ID: 922101598

View in Genome Browser
Species Human (GRCh38)
Location 1:222481844-222481866
Sequence GATGGTCAGAGGGGAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 9, 1: 8, 2: 4, 3: 44, 4: 362}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922101598_922101603 0 Left 922101598 1:222481844-222481866 CCTACTTCTCCCCTCTGACCATC 0: 9
1: 8
2: 4
3: 44
4: 362
Right 922101603 1:222481867-222481889 TCTCAACACCACCACGACCCTGG No data
922101598_922101604 5 Left 922101598 1:222481844-222481866 CCTACTTCTCCCCTCTGACCATC 0: 9
1: 8
2: 4
3: 44
4: 362
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101598_922101609 27 Left 922101598 1:222481844-222481866 CCTACTTCTCCCCTCTGACCATC 0: 9
1: 8
2: 4
3: 44
4: 362
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922101598 Original CRISPR GATGGTCAGAGGGGAGAAGT AGG (reversed) Intergenic