ID: 922101604

View in Genome Browser
Species Human (GRCh38)
Location 1:222481872-222481894
Sequence ACACCACCACGACCCTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922101590_922101604 29 Left 922101590 1:222481820-222481842 CCCAGCAACTCCCTGGCCTCCTC 0: 31
1: 18
2: 13
3: 67
4: 529
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101599_922101604 -4 Left 922101599 1:222481853-222481875 CCCCTCTGACCATCTCTCAACAC No data
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101601_922101604 -6 Left 922101601 1:222481855-222481877 CCTCTGACCATCTCTCAACACCA 0: 13
1: 4
2: 1
3: 26
4: 233
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101600_922101604 -5 Left 922101600 1:222481854-222481876 CCCTCTGACCATCTCTCAACACC No data
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101592_922101604 19 Left 922101592 1:222481830-222481852 CCCTGGCCTCCTCCCCTACTTCT 0: 13
1: 15
2: 15
3: 78
4: 777
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101595_922101604 10 Left 922101595 1:222481839-222481861 CCTCCCCTACTTCTCCCCTCTGA No data
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101591_922101604 28 Left 922101591 1:222481821-222481843 CCAGCAACTCCCTGGCCTCCTCC 0: 13
1: 36
2: 22
3: 116
4: 787
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101593_922101604 18 Left 922101593 1:222481831-222481853 CCTGGCCTCCTCCCCTACTTCTC 0: 13
1: 15
2: 16
3: 96
4: 958
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101594_922101604 13 Left 922101594 1:222481836-222481858 CCTCCTCCCCTACTTCTCCCCTC No data
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101598_922101604 5 Left 922101598 1:222481844-222481866 CCTACTTCTCCCCTCTGACCATC No data
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101597_922101604 6 Left 922101597 1:222481843-222481865 CCCTACTTCTCCCCTCTGACCAT No data
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data
922101596_922101604 7 Left 922101596 1:222481842-222481864 CCCCTACTTCTCCCCTCTGACCA No data
Right 922101604 1:222481872-222481894 ACACCACCACGACCCTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922101604 Original CRISPR ACACCACCACGACCCTGGTC AGG Intergenic
No off target data available for this crispr