ID: 922101590

View in Genome Browser
Species Human (GRCh38)
Location 1:222481820-222481842
Sequence GAGGAGGCCAGGGAGTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922101590_922101603 24 Left 922101590 1:222481820-222481842 CCCAGCAACTCCCTGGCCTCCTC No data
Right 922101603 1:222481867-222481889 TCTCAACACCACCACGACCCTGG No data
922101590_922101604 29 Left 922101590 1:222481820-222481842 CCCAGCAACTCCCTGGCCTCCTC No data
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922101590 Original CRISPR GAGGAGGCCAGGGAGTTGCT GGG (reversed) Intergenic