCCTGG - Intronic
1145939942 17:28738003-28738025 GAGCAGGCCAGGGGGTGGCCTGG + Intronic
1146126892 17:30237396-30237418 GAGGGGTACAGGGAGTTGCTGGG + Intergenic
1146260497 17:31417263-31417285 GAGGAGGTGAGGCAGGTGCTGGG - Intronic
1146502423 17:33375413-33375435 GAAGAGGTCAGGGAGGTGCAGGG + Intronic
1147016007 17:37491482-37491504 GGGGAGGAGAGGTAGTTGCTTGG + Intronic
1147045084 17:37745658-37745680 GACCAGGCCAGGGAGGTTCTGGG - Intergenic
1147135542 17:38431925-38431947 GGGGAGGGCAGGGAGCTGCAGGG + Intronic
1147244350 17:39110457-39110479 AAGGAGGCCAGGGAAATGGTTGG + Intronic
1147345187 17:39787485-39787507 GAGGAGGTTGGGGAGTGGCTAGG - Intronic
1147894437 17:43741321-43741343 GAGGAGGCCAGAGAGATGAGTGG + Intergenic
1148139262 17:45316903-45316925 GAGGCGACCAGGGAGCGGCTGGG - Intronic
1148215901 17:45833918-45833940 CAGGAGGCCAGGGAGAAGCAAGG + Intronic
1148506793 17:48133718-48133740 GAGGAGTCCAAGGCGTTGGTGGG + Exonic
1149132245 17:53316482-53316504 GAGGTGGCCAGAGAAGTGCTGGG - Intergenic
1149217168 17:54370581-54370603 GAGGGGGACAGGGAAGTGCTGGG - Intergenic
1149882534 17:60307649-60307671 GAGCAGGGCAGGGAAGTGCTGGG + Intronic
1150586608 17:66524060-66524082 GCTGAGGCCTGGGAGTTGCGAGG - Intronic
1151570531 17:74923382-74923404 GAGGAGGACAGGGCCTTGCGTGG - Intergenic
1152820515 17:82435561-82435583 GAGGAGGCCAGGGAGGGGCTCGG - Intronic
1153651559 18:7245551-7245573 GAGGAGGCATGGTAGTGGCTTGG - Intergenic
1153947078 18:10027605-10027627 GGGGAGGCCAGGGAGATGGGTGG - Intergenic
1154472860 18:14721883-14721905 GAGGAGGCCAGGGAGTAGCTGGG + Intergenic
1155499395 18:26471883-26471905 AAGGAGTCCAGAGAGCTGCTGGG + Intronic
1156468676 18:37363865-37363887 GAGGAGGCCAGAGAGTACCCAGG - Intronic
1156482821 18:37446802-37446824 GAGAAGACCATGGTGTTGCTGGG + Intronic
1157535103 18:48452148-48452170 GACGGGGCCAGGGAAATGCTGGG - Intergenic
1157855335 18:51100104-51100126 GAGGGGGACAGGGAAGTGCTGGG + Intergenic
1159328124 18:66949916-66949938 GAGGGGGGCAGGGAAGTGCTGGG - Intergenic
1160630795 18:80245970-80245992 GAGGCGGCCATGCTGTTGCTGGG + Intronic
1160649629 19:216439-216461 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1160909447 19:1468024-1468046 GAGGAGCTCAGGGAGTAGCAGGG - Exonic
1161244886 19:3245505-3245527 TAGGAGGCTAGGGAGTGGGTAGG - Intronic
1161354744 19:3812606-3812628 GAGGAGGCTGGGGAGTGGCGCGG - Intronic
1161364086 19:3868512-3868534 GAGGAGACCTGGGAGGTGCCTGG - Intronic
1161428645 19:4217930-4217952 GAGGAGGCCCTGGAGCTGCGGGG + Exonic
1161667035 19:5583410-5583432 GTGGAGGCTTGGGAGTTCCTTGG + Intergenic
1162147413 19:8621244-8621266 GAGGAGGCGAGAGGATTGCTTGG + Intergenic
1162323873 19:9986855-9986877 GAGGAGGCTAGGCAGAAGCTGGG + Intronic
1162854728 19:13459646-13459668 GAGGAGACCAGGGAAGGGCTTGG - Intronic
1163679067 19:18670147-18670169 GGGCAGGCCAGGGAGTGGCAGGG - Exonic
1164677636 19:30112353-30112375 GAGGTGTCCAGGGTGCTGCTGGG + Intergenic
1165700578 19:37933958-37933980 GGGGAGGCCAGGGAGTGCCTGGG + Intronic
1165951331 19:39475415-39475437 GATGAGGCCAGAGAGTTGGCTGG + Intronic
1166104324 19:40589954-40589976 GAGGAGGCCAGGAGGCTGATAGG + Intronic
1166286701 19:41835184-41835206 GAGGAGGCAAAGGAGTGGATGGG + Intergenic
1166521335 19:43482201-43482223 GAGGAGACCAGGGATGGGCTTGG + Intronic
1166831301 19:45641367-45641389 GAGGAAGTCAGGGAGGAGCTTGG - Intronic
1167520298 19:49950817-49950839 GAGAAAGACAGGGATTTGCTCGG + Intronic
1167576501 19:50320362-50320384 GAAGAGGCCAGAGAGTTGGGGGG + Intronic
925055798 2:856485-856507 GAGGAGAGCAGGAAGTTCCTGGG - Intergenic
925092439 2:1166599-1166621 GAGGGGGGCAGGGAAGTGCTGGG + Intronic
925284021 2:2704387-2704409 GAGAAGGCAAGTGAGCTGCTGGG + Intergenic
925294120 2:2766556-2766578 CAGGAGGCCCGGGAGGAGCTGGG - Intergenic
926297748 2:11580890-11580912 GAGGGGGCATGGGAGCTGCTGGG + Intronic
928206812 2:29290357-29290379 GAGGAGGCGCAGGAGCTGCTGGG + Intronic
928819265 2:35341775-35341797 AAGGAGGGCAGGGAAGTGCTGGG + Intergenic
929628439 2:43434309-43434331 GAAGAGGGCAGGGAAGTGCTGGG + Intronic
931229495 2:60362368-60362390 CAGGAGGCCAGGGAGGACCTGGG + Intergenic
931247098 2:60500410-60500432 GAGAAGGGCAGGGAGCAGCTGGG + Intronic
934164429 2:89281379-89281401 GAGGAGGCCAGGGTGATTCCTGG - Intergenic
934202845 2:89901145-89901167 GAGGAGGCCAGGGTGATTCCTGG + Intergenic
934509377 2:94925064-94925086 GAGGAGGCCAGGGAGTTGTTGGG - Intergenic
935631556 2:105216504-105216526 AGGGAGGCCAGTGAGTTACTAGG - Intergenic
935670757 2:105555226-105555248 GAGAAGGGTAGGGAGTTGTTGGG + Intergenic
936006520 2:108893761-108893783 GGGTTGGACAGGGAGTTGCTGGG - Intergenic
937223681 2:120356336-120356358 GAGGGGACCTGGGAGCTGCTGGG + Intergenic
937790677 2:125957797-125957819 GAGGAGGCCTGGGAGGTGAATGG - Intergenic
938144479 2:128822219-128822241 GAGGAGACCAGAGAGGTGCATGG + Intergenic
938310612 2:130286185-130286207 GGGGAGGCCAGGGAGTCTCCAGG - Intergenic
938374267 2:130795555-130795577 GGCAAGGACAGGGAGTTGCTGGG - Intergenic
939117064 2:138072448-138072470 GAGGATGCTTGGGATTTGCTTGG - Intergenic
939554201 2:143654861-143654883 GAGGAGGCAAGAGGATTGCTTGG + Intronic
940240759 2:151560799-151560821 GAGGAGTCCTGGGAGTTAGTAGG - Intronic
940334728 2:152513980-152514002 TAGGATGCCAGGTAGTTGTTTGG + Intronic
940404770 2:153287931-153287953 GAGGGGGGCAGGGAAGTGCTGGG - Intergenic
942043991 2:172088409-172088431 GCGGATGCCGGGAAGTTGCTGGG - Exonic
942324508 2:174764562-174764584 CTGGAGCCCAGGGAGTTACTGGG + Intergenic
942707976 2:178799098-178799120 GAGGAGGGCAGGGAAGTGCTGGG + Intronic
942715110 2:178882853-178882875 GTGGAGGGCAGGGAGTTGAGGGG + Intronic
944332849 2:198492598-198492620 GAGGAGATCAGGGAGTTGACAGG - Intronic
944578566 2:201113147-201113169 GCCGAGGCAAGGGAATTGCTTGG + Intergenic
946771307 2:223091954-223091976 GAGGAGGACAGGGAGTCACCAGG - Intronic
947063123 2:226189218-226189240 GAAGAGGCCAGGAAGCAGCTCGG + Intergenic
947533393 2:230926492-230926514 GAGGAGGCCAGGAGCCTGCTGGG + Intronic
947541191 2:230980921-230980943 GGGGAGGGGAGGGAGTTGCAGGG + Intergenic
947721640 2:232373142-232373164 AAGGAGTCTAGGGACTTGCTGGG - Intergenic
947740135 2:232481169-232481191 GAAGAGGCCAGGGGGCTGCTTGG + Intronic
947748147 2:232520016-232520038 GAGGAGGGCAGGGGGTGTCTGGG - Intergenic
948004446 2:234595730-234595752 TAGGGGGCCAGGGAGTTGGGGGG + Intergenic
1168812688 20:716046-716068 GAGAAAGCCAGAGACTTGCTGGG + Intergenic
1168895629 20:1321510-1321532 GAGAGGGCCAGGGAGATGATGGG - Intronic
1170367982 20:15618188-15618210 GAGGAGGGCAGTGAGTTGTGGGG - Intronic
1170714416 20:18819648-18819670 GTGGAGGCGGGGGAGTTGGTAGG - Intronic
1170912012 20:20582070-20582092 GGGGAGGCCATGGAGGAGCTGGG - Intronic
1170977692 20:21181926-21181948 GAGCAGGCCATGGAGTTGGTTGG + Intronic
1171255966 20:23689202-23689224 GAGGAGGCCTGGGAGGGGCAGGG - Intergenic
1171263314 20:23751099-23751121 GAGGAGGCCTGGGAGGGGCAGGG - Intronic
1171272371 20:23826893-23826915 GAGGAGGCCTGGGAGGGGCAGGG - Intergenic
1172011943 20:31850738-31850760 GAGGAGGCCAGGGAGGAGGCAGG + Intronic
1172472224 20:35208050-35208072 GAGCAGGCCTGGGAGTGGCCAGG + Intergenic
1172477236 20:35248136-35248158 GAGGATCCAAGGGAGTTGGTGGG + Intronic
1172773350 20:37393950-37393972 GAGGGCGCCACGTAGTTGCTGGG - Exonic
1172791378 20:37507754-37507776 GAGAAGGCCAGAGAGGTGCCTGG - Intronic
1172880239 20:38195107-38195129 GAGGAGGTTATGGAGATGCTGGG + Intergenic
1173158284 20:40633440-40633462 GAGGAGGGAAGGGAGTTCTTAGG - Intergenic
1173565052 20:44032543-44032565 GGGGAGGCCAGAGAGGTGCCAGG + Intronic
1174402180 20:50282109-50282131 GAGGAGGCTGGGGAGGAGCTTGG - Intergenic
1175470827 20:59226276-59226298 GAGGTGCTCAGTGAGTTGCTTGG + Intronic
1175534233 20:59696624-59696646 GAGAAGGCCGGGGAGCAGCTTGG + Intronic
1175844483 20:62051374-62051396 GAGGAGGCCTGAGAGTAGCCAGG - Intronic
1176382197 21:6119114-6119136 GAGGAGGCCAGGCAGGGGCCGGG + Exonic
1176801624 21:13435966-13435988 GAGGAGGCCAGGGAGTAGCTGGG - Intergenic
1177264390 21:18764655-18764677 GAGGAGGGCAGAGAAGTGCTGGG + Intergenic
1177513947 21:22123360-22123382 GAGGAGGGCAGGGAAGTGCTGGG + Intergenic
1178384460 21:32138074-32138096 GAGGGGGGCAGGGAAGTGCTGGG + Intergenic
1179135433 21:38676500-38676522 GAGGAGGCCAGGGAGCTATTTGG + Intergenic
1179543684 21:42100715-42100737 GAGGAGGGCACGGGGTTGCTGGG - Intronic
1179543698 21:42100749-42100771 GAGGAGGGCATGGGGTTGCTGGG - Intronic
1179543726 21:42100817-42100839 GAGGAGGGCACGGGGTTGCTGGG - Intronic
1179543740 21:42100851-42100873 GAGGAGGGCACGGGGTTGGTGGG - Intronic
1179543755 21:42100885-42100907 GAGGAGGGCACGGGGTTGGTGGG - Intronic
1179741275 21:43419125-43419147 GAGGAGGCCAGGCAGGGGCCGGG - Exonic
1181122400 22:20680285-20680307 GGGGAGGGCAGGGACTTGCTTGG + Intergenic
1181122973 22:20684691-20684713 GGGGAGGGCAGGGACTTGCTTGG + Intergenic
1181180023 22:21060800-21060822 GGGGAGGGCAGGGACTTGCTTGG - Intronic
1181796133 22:25312371-25312393 AAGGAGGCCAGGGGGCTGCAGGG + Intergenic
1181836679 22:25615981-25616003 AAGGAGGCCAGGGGGCTGCAGGG + Intronic
1182425692 22:30270901-30270923 CAGGAGGACAGGGAGTGGCTCGG + Intergenic
1182560648 22:31156322-31156344 CAGGAGGCCCTGGAGTTGTTAGG - Intergenic
1182653670 22:31872611-31872633 GAGCAGTCCAGGGGGTTTCTTGG + Intronic
1183051492 22:35265512-35265534 GTGGAGGCCAGGAAGTGGCAGGG - Exonic
1183194445 22:36343823-36343845 GAGAAGGCCAGGGAGCAGCAAGG + Intronic
1183316350 22:37139088-37139110 GAGGAAGCCAGGGTGGGGCTGGG - Intronic
1183645480 22:39123867-39123889 GAGGAGGACAGGGAGGTCCTGGG + Intronic
1184187538 22:42874789-42874811 GAGGAGTCCAGGCACTGGCTTGG + Intronic
1184281890 22:43442135-43442157 GAGGAGGCCAGAGAGTAGACTGG - Intronic
1185077716 22:48692098-48692120 GAGGAGGCTAGGGTCTTCCTGGG + Intronic
1185134658 22:49062766-49062788 GAGGAGGCCAGGGCCTGGCAAGG + Intergenic
1185288581 22:50013200-50013222 GTGGAGGCCAGGGACTTGGGTGG - Intergenic
1185345379 22:50308375-50308397 CTGGAGGCCAGGGATGTGCTGGG - Intergenic
949617578 3:5770666-5770688 GAGGAGGGCAGGGAAGTGCTGGG - Intergenic
950578125 3:13845199-13845221 CAGGAGGCCAGGGAGGTGACAGG + Intronic
952003054 3:28808960-28808982 GAGAAGGGCAGGGAAGTGCTGGG - Intergenic
952593675 3:34988656-34988678 CAGGAGCCCAGGGAGGTGGTGGG - Intergenic
952736231 3:36694109-36694131 GAGCAGGCAAGGGAGTCCCTGGG - Intergenic
953475916 3:43205851-43205873 TAGGAGGCCTTGGAGTTGGTTGG + Intergenic
954223803 3:49170324-49170346 AGGGAGGCCAGGGAGTTAATAGG + Intergenic
954432404 3:50477883-50477905 CAGGAGGCCAGGTAGAGGCTTGG - Intronic
954458044 3:50610680-50610702 GAAGAGGACATGGAGGTGCTGGG - Intronic
956058137 3:65322271-65322293 AAGGAGGCCAGTGAGGTGCAAGG + Intergenic
956216793 3:66857833-66857855 GAAGGGGGCAGGGAGGTGCTGGG + Intergenic
958002017 3:87762207-87762229 GAGGGGGGCAGGGAAGTGCTGGG - Intergenic
959577954 3:107955149-107955171 GAGGTTGACAGGCAGTTGCTGGG - Intergenic
960360754 3:116708027-116708049 TAGGAGGCAAGGTAGTTGCAAGG - Intronic
960515296 3:118596163-118596185 GAGGGGGACAGGGAAGTGCTGGG - Intergenic
960963330 3:123087975-123087997 GAGAAGGGAAGGGAGATGCTGGG + Intronic
960988081 3:123293214-123293236 GAGGGGGCCAGGCAGGCGCTAGG + Intronic
961034843 3:123635088-123635110 GGAGAGGCCAGGGAGTTGGAAGG - Intronic
961547415 3:127644864-127644886 CAGGAGGCCAGGCAGGTGCAGGG + Intronic
961658987 3:128458379-128458401 GAGGAGGCCAGGGAGGAGGCTGG + Intergenic
962526665 3:136243526-136243548 GAGGAGGCTAAGGAATTCCTAGG + Intergenic
964523470 3:157591785-157591807 GACAAGGCCAGGGAGTGGCTTGG + Intronic
964996825 3:162892105-162892127 GAGGAGGCCCTGGAGTGGGTAGG - Intergenic
965359838 3:167725155-167725177 GCTGAGGCAAGGGAATTGCTTGG + Intronic
965589515 3:170349192-170349214 GAACAGGTCAGGGAGTTGGTAGG + Intergenic
968368220 3:198203692-198203714 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
968446671 4:655606-655628 GAGGAGGCCAGGGCGTGGGTTGG - Intronic
968924602 4:3540516-3540538 GAGCAGGCCAGGGTTTTGCAGGG - Intergenic
969101912 4:4775761-4775783 GAGGAGGGGAGGGACTGGCTGGG + Intergenic
969266871 4:6070312-6070334 CAGGAAGCCGTGGAGTTGCTAGG - Intronic
969446390 4:7247054-7247076 GAGAAGGCCAGTGAGATGTTTGG + Intronic
969504162 4:7573878-7573900 GAGGAGGCCAGGGAGGCAGTGGG - Intronic
969517163 4:7654288-7654310 GAGGAGGAAAGGGAGCTGCAGGG - Intronic
969681243 4:8644625-8644647 GAGGAGGCCAGGGAGCCACCAGG - Intergenic
971831435 4:31701268-31701290 GAGGGGGGCAGGGAAGTGCTGGG + Intergenic
974121073 4:57640011-57640033 GAGGGGGGCAGGGAAGTGCTGGG + Intergenic
974603684 4:64122271-64122293 GAGGAGGCCAGGAAGTTAGGAGG + Intergenic
975605188 4:76148118-76148140 GAGGAGGCCACGGGGGTACTCGG - Intronic
975832685 4:78386513-78386535 CAGGAGGCCAGGAGGGTGCTTGG + Intronic
976262385 4:83158090-83158112 GAAGAGGTCAGGGAGATTCTTGG - Intergenic
977125353 4:93159131-93159153 GTGGAGGCCAGGCAACTGCTAGG - Intronic
978402940 4:108349955-108349977 GCGGAGGCCAGGCAGTGACTGGG - Intergenic
978521940 4:109625246-109625268 GATGAGGCCTGAGAGTAGCTGGG - Intronic
979256648 4:118613420-118613442 AAGGAGGCCAGGGAGTTGCTGGG + Intergenic
979258152 4:118625459-118625481 GAGGGAGCCAGGGAGTTGCTGGG + Intergenic
979258209 4:118625762-118625784 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
979275672 4:118812285-118812307 GAGGCGGGCAGGGAAGTGCTGGG + Intronic
979330140 4:119414806-119414828 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
979330195 4:119415109-119415131 GAGGGAGCCAGGGAGTTGCTGGG - Intergenic
979331700 4:119427125-119427147 AAGGAGGCCAGGGAGTTGCTGGG - Intergenic
979546562 4:121946706-121946728 GAAGGGACCAGGGAATTGCTGGG + Intronic
980286295 4:130782727-130782749 AAGGGGGACAGGGAGGTGCTGGG + Intergenic
981023080 4:140049234-140049256 GAGGCGGCGAGGGAGATGGTAGG - Intronic
981196542 4:141927582-141927604 GAGGTGGACAGCGAGTTGCTGGG + Intergenic
983588684 4:169383445-169383467 GAGGAGGGCAGGGAAGTGCTGGG - Intergenic
984289941 4:177782118-177782140 GAGGGGGGCAGGGAAGTGCTGGG - Intronic
986015709 5:3755034-3755056 GAGGAGGGCAGGGAGCCGATGGG + Intergenic
986231031 5:5864928-5864950 GAGGAGGGCAGGGAAGTACTGGG - Intergenic
986543456 5:8870773-8870795 GAGGGGGCCGGGGAAGTGCTGGG - Intergenic
986645421 5:9912139-9912161 GGGGAGGCCAGGCAGGTCCTTGG - Intergenic
986971862 5:13346208-13346230 GAGGAGGGCAGGGAGTGGGTGGG + Intergenic
987005635 5:13706866-13706888 GAGCAGGGCAGGGAAGTGCTGGG + Intronic
987397916 5:17443221-17443243 GAGGGGGGCAGGGAAGTGCTGGG + Intergenic
988542490 5:32123365-32123387 CAGGAGGCCAGGGACTTTCCTGG + Intergenic
988663447 5:33298895-33298917 GTGAATTCCAGGGAGTTGCTAGG - Intergenic
988789885 5:34597829-34597851 GAGCAGGGCAGGGGGGTGCTTGG + Intergenic
988906765 5:35798454-35798476 GAGGAGGGCAGGGAGTTAGCTGG - Intronic
988937838 5:36106830-36106852 GAGGAGGCCACAGAGTAGTTGGG - Intronic
988998519 5:36737680-36737702 GAGGCAGCCAGGCAGTTTCTTGG + Intergenic
989275695 5:39586139-39586161 GAGGGGGACAGGGAACTGCTGGG + Intergenic
989440509 5:41466701-41466723 GAGGGAGGCAGGGAGTTGGTGGG - Intronic
989491373 5:42059895-42059917 GAGCAGGCCAGGGAAGTGCTAGG + Intergenic
989614136 5:43322382-43322404 GAGGGGGACAGGAAGTTGTTCGG + Intergenic
989709148 5:44375524-44375546 AACGAGGCCAGGGAGTTGGTAGG + Intronic
991115184 5:62946648-62946670 GAAGAGGGCAGGGAAGTGCTGGG + Intergenic
992210887 5:74478512-74478534 GAGGGGGGCAGGGAAGTGCTGGG - Intergenic
992488185 5:77215832-77215854 GAGGGGGCCAGGGAGCAGGTGGG + Intronic
994661581 5:102660866-102660888 GAGGGGGGCAGGGAAGTGCTGGG + Intergenic
997563383 5:134868308-134868330 GAGGGGGACAGGGAGTGGGTGGG - Intergenic
997950810 5:138241438-138241460 TAGCAGCCCAGGGAGTTGGTAGG - Intergenic
998353656 5:141516864-141516886 GAGGAAGCCAAGGAGTTGGTTGG - Exonic
999439895 5:151593091-151593113 GAGAGGCCCAGGGAGTTGCAGGG + Intergenic
999609201 5:153351065-153351087 CAGGAGGCCAGAGAGGTGCTGGG - Intergenic
1001206660 5:169769658-169769680 GAGGAGGCCAGGGATGTGCATGG + Intronic
1001412616 5:171521481-171521503 GAGCAGGCCAGGGAGGTTTTAGG + Intergenic
1001628887 5:173160030-173160052 GAGGAGGCCATGCAGTCTCTAGG + Exonic
1001664880 5:173424314-173424336 TAGGACACCAGTGAGTTGCTGGG - Intergenic
1002019915 5:176356932-176356954 GAGGTTGCCAGGGAGTGGGTGGG + Intronic
1002340247 5:178511726-178511748 GAGGAGGCTCAGGAGCTGCTTGG - Intronic
1002727441 5:181308923-181308945 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1002821978 6:734420-734442 CAGGAAGCCAGGGGGTGGCTGGG + Intergenic
1003324636 6:5083146-5083168 AAGGAGGTGAGGGAGGTGCTGGG - Intergenic
1003888801 6:10544982-10545004 GAGGTGGTCAGAGAGCTGCTGGG + Intronic
1005506626 6:26474846-26474868 GCTGAGGCCAGAGAATTGCTTGG - Intronic
1005575154 6:27183425-27183447 GAGGACCCCAGTGAGTTCCTTGG - Intergenic
1005991910 6:30908476-30908498 GAGGAAGGCAGGGAGAAGCTAGG + Intronic
1006024364 6:31138019-31138041 CAGGAGGCCAGGGGTTTTCTGGG + Exonic
1006025890 6:31146498-31146520 GAGGAGGCCAAGGAGTGTCTGGG + Intronic
1006220671 6:32487819-32487841 GAGCAGGCAAGGGAGTCCCTGGG + Intergenic
1006332894 6:33405069-33405091 GAGGAGGCCAGGGGGTGGAGTGG - Exonic
1006447498 6:34087996-34088018 GGGGAGGCCTGGGAAGTGCTGGG - Intronic
1006730942 6:36235785-36235807 GAGAAGGGCAGGGAAGTGCTGGG + Intergenic
1007520157 6:42445771-42445793 GAGGAGGCGAAGGAGGTGCATGG - Intronic
1008422388 6:51317008-51317030 GAAGAGGCCAGAAAGTTGGTGGG + Intergenic
1008727739 6:54442111-54442133 AAGCAGGGCAGGGAGGTGCTGGG - Intergenic
1009037812 6:58139170-58139192 GAGGAGGGCAGGGAGATGCTAGG - Intergenic
1009213598 6:60892807-60892829 GAGGAGGGCAGGGAGATGCTAGG - Intergenic
1011410176 6:87059627-87059649 GGGGAGGCCAGGGAGGTGGGGGG + Intergenic
1012268621 6:97179646-97179668 AATGAGGCCAAGGAGTTGCAGGG - Intronic
1012398579 6:98826087-98826109 TTGGAGACCAGGGAGTTGGTGGG - Intergenic
1012436008 6:99215936-99215958 GAGGAGCCCAGGGAATTCTTTGG - Intergenic
1013223985 6:108106460-108106482 GAGAAGCCCAGGGGCTTGCTGGG + Intronic
1013722558 6:113048481-113048503 GAGGTGGCCAGAGAGATGCAGGG - Intergenic
1014620507 6:123661211-123661233 GAGGGGGGCAGGGAAGTGCTGGG - Intergenic
1014867629 6:126551252-126551274 GAGCAGGGCAGGGAGGTGCTGGG - Intergenic
1015168390 6:130224405-130224427 GAGGCGGGCAGGGAAGTGCTGGG - Intronic
1015251869 6:131135657-131135679 GCGGAGGCCAGGGCGGGGCTCGG - Exonic
1015717419 6:136206718-136206740 GAGGAGGTTAGGGAGGTGGTGGG + Intergenic
1015729535 6:136334336-136334358 AAGGCGGGCAGGGAGGTGCTGGG + Intergenic
1017508251 6:155088638-155088660 GAGGTGGTCATGGAGTGGCTGGG + Intronic
1017810736 6:157981815-157981837 GAGGAGGCCGGGGAGGAGCCTGG + Intergenic
1017822825 6:158061325-158061347 GAGAAAGCCAGGGAGCTGCCAGG + Intronic
1017869923 6:158478645-158478667 CAGGAGGCCAGGCAGTTGCAGGG - Intronic
1018423787 6:163662623-163662645 GAGCAGAGGAGGGAGTTGCTAGG - Intergenic
1018650521 6:165988311-165988333 GAGGGGCCCGGGGAGGTGCTGGG + Intergenic
1019105188 6:169661494-169661516 GAGGAGCCCAGGGTGCTGCCTGG - Intronic
1019188821 6:170238285-170238307 GAGGAAGCTGTGGAGTTGCTGGG - Intergenic
1019570950 7:1711893-1711915 CTGGAGGCCAGGGGGTTCCTGGG - Intronic
1019627799 7:2029797-2029819 GAGGAGCCCAGCAAGTTTCTAGG + Intronic
1020552244 7:9621562-9621584 CAGGAGCCCACGGAGTTGCGGGG + Intergenic
1021009329 7:15442624-15442646 GAGGAGGGCAGGGAAGTGCTGGG + Intronic
1021076908 7:16316145-16316167 GAGGAACAAAGGGAGTTGCTAGG + Intronic
1021150686 7:17147463-17147485 GAGCAGGTCAGGGAGGTACTAGG - Intergenic
1021890850 7:25184968-25184990 GAGGAGGCGATGAAGATGCTGGG - Intergenic
1021959726 7:25859336-25859358 GAGGAGGCCAGGGAGTGAAATGG + Intergenic
1022140139 7:27486728-27486750 GAGGAAGCCTGGGAAATGCTTGG + Intergenic
1022992691 7:35724540-35724562 GAGGTGGCCAGGGAAGTGCTGGG + Intergenic
1023398623 7:39774711-39774733 AAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1023400137 7:39786752-39786774 GAGGGGGCCAGGGAGTTGCTGGG + Intergenic
1023400194 7:39787056-39787078 GAGGAGGCCAGGGAGTTACTGGG + Intergenic
1023847322 7:44129754-44129776 GTGGAGGTCAGGGAGGGGCTGGG + Intergenic
1024073066 7:45802503-45802525 AAGGGGGCCAGGGAATTGCTGGG + Intergenic
1024073122 7:45802807-45802829 GAGGAGGCCAGGGAGTTACTGGG + Intergenic
1024203147 7:47126437-47126459 GAGGACGGCAGGGAAGTGCTGGG - Intergenic
1024340225 7:48250223-48250245 GATGAGGACATGGAGGTGCTGGG - Intronic
1024544786 7:50508132-50508154 GAGGAGGCCTGGGGGCTGCAAGG + Intronic
1024570352 7:50718031-50718053 GAGGAGGCCAGGGACTCAGTCGG + Intronic
1024650209 7:51397381-51397403 GAGGAGGCCAGGGAGTTACTGGG - Intergenic
1024650267 7:51397685-51397707 GAGGGGGCCAGGGAGTTGCTGGG - Intergenic
1024651814 7:51409994-51410016 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1024885064 7:54131604-54131626 GAGGAGGCCAAGGAATTGTGAGG - Intergenic
1025054356 7:55753030-55753052 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1025054411 7:55753335-55753357 GAGGGGGCCAGGGAGTTGCTGGG - Intergenic
1025132406 7:56383183-56383205 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1025132463 7:56383487-56383509 GAGGGGGCCAGGGAGTTGCTGGG - Intergenic
1025134024 7:56395775-56395797 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1025183466 7:56837637-56837659 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1025185612 7:56855996-56856018 GGAGGAGCCAGGGAGTTGCTGGG - Intergenic
1025686317 7:63720954-63720976 GGAGGAGCCAGGGAGTTGCTGGG + Intergenic
1025688459 7:63739330-63739352 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1025910001 7:65820595-65820617 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1025911527 7:65832541-65832563 CAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1025911572 7:65832825-65832847 GAGGAGGCCAGGGAGTCGGTGGG + Intergenic
1025978077 7:66385451-66385473 GAGGAGGCCAGGGAGTTGCTGGG - Intronic
1025978127 7:66385735-66385757 CAGTAGGCCAGAGATTTGCTGGG - Intronic
1026044242 7:66894840-66894862 GAGCAGGCCAGGGAGTTGCTAGG + Intergenic
1026054178 7:66970492-66970514 GAGGAGGGCAGGGAAGTGCTGGG + Intergenic
1026111115 7:67459586-67459608 GAGGGGGGCAGGGAAGTGCTGGG - Intergenic
1026851447 7:73726049-73726071 GAGGAGGCCCAGGGGCTGCTGGG + Intergenic
1027203658 7:76080115-76080137 GAGGAGGCCAGGGAGTTGCTGGG - Intergenic
1027203706 7:76080399-76080421 CAGCAGGCCAGAGATTTGCTGGG - Intergenic
1027261233 7:76465951-76465973 GAGCAGGGCAGGCAGCTGCTAGG + Intronic
1027312617 7:76964059-76964081 GAGCAGGGCAGGCAGCTGCTAGG + Intergenic
1027529688 7:79314968-79314990 GAGCAGTCCAGGGATTGGCTAGG - Intronic
1028516077 7:91679655-91679677 GAGGAAGCAAGGGAGATGCCAGG + Intergenic
1029381942 7:100220486-100220508 CAGGAGGGCAGGGAGGGGCTCGG + Intronic
1029402106 7:100352936-100352958 CAGGAGGGCAGGGAGGGGCTCGG + Intronic
1029910152 7:104137396-104137418 GAGGGGGGCAGGGAAGTGCTGGG + Intronic
1030061067 7:105621751-105621773 AGAGAGGCCAGGGAGCTGCTGGG - Intronic
1030758588 7:113321333-113321355 CATGAGGCCAGAGAGTTGCCAGG - Intergenic
1031074576 7:117200260-117200282 GAGGGGGCCTTGGGGTTGCTGGG - Intronic
1032048960 7:128634186-128634208 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1032050452 7:128646197-128646219 GAGGGGGCCAGGGAGTTGCTGGG + Intergenic
1032050509 7:128646501-128646523 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1032308160 7:130756126-130756148 GAGGAGGCCAAAGAGGTTCTGGG + Intergenic
1032386543 7:131529504-131529526 AAGGAGGCCAGGGAGGAGGTGGG + Intronic
1032673394 7:134106518-134106540 GAGGAGGGCAGGGAAGTGCTGGG - Intergenic
1032838783 7:135697742-135697764 GAGGAGGCCAGGGAGCTGGATGG - Intronic
1033579676 7:142720728-142720750 GGTGAGTCCTGGGAGTTGCTGGG + Intergenic
1034202980 7:149294113-149294135 GAGGAGGCCAGAGACCTTCTGGG + Intronic
1034264866 7:149776040-149776062 GAGGAGGGCAGGGAGTAGCATGG - Intergenic
1034345561 7:150383497-150383519 CAGGAGGGCAGGGAGGCGCTGGG + Intronic
1034457268 7:151177589-151177611 GAGGGGGCCAGGGAGTGGGGTGG + Intronic
1034736540 7:153434195-153434217 AAGCAGGGCAGGGAGGTGCTGGG - Intergenic
1034931218 7:155165621-155165643 GAGGGGGGCAGGGAAGTGCTGGG + Intergenic
1035286022 7:157807736-157807758 CAGGAGGCCAGGCATTTGCAGGG - Intronic
1036125216 8:6056197-6056219 GAGGAGACGGGAGAGTTGCTGGG - Intergenic
1036772330 8:11587852-11587874 GAGAAGGCCAGGGAGTGGCGGGG - Intergenic
1037175831 8:15945077-15945099 GAGGAGGGCAAGGAAGTGCTGGG + Intergenic
1038530977 8:28317705-28317727 GAGGGGGCCAGGGTCTTCCTGGG - Intronic
1039088413 8:33802586-33802608 GAGGATGCCAGGGTGTGGCAAGG + Intergenic
1039607962 8:38898608-38898630 GAGGAGGCCAGGAACATGTTGGG - Intergenic
1039749710 8:40466152-40466174 AAGGAGGCCTGGGAGTATCTGGG - Intergenic
1040532038 8:48274093-48274115 GAGGAGGGCAGGGAGCCCCTGGG + Intergenic
1040550289 8:48432202-48432224 GAGGAGGGCAGGATGATGCTTGG + Intergenic
1040713942 8:50224602-50224624 GAGGAGTCCAGTCAGTTGGTTGG - Intronic
1042864911 8:73348701-73348723 GAGGAGGACAGGGGGTAGCCGGG + Intergenic
1043599742 8:81923234-81923256 GAGGGGGGCAGGGAAGTGCTGGG + Intergenic
1044829011 8:96227320-96227342 AAGGAGGGGAGGGAGTTGGTGGG + Intronic
1044854057 8:96456460-96456482 AAGGATGCCAGGGTGTTGCATGG + Intergenic
1046250588 8:111624997-111625019 GAGGGGGACAGGGAAGTGCTAGG - Intergenic
1046260820 8:111765650-111765672 GAGGGGGTCAGGGAAGTGCTGGG + Intergenic
1046439129 8:114236183-114236205 GAGGAGGGCAGGGAAGTGCTAGG + Intergenic
1047476443 8:125236196-125236218 GGTGAGGTCAGGGAGTTTCTAGG + Intronic
1047835843 8:128689514-128689536 GAGGCGGGCAGGGAAATGCTGGG - Intergenic
1048261192 8:132946618-132946640 GAGGAGGCTAGAGACTTGTTGGG - Intronic
1049100498 8:140575342-140575364 GAGCAGGTCAGGGAGGTGCCAGG - Intronic
1049348502 8:142151852-142151874 CAGCAGGCCAGGGGGTTGCTGGG - Intergenic
1049421301 8:142517781-142517803 GACGGGGCCAGGGAGGTGCCAGG - Intronic
1049427425 8:142543673-142543695 GAGAAGGACAAGGAGGTGCTGGG + Exonic
1049658990 8:143811367-143811389 GAGGACGCTAGGGGCTTGCTGGG + Intronic
1049809198 8:144555839-144555861 CCAGAGGCCAGGGAGTGGCTGGG + Intronic
1050676086 9:8054116-8054138 GAGGAAGCCAGGAACTTTCTTGG - Intergenic
1051136973 9:13933448-13933470 GAGCAGGCAAGGGAGTTGACAGG - Intergenic
1051727311 9:20101624-20101646 AAGGAGGCCAAGGAGTTTCCGGG + Intergenic
1052690477 9:31809701-31809723 GAGGAGGGCAGGGAAGTGCTGGG - Intergenic
1053185478 9:36012774-36012796 GAGGGAGCCAGGGAGAGGCTGGG - Intergenic
1053460847 9:38269967-38269989 GAGGAGGACAGGGAGAAGCAAGG + Intergenic
1053799685 9:41756547-41756569 GAGCAGGCCAGGGTTTTGCAGGG - Intergenic
1054145535 9:61558451-61558473 GAGCAGGCCAGGGTTTTGCAGGG + Intergenic
1054188094 9:61968602-61968624 GAGCAGGCCAGGGTTTTGCAGGG - Intergenic
1054352420 9:64029230-64029252 AAGAAGGCCAGGGAGTTGTTGGG + Intergenic
1054465275 9:65489559-65489581 GAGCAGGCCAGGGTTTTGCAGGG + Intergenic
1054650422 9:67619974-67619996 GAGCAGGCCAGGGTTTTGCAGGG + Intergenic
1055508303 9:76970517-76970539 GAGGAGGCCGAGGAGAGGCTGGG - Intergenic
1055883564 9:81032062-81032084 CAGGAGGCCTGAGACTTGCTGGG + Intergenic
1056212254 9:84375747-84375769 GATGAGGCCAGGGAGGGGCTTGG + Intergenic
1056377388 9:86028072-86028094 GAGGGGGACAGGGAAGTGCTGGG + Intronic
1056477192 9:86964154-86964176 GATGAGGTCAGAGAGGTGCTGGG - Intergenic
1057372988 9:94490776-94490798 TAGGATGCCAGGGAGTTGTTGGG + Intergenic
1057506486 9:95637887-95637909 GAGGATGCCAAGGAGTAGCAAGG - Intergenic
1059329151 9:113524210-113524232 GAGGGAGCCAGGGAGGGGCTGGG - Intronic
1060210774 9:121708922-121708944 AAGGAGGCCAGGCACCTGCTAGG + Intronic
1060496978 9:124126118-124126140 GAGGAGGCAAGTGACTTGCTTGG + Intergenic
1060813354 9:126622428-126622450 GAGGAGGCCACCGAGCTGCTGGG + Intronic
1060826366 9:126690347-126690369 GAGGGGACCAGGCAGTTGCTCGG + Intronic
1061155554 9:128858906-128858928 GCTGAGGCAAGGGAATTGCTTGG + Intronic
1061266067 9:129505722-129505744 GAGGAGGGCAGGGGGTTGGGCGG - Intergenic
1061579927 9:131530611-131530633 GAGAAGATCATGGAGTTGCTGGG - Exonic
1061718854 9:132538985-132539007 GCTGAGGCAAGAGAGTTGCTTGG + Intronic
1061735194 9:132650638-132650660 GAGTAGGGAAGGGTGTTGCTTGG - Intronic
1062453514 9:136625299-136625321 GAGGCTGCCAGAGAGTGGCTGGG - Intergenic
1062752561 9:138266397-138266419 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1203575075 Un_KI270745v1:1172-1194 GAGGAGGCCAGGGAGTTGCTGGG + Intergenic
1186392095 X:9171129-9171151 CAGGAGGCCAGGTAGATGTTTGG - Intergenic
1187138444 X:16570754-16570776 TAGGAGGACAGGGAAGTGCTGGG + Intergenic
1188022996 X:25178726-25178748 CAGCAGGCCAGGGAGTAGCCTGG + Intergenic
1188107470 X:26161513-26161535 GAGGAGGTCTGGAAGTTCCTGGG + Intergenic
1188110868 X:26194759-26194781 GAGGAGGTCTGGGAGTTCCTGGG + Exonic
1189002155 X:36958289-36958311 GTGGACGCCAGGGAGGTGGTTGG - Intergenic
1189056073 X:37700674-37700696 TGTGAGGCCAGGTAGTTGCTGGG + Intronic
1189084018 X:38001148-38001170 GAGGAGGGCAGGGAAGTGCTGGG - Intronic
1189160814 X:38805948-38805970 GTGGAGGCCCAGGCGTTGCTAGG + Exonic
1189320289 X:40083491-40083513 GAGGAGGCCGGGAAGGTTCTGGG - Intronic
1189947485 X:46194096-46194118 AAGGAGTCCAGGGAGGTGCAAGG + Intergenic
1190600756 X:52089612-52089634 GAGGGGGGCAGGGATGTGCTGGG + Intergenic
1191852403 X:65595163-65595185 GAGGAGGGAAGGGAGTAGATGGG + Intronic
1192988285 X:76424106-76424128 CAGCAAGACAGGGAGTTGCTGGG - Intergenic
1194105959 X:89767677-89767699 GAGGAGGGCAGAGAAGTGCTGGG + Intergenic
1197922328 X:131608675-131608697 GAGGAGGCAAAGGGGCTGCTGGG - Intergenic
1197962065 X:132017801-132017823 GAGGAGACTGGGGAGTTTCTTGG - Intergenic
1199580130 X:149352226-149352248 GAGGGGGGCAGGGAAGTGCTGGG - Intergenic
1199618905 X:149681670-149681692 GAGCAGGCAAGGGAGTCCCTGGG - Intergenic
1200100583 X:153687769-153687791 GAGGAGGGCAGGGAGGAGGTGGG + Intronic
1200457916 Y:3415536-3415558 GAGGAGGGCAGAGAAGTGCTGGG + Intergenic
1201154310 Y:11115787-11115809 AAGGAGGCCAGGGAGTTGTTGGG + Intergenic
1201291157 Y:12421486-12421508 GAGGAGGCCTGGGCGCGGCTGGG - Intergenic
1202069253 Y:20973364-20973386 GAGGTGTTAAGGGAGTTGCTAGG - Intergenic