ID: 922101600

View in Genome Browser
Species Human (GRCh38)
Location 1:222481854-222481876
Sequence GGTGTTGAGAGATGGTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922101600_922101603 -10 Left 922101600 1:222481854-222481876 CCCTCTGACCATCTCTCAACACC No data
Right 922101603 1:222481867-222481889 TCTCAACACCACCACGACCCTGG No data
922101600_922101604 -5 Left 922101600 1:222481854-222481876 CCCTCTGACCATCTCTCAACACC No data
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101600_922101609 17 Left 922101600 1:222481854-222481876 CCCTCTGACCATCTCTCAACACC No data
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922101600 Original CRISPR GGTGTTGAGAGATGGTCAGA GGG (reversed) Intergenic
No off target data available for this crispr