ID: 922101591

View in Genome Browser
Species Human (GRCh38)
Location 1:222481821-222481843
Sequence GGAGGAGGCCAGGGAGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922101591_922101604 28 Left 922101591 1:222481821-222481843 CCAGCAACTCCCTGGCCTCCTCC No data
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101591_922101603 23 Left 922101591 1:222481821-222481843 CCAGCAACTCCCTGGCCTCCTCC No data
Right 922101603 1:222481867-222481889 TCTCAACACCACCACGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922101591 Original CRISPR GGAGGAGGCCAGGGAGTTGC TGG (reversed) Intergenic