ID: 922101597

View in Genome Browser
Species Human (GRCh38)
Location 1:222481843-222481865
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922101597_922101604 6 Left 922101597 1:222481843-222481865 CCCTACTTCTCCCCTCTGACCAT No data
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101597_922101603 1 Left 922101597 1:222481843-222481865 CCCTACTTCTCCCCTCTGACCAT No data
Right 922101603 1:222481867-222481889 TCTCAACACCACCACGACCCTGG No data
922101597_922101609 28 Left 922101597 1:222481843-222481865 CCCTACTTCTCCCCTCTGACCAT No data
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922101597 Original CRISPR ATGGTCAGAGGGGAGAAGTA GGG (reversed) Intergenic
No off target data available for this crispr