ID: 922101601

View in Genome Browser
Species Human (GRCh38)
Location 1:222481855-222481877
Sequence TGGTGTTGAGAGATGGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 13, 1: 4, 2: 1, 3: 26, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922101601_922101609 16 Left 922101601 1:222481855-222481877 CCTCTGACCATCTCTCAACACCA 0: 13
1: 4
2: 1
3: 26
4: 233
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data
922101601_922101604 -6 Left 922101601 1:222481855-222481877 CCTCTGACCATCTCTCAACACCA 0: 13
1: 4
2: 1
3: 26
4: 233
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922101601 Original CRISPR TGGTGTTGAGAGATGGTCAG AGG (reversed) Intergenic
900078042 1:833952-833974 TGGAGCTAAGAGATGGTCACAGG + Intergenic
900208571 1:1441937-1441959 TGGTGTGCAGAGATGGGCAGAGG - Exonic
900397491 1:2459116-2459138 TGGTGATGCCAGGTGGTCAGTGG + Intronic
904695681 1:32329703-32329725 TGTTTTTGAGGGATGATCAGAGG + Intronic
905295806 1:36953768-36953790 AGGTGGTGAGAGATGCTCAGAGG + Intronic
907641768 1:56197684-56197706 TGGCCTTTAGAGATTGTCAGTGG + Intergenic
908030387 1:59993012-59993034 GGGTGTGGAGAAATGGCCAGAGG - Intronic
908039487 1:60093324-60093346 TGATGTAGAGAGATGTTAAGGGG - Intergenic
909985910 1:82160497-82160519 GGGTGGTGGGAGATGGTAAGGGG - Intergenic
910589128 1:88910550-88910572 TGGTGTTCAGGGATTGGCAGAGG + Intergenic
912232802 1:107815432-107815454 TGGTGATGAGAGTTGGCCAGGGG - Intronic
912887405 1:113489263-113489285 TGGAGTTGAGAGCTGAGCAGTGG + Intronic
912978544 1:114350831-114350853 TGGTGAGGAGACATTGTCAGTGG + Intergenic
913975503 1:143451589-143451611 TGGTGTTGAGGGAGGGGCTGGGG - Intergenic
914069896 1:144277205-144277227 TGGTGTTGAGGGAGGGGCTGGGG - Intergenic
914109259 1:144689149-144689171 TGGTGTTGAGGGAGGGGCTGGGG + Intergenic
920195200 1:204222155-204222177 AGGTGATGAGAGATGGGGAGAGG - Exonic
921161508 1:212475630-212475652 TGGGTTTGAGAGATGGCCTGAGG - Intergenic
921929816 1:220746092-220746114 TGGTTAGGAGAGATGGTCAGGGG - Intergenic
922101601 1:222481855-222481877 TGGTGTTGAGAGATGGTCAGAGG - Intergenic
922240954 1:223755337-223755359 AGGTGGTGGGAGATGGTAAGAGG - Intronic
922262682 1:223956971-223956993 TGGTGTTGAGAGATGGTCAGAGG - Intergenic
922842801 1:228657978-228658000 TAGTGTTAAGAGGTGGACAGTGG + Intergenic
922898688 1:229119925-229119947 TGGTGTCTGGAGAGGGTCAGGGG - Intergenic
924082302 1:240412020-240412042 TGGTGTCCACAGATGATCAGCGG + Intronic
924344521 1:243061972-243061994 TGGTGTTGAGAGATGGTCAGAGG - Intergenic
1063643285 10:7853298-7853320 TGGAGTTGGGAGGTGTTCAGAGG - Intronic
1064927503 10:20585334-20585356 TGTAGTTGAGAGAGGCTCAGAGG - Intergenic
1065210077 10:23394586-23394608 GGGTGTTAAGAGAAGGTGAGTGG - Intergenic
1066731812 10:38443100-38443122 TGGTGTTGAGAGATGGTCAGAGG + Intergenic
1067152400 10:43747656-43747678 TTGTGTTAAGGGATTGTCAGTGG + Intergenic
1067527261 10:47046329-47046351 TGGTGGAAAGAGGTGGTCAGAGG + Intergenic
1068061565 10:52073974-52073996 AGGTGTTCAGAGAAGTTCAGAGG - Intronic
1068716737 10:60197069-60197091 TGGTGATGTGAGATTGTGAGAGG - Intronic
1069193534 10:65520040-65520062 TGGTGTTGTGCTAGGGTCAGAGG - Intergenic
1070006006 10:72424741-72424763 TGGTGTTGAGAGATAGTCTTTGG - Intronic
1071432638 10:85618329-85618351 TGTTCTAGAGAGATGCTCAGAGG + Intronic
1072687645 10:97548141-97548163 TGGGCTTCAGAGATGGACAGTGG - Intronic
1072761041 10:98057097-98057119 AGGTGTTGGGAGAGGGACAGGGG + Intergenic
1074059129 10:109949028-109949050 TGGCAGTGAGAGATGGACAGGGG + Intronic
1074286090 10:112099674-112099696 TGGTGTTGAGATATGGAGATTGG - Intergenic
1074587874 10:114786655-114786677 TGATGATGATACATGGTCAGTGG - Intergenic
1075626889 10:123970101-123970123 AGGAGTTCAGAGATGTTCAGAGG + Intergenic
1076947331 10:133660162-133660184 TGGGGTTGAGTGATGGGCTGTGG + Intergenic
1076979407 11:196647-196669 TGGTGGTGAGATCTGGTGAGGGG + Intronic
1077126030 11:937332-937354 TGGTGTTGCGCTGTGGTCAGTGG - Intronic
1077236600 11:1484806-1484828 CTGTGCTGAGAGATGGACAGGGG - Intronic
1077774631 11:5257891-5257913 TGATGTTGAGGGGTGGGCAGTGG - Intronic
1077778918 11:5303543-5303565 TGGTGGAGAGAGATGGACAGAGG + Intronic
1079784105 11:24649187-24649209 TGGTGTTGGTGGATGGCCAGAGG + Intronic
1080392188 11:31858594-31858616 GGATGTAGAGAGAAGGTCAGAGG - Intronic
1080492522 11:32781680-32781702 TGCAGTTGAGAAAGGGTCAGGGG + Intronic
1081612968 11:44574224-44574246 TGGTGTTGTGAGAAGCTCTGTGG + Intronic
1082261961 11:50083310-50083332 TGGTGGTGAGAGATGGTCAGAGG - Intergenic
1082779415 11:57275043-57275065 TAGTGTTGAGAGAAAGACAGAGG - Intergenic
1083427901 11:62598436-62598458 TGGTATTGAGAGATGCTGTGGGG - Intronic
1084861767 11:72023421-72023443 TGGTGCTGAGAGTTGGTGAGTGG - Intronic
1088178983 11:107087745-107087767 TGATGTTCAGAGATGTTAAGTGG - Intergenic
1089285768 11:117407127-117407149 TGGTGTTCAGAACTGGTAAGGGG + Intronic
1090084550 11:123639962-123639984 TGCTGTTGAGAGCTGGCAAGGGG - Intronic
1090541074 11:127706743-127706765 TGCTGTGGGGAGATGGGCAGGGG - Intergenic
1090891637 11:130928863-130928885 TGGTGAGGCTAGATGGTCAGGGG - Intergenic
1091305946 11:134536163-134536185 TCTTTTTGAGAGATGGGCAGTGG - Intergenic
1091662469 12:2394687-2394709 AGGTGTAGAGGGATGGGCAGTGG + Intronic
1092269688 12:7013468-7013490 TGCTGGTGACAGATGGTTAGTGG + Intronic
1092956531 12:13555958-13555980 TGGTGTAGTGAGATGGCAAGAGG + Exonic
1095278949 12:40326748-40326770 TGGTATTGAGAGAGCTTCAGAGG - Intronic
1095820964 12:46478115-46478137 TGGTGTTGGAAGATGGGCACAGG - Intergenic
1096973317 12:55684465-55684487 TAGTGGGGAGAGAGGGTCAGGGG - Exonic
1099513652 12:83569141-83569163 TGGGGTTGGGGGGTGGTCAGTGG + Intergenic
1101311859 12:103587908-103587930 GGCTGTGGAGAGATGGTCTGGGG + Intronic
1101425324 12:104583467-104583489 GGTTGTTGAAATATGGTCAGAGG - Intronic
1101650358 12:106672023-106672045 TGGTGCTTAGTGATGCTCAGTGG + Intronic
1103237728 12:119387514-119387536 TGGAGCTGGGAGATGGGCAGGGG - Intronic
1103586556 12:121960616-121960638 TGGTGGTCAGAAATGGACAGAGG + Exonic
1105330749 13:19412890-19412912 TGCTGGTGAGAGGTGGCCAGGGG - Intergenic
1105672634 13:22636743-22636765 TGTTGGTGAGAAATGGTCAAGGG - Intergenic
1105918826 13:24941664-24941686 TGCTGGTGAGAGGTGGCCAGGGG - Intergenic
1106701108 13:32229619-32229641 TGGTACTGACAGATGGTGAGTGG - Intronic
1107598964 13:41993102-41993124 TGCTGTTTAGAGCTGGTCACAGG - Intergenic
1109960907 13:69628902-69628924 TAGTGTTGTGTGATGCTCAGTGG - Intergenic
1112213919 13:97410694-97410716 TGGTGCTGAGAGAAGCTTAGAGG - Intergenic
1119116480 14:72026639-72026661 TGTGGTTGTGAGATGTTCAGAGG - Intronic
1119484524 14:74979084-74979106 GGGTGGTGAGAGAGGGACAGAGG - Intergenic
1120691673 14:87599954-87599976 TTGAGTTGGGAGATGGTCTGAGG - Intergenic
1121617716 14:95324028-95324050 TGGTGTGGAGAAGTGATCAGAGG + Intergenic
1122791378 14:104185503-104185525 TGGGGTTGAGGGATGGGTAGAGG + Intergenic
1202921385 14_KI270723v1_random:32713-32735 TGGGGTTGAGTGATGGGCTGTGG + Intergenic
1124113435 15:26815290-26815312 TGGAGTTGCCATATGGTCAGGGG + Intronic
1124364961 15:29064712-29064734 TGGTGATGAGAGAGAGACAGAGG + Intronic
1126663701 15:51056427-51056449 TGGATCTGTGAGATGGTCAGTGG - Intergenic
1128315780 15:66658311-66658333 TGGGGCTGAGAGATGGGGAGAGG - Intronic
1128873406 15:71181971-71181993 AGATGTTGAGAGATCATCAGAGG + Intronic
1134245501 16:12536674-12536696 TGGTATTAAGAGGTGTTCAGGGG + Intronic
1135011576 16:18885009-18885031 TGGTATTGATAGATGGTCACTGG + Intronic
1135318477 16:21472592-21472614 TGGTATTGATAGATGGTCACTGG + Intergenic
1135371370 16:21904387-21904409 TGGTATTGATAGATGGTCACTGG + Intergenic
1135435678 16:22425330-22425352 TGGGGTTGGGACAAGGTCAGAGG + Intronic
1135440417 16:22466328-22466350 TGGTATTGATAGATGGTCACTGG - Intergenic
1135858023 16:26029955-26029977 TGGTATTGACAGGTGCTCAGGGG - Intronic
1136328734 16:29554335-29554357 TGGTATTGATAGATGGTCACTGG + Intergenic
1136443365 16:30294034-30294056 TGGTATTGATAGATGGTCACTGG + Intergenic
1137043971 16:35639357-35639379 TGGGGCTGAGAGATGTCCAGGGG - Intergenic
1137628948 16:49928501-49928523 TGATTTTGAGAGAGGGACAGTGG - Intergenic
1139890088 16:70246457-70246479 TGTTATTGATAGATGGTCACTGG + Intergenic
1140192287 16:72828442-72828464 TGGTGTTGAGAGAAGGAGAACGG - Intronic
1142466984 17:141672-141694 TGGTGGTGAGATCTGGTGAGGGG + Intergenic
1142985976 17:3695630-3695652 AGGTGATGAGAGGTGGGCAGGGG - Intronic
1143417810 17:6762493-6762515 TGAAGTTTGGAGATGGTCAGAGG - Intronic
1147450749 17:40502389-40502411 AGGTGTTCAGACATGGTGAGGGG + Intergenic
1147668837 17:42165234-42165256 TGGCGATGAGAGACGGCCAGGGG + Intronic
1149261664 17:54886828-54886850 AGCTGATGAGAGATGGACAGAGG - Intergenic
1150243686 17:63657104-63657126 AGGGGTGGAGGGATGGTCAGAGG - Intronic
1151997190 17:77617497-77617519 CGGAGTTGAGAGATGGTGAGAGG + Intergenic
1152203168 17:78958875-78958897 CGGTGTTCATAGATGGTCTGGGG - Intergenic
1153880693 18:9419405-9419427 TGGTGATGATAGCTGTTCAGAGG - Intergenic
1157119570 18:44896155-44896177 TGGTATTGGGAGATGATTAGGGG + Intronic
1157603329 18:48909138-48909160 TGGGGTAGAGAGAATGTCAGCGG - Intergenic
1157844674 18:50992217-50992239 GGGTGGGGACAGATGGTCAGGGG + Intronic
1158391832 18:57050893-57050915 TGGGCAGGAGAGATGGTCAGAGG - Intergenic
1160026524 18:75222527-75222549 TGGGGTCGAGGGATGGTCCGGGG + Intronic
1162003465 19:7763051-7763073 AGGTGTTGGGGGATGGTCTGGGG - Intergenic
1162964238 19:14148540-14148562 TTGTGTGGAGGGGTGGTCAGAGG - Exonic
1165576188 19:36821054-36821076 TGTTGTTAAGACAGGGTCAGTGG - Intronic
1167636750 19:50659915-50659937 GGGTGGTGAGAGAGGGGCAGAGG - Intronic
925289517 2:2738001-2738023 TGGTGCTCAGAGCTGGGCAGAGG + Intergenic
925522980 2:4768184-4768206 TGATTTTGAGAGAGGGCCAGAGG - Intergenic
926363695 2:12113829-12113851 TGGAGGTGAGAGATGCCCAGAGG - Intergenic
929168216 2:38904999-38905021 AGGTCTTGAGAGTGGGTCAGTGG + Intronic
930930224 2:56873885-56873907 GAGTGGTGAGAGATGGGCAGTGG + Intergenic
932300308 2:70662447-70662469 TGGGGGTGAGGGAAGGTCAGGGG + Exonic
932456507 2:71852866-71852888 TGGGGTGGAGAGAAGGTGAGTGG + Intergenic
932568158 2:72922398-72922420 TGGAATAGACAGATGGTCAGGGG - Intronic
932892779 2:75611207-75611229 TGGTGGTGGGAGATGGTTGGAGG - Intergenic
932892786 2:75611231-75611253 TGGTGGTGGGAGATGGTTGGAGG - Intergenic
932892799 2:75611279-75611301 TGGTGGTGGGAGATGGTTGGAGG - Intergenic
932892827 2:75611374-75611396 TGGTGGTGGGAGATGGTTGGAGG - Intergenic
932892850 2:75611455-75611477 TGGTGGTGGGAGATGGTTGGAGG - Intergenic
932892870 2:75611526-75611548 TGGTGGTGGGAGATGGTTGGAGG - Intergenic
932892897 2:75611621-75611643 TGGTGGTGGGAGATGGTTGGAGG - Intergenic
932892928 2:75611740-75611762 TGGTGATGGGAGATGGTTGGAGG - Intergenic
932892934 2:75611764-75611786 TGGTGGTGGGAGATGGTTGGAGG - Intergenic
932892941 2:75611788-75611810 TGGTGGTGGGAGATGGTTGGAGG - Intergenic
934180203 2:89612562-89612584 TGGTGTTGAGGGAGGGGCTGGGG - Intergenic
934290495 2:91686822-91686844 TGGTGTTGAGGGAGGGGCTGGGG - Intergenic
935047323 2:99493862-99493884 TGGGTTTGAGAGGTGGTCACGGG + Intergenic
935306013 2:101737195-101737217 TGTTGGTCAGAGATGGTGAGTGG + Intronic
935386180 2:102502080-102502102 TGGTGTAGATAGATGCTAAGAGG + Intronic
936596313 2:113851562-113851584 TAGAGTTGAGAGATGGTCAAAGG - Intergenic
936662797 2:114560652-114560674 TTGTGTGGAGAGGTGGTGAGGGG - Intronic
937034471 2:118769477-118769499 AGGGGTTGAGGGATAGTCAGGGG - Intergenic
937241522 2:120465321-120465343 TGGGGGTCAGAGATGGACAGGGG + Intergenic
937353920 2:121186263-121186285 TGGTGGTGAGAGGTAGGCAGCGG - Intergenic
938062366 2:128263327-128263349 TGGGGATGAGAGCTGGGCAGGGG + Intronic
938236494 2:129710381-129710403 TGGTGGTAAGACATGGCCAGAGG + Intergenic
939082215 2:137675793-137675815 TGGTGGTGAGAGAAGTTAAGTGG + Intronic
940250047 2:151665135-151665157 TGCTGTTGAGAGATGATCTGAGG + Intronic
943444507 2:187967393-187967415 TGGTGTTGAGAGAGGGGTGGGGG + Intergenic
945054720 2:205858660-205858682 TGCTGTTGTGAGATGGTCCTGGG - Intergenic
945336482 2:208598999-208599021 TGGTGGCAAGAGAGGGTCAGGGG + Intronic
945489553 2:210438928-210438950 TGGTGGTGAGGGGTGGGCAGTGG + Intronic
945501420 2:210580384-210580406 TGGTGATGAGATATTCTCAGAGG - Intronic
948290974 2:236824199-236824221 TGAAGTTGATAGATGGTCATGGG + Intergenic
1169572552 20:6922433-6922455 TAGAATTGAGAGATGGTGAGGGG + Intergenic
1171482377 20:25463671-25463693 TTGTGCTGAGAGCGGGTCAGAGG - Intronic
1172847417 20:37938199-37938221 TGGTGTTTAGAGGAGGTCAGTGG + Intronic
1173142399 20:40495547-40495569 AGGTTTTGAGAAAAGGTCAGAGG - Intergenic
1174379722 20:50148749-50148771 TGGGGATGAGAGATGGACAGAGG + Intronic
1175705016 20:61170325-61170347 TGGTGCTGAGTGAGGGTCGGGGG + Intergenic
1176754239 21:10713935-10713957 TGGAGTGGAGTGGTGGTCAGTGG - Intergenic
1179466565 21:41579663-41579685 TGATGGTAAGAGATGGTCACAGG + Intergenic
1179997821 21:44982012-44982034 TGGTGTTCAGAGGGGGACAGCGG + Intergenic
1179997853 21:44982127-44982149 TGGTGTTCAGAGGGGGACAGCGG + Intergenic
1180867858 22:19129773-19129795 TTGTGTTTTAAGATGGTCAGTGG - Intergenic
1181343359 22:22199953-22199975 TGCTGTGGAGAGAGGGTCTGTGG + Intergenic
1181821203 22:25477063-25477085 TGGTGTGGAGGGAAGGTCACGGG + Intergenic
1184126724 22:42492439-42492461 TGGTGATGCGAGATGCTCAGGGG - Intergenic
1185152031 22:49169320-49169342 GGGTGGTGAGAAATGGGCAGAGG + Intergenic
950210658 3:11120527-11120549 TGGGGGAGAGAGATGCTCAGAGG + Intergenic
950693632 3:14681058-14681080 TGTTATTGATAGATGGACAGAGG + Intronic
952000165 3:28775925-28775947 TGGAGGTTAGAGAGGGTCAGGGG - Intergenic
954294520 3:49666747-49666769 TGGAGGGGAGAGGTGGTCAGGGG + Intronic
954400521 3:50317300-50317322 TGGTGGTGGGAGGTGGGCAGGGG - Intergenic
954575756 3:51675122-51675144 TGGTGCTGGGAGATGGCCAAGGG + Intronic
956055022 3:65289597-65289619 TTGTGTCCAGGGATGGTCAGAGG - Intergenic
957080125 3:75630254-75630276 TGGGGTTGAGTGATGGGCTGTGG - Intergenic
957381635 3:79437754-79437776 TGGTGATGAGAGTGGGGCAGAGG + Intronic
961524345 3:127487065-127487087 TGATGTTGGGGGAAGGTCAGCGG - Intergenic
961570669 3:127796248-127796270 TGGTGCTGAAAAAGGGTCAGAGG - Intronic
962752166 3:138441422-138441444 AGGTGGGGAGAGATGGTCACCGG + Intronic
962777993 3:138681672-138681694 TGGTGTTGAAAGATGTACTGTGG - Intronic
965297612 3:166969571-166969593 TGGAGTTTAAAGATGGACAGAGG + Intergenic
968405285 4:335611-335633 TGGTGAGGAGAGAAGGTGAGTGG - Intergenic
969135798 4:5027759-5027781 TGGTGTTGAAAGATGCACACAGG + Intergenic
969296953 4:6275873-6275895 GGGTGTTCAGAGGTGGCCAGGGG + Intronic
969829069 4:9781067-9781089 GGGTGTTGAGAGAGGGGCTGGGG + Intronic
970345927 4:15152131-15152153 TTGTGGTGATAGATGATCAGTGG + Intergenic
971154464 4:24066492-24066514 TAGAGTTCAGAGATGGACAGAGG - Intergenic
971498870 4:27297172-27297194 TGGTGGGGTGAGATGGTCATGGG + Intergenic
972717490 4:41662071-41662093 TGGTATTGAAAGAGGGTGAGAGG - Intronic
977102714 4:92837615-92837637 TGGTGTTCAGAAATGGCCAAAGG + Intronic
979258198 4:118625727-118625749 TGGTGTTGAGAGATGGTCAGAGG + Intergenic
979330151 4:119414841-119414863 TGGTGTTGAGAGATGGTCAGAGG - Intergenic
980562584 4:134497406-134497428 TGGTATTAAGAGATGCTCAATGG + Intergenic
981402051 4:144324548-144324570 TGGTGTTGAGAGATTTTCTTGGG - Intergenic
982185982 4:152799733-152799755 TCCTGTTGAGAGATGATCAGAGG + Intronic
982353790 4:154444807-154444829 AGATGTGGAGAGATGGTCAGGGG - Intronic
985045627 4:185937953-185937975 TGCTGTTCAGAGACTGTCAGTGG + Intronic
985393560 4:189516613-189516635 AGGTGTTAGGAGATTGTCAGAGG - Intergenic
985450788 4:190060962-190060984 TGGGGTTGAGTGATGGGCTGTGG + Intergenic
987910354 5:24135510-24135532 TGGTATTGTGAGATGCTCTGTGG + Intronic
993734599 5:91461549-91461571 TGGTTTTGAGAGATTTTCATTGG - Intergenic
995029030 5:107458721-107458743 TGGTGTTGTGAGATAGACAGCGG - Intronic
995241558 5:109890593-109890615 AGGTGTGGATAGATGGTCATGGG + Intergenic
995853298 5:116569547-116569569 CTGTGTTGAGAAATGGGCAGAGG + Intronic
996206752 5:120747516-120747538 AGGTGTTGTAAGATGGCCAGTGG + Intergenic
996740517 5:126794605-126794627 TAGTGTTGAGTGGTGTTCAGGGG + Intronic
997145003 5:131423030-131423052 GACTGTGGAGAGATGGTCAGGGG + Intergenic
997391569 5:133521223-133521245 TGGTGTTCAGGGATGGTCCCAGG + Intronic
999200085 5:149810037-149810059 TGGTCTTGAGAGATGCGGAGAGG + Intronic
999715260 5:154355250-154355272 TGATGATGAGAGAGGGTGAGGGG - Intronic
1002105806 5:176878969-176878991 TGGCGGTGAGAGCTGGGCAGGGG + Intronic
1002446159 5:179291277-179291299 TGGTGTTCAGGGGTGGGCAGTGG + Intronic
1004049652 6:12063730-12063752 AGGTTTTGAGAGGTGGTCACTGG + Intronic
1004375225 6:15085324-15085346 TGGTGCTGAGTGATGATGAGCGG - Intergenic
1005519286 6:26584449-26584471 TGGTCTTCAAAGTTGGTCAGTGG + Intergenic
1005707845 6:28473789-28473811 TGGGGTGGAGGGATGGTGAGGGG + Intergenic
1005938645 6:30544440-30544462 TGATGTTCAGAGATGCTCAGGGG - Exonic
1006935074 6:37711614-37711636 TGGTGTTGAGGGTGGGTCAATGG - Intergenic
1008051554 6:46905001-46905023 TGGTGGTGAAGGCTGGTCAGGGG - Intronic
1012939438 6:105402168-105402190 AGGAGTTGAGAGAGGGTGAGAGG - Intronic
1014276724 6:119397204-119397226 TAGAGTTGAGAGTTGGTCAAAGG + Intergenic
1019328196 7:449717-449739 TGGGGTTGAGAGATGGTTTTAGG + Intergenic
1019875251 7:3804797-3804819 TTCTGTTGAGTGATTGTCAGTGG + Intronic
1019901978 7:4028082-4028104 TGGTTCTCAGAGATGGTCTGTGG + Intronic
1022487946 7:30794783-30794805 TGGTTCTGAGTGATGGTGAGAGG - Intronic
1022602336 7:31773186-31773208 AGGACTTGAGAGATGGTCAGAGG - Intronic
1023400183 7:39787021-39787043 TGGTGTTGAGAGATGGTCAGAGG + Intergenic
1024073111 7:45802772-45802794 TGGTGTTGAGAGATGGTCAGAGG + Intergenic
1024650221 7:51397416-51397438 TGGTGTTGAGAGATGGCCAGAGG - Intergenic
1025054367 7:55753065-55753087 TGGTGTTGAGAGATGGTCAGAGG - Intergenic
1025132417 7:56383218-56383240 TGGTGTTGAGAGATGGTCAGAGG - Intergenic
1025183475 7:56837672-56837694 TGGTGGTGAGAGATGGTCAGAGG - Intergenic
1025688450 7:63739295-63739317 TGGTGGTGAGAGATGGTCAGAGG + Intergenic
1025911564 7:65832790-65832812 TGGTGTTGAGAGATGGTCAGAGG + Intergenic
1025978086 7:66385486-66385508 TGGTGTTGAGAGATGGTCAGAGG - Intronic
1026595879 7:71733568-71733590 TGGGGATGAGGGGTGGTCAGAGG + Intergenic
1027203667 7:76080150-76080172 TGGTGGTGAGAGATAGTCAGAGG - Intergenic
1032050498 7:128646466-128646488 TGGTGTTGAGAGATGGTCAGAGG + Intergenic
1033645932 7:143304271-143304293 TGGTGCTGACAGATGCTCAAAGG - Intronic
1035149410 7:156855376-156855398 TGGTGTTAAGAGATGGGGAGAGG - Intronic
1035527579 8:325725-325747 TGGAGCTAAGAGATGGTCACAGG - Intergenic
1037787987 8:21913602-21913624 TGGGGCTCCGAGATGGTCAGAGG - Exonic
1038240520 8:25803657-25803679 TGCTATTGAGAGATTTTCAGTGG + Intergenic
1038254522 8:25938824-25938846 TGGTATTGGGAGAAGGACAGGGG + Intronic
1039323295 8:36456814-36456836 TGGAGTTGAGAGAAAGTCATAGG + Intergenic
1041862154 8:62526786-62526808 TGAAGTGGAGAGATGATCAGGGG - Intronic
1042775393 8:72425036-72425058 TAGTGTTGAGGGAGGGACAGAGG - Intergenic
1044684653 8:94815220-94815242 TGTTGTGGAGAGAGGGTGAGAGG + Intronic
1045522247 8:102913638-102913660 TGCAGTAGAGAGATGGCCAGAGG + Intronic
1046100312 8:109606479-109606501 TGGTTTTTAGAGGTGGGCAGGGG + Intronic
1046997554 8:120541295-120541317 TGGAGTGGAGAGAGGGCCAGAGG - Intronic
1049137130 8:140913061-140913083 TAGTGTTGAGAAATGGTGAGAGG - Intronic
1055580116 9:77699321-77699343 TTGTGTAGAGGGATGATCAGTGG + Intergenic
1055661550 9:78508717-78508739 TGGTCAGGAGAGATGGTCACTGG + Intergenic
1056500473 9:87203812-87203834 TGGTGCTGAGAGGTGGAGAGGGG - Intergenic
1058629630 9:106973436-106973458 TGGTGCTGAGAGAAGGCTAGAGG + Intronic
1058853971 9:109041589-109041611 AGGGGCTGAGAGATGGTCAAAGG + Intronic
1186955139 X:14673471-14673493 TGAGTTTGAGAAATGGTCAGGGG + Intronic
1187050261 X:15688762-15688784 GGGTCATAAGAGATGGTCAGTGG - Intergenic
1187058674 X:15764679-15764701 GGGTCATAAGAGATGGTCAGTGG - Exonic
1189374209 X:40453910-40453932 TGGTGGTGAGAGAGAGACAGAGG - Intergenic
1190328504 X:49221356-49221378 TGGTATGGAGTGAAGGTCAGTGG - Intronic
1191892737 X:65961377-65961399 TGGTCTAGAGAGAGGGTAAGAGG + Intergenic
1193543383 X:82798253-82798275 TGGTGGGGAGTGATGGTCAAAGG - Intergenic
1194943100 X:100036291-100036313 TTCTGGTGAGGGATGGTCAGTGG - Intergenic
1197857249 X:130928451-130928473 TGTTGTAAAGAGGTGGTCAGAGG - Intergenic