ID: 922101595

View in Genome Browser
Species Human (GRCh38)
Location 1:222481839-222481861
Sequence TCAGAGGGGAGAAGTAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922101595_922101604 10 Left 922101595 1:222481839-222481861 CCTCCCCTACTTCTCCCCTCTGA No data
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101595_922101603 5 Left 922101595 1:222481839-222481861 CCTCCCCTACTTCTCCCCTCTGA No data
Right 922101603 1:222481867-222481889 TCTCAACACCACCACGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922101595 Original CRISPR TCAGAGGGGAGAAGTAGGGG AGG (reversed) Intergenic
No off target data available for this crispr