ID: 922101609

View in Genome Browser
Species Human (GRCh38)
Location 1:222481894-222481916
Sequence GACCACCATCATCTCCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922101602_922101609 9 Left 922101602 1:222481862-222481884 CCATCTCTCAACACCACCACGAC No data
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data
922101599_922101609 18 Left 922101599 1:222481853-222481875 CCCCTCTGACCATCTCTCAACAC No data
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data
922101596_922101609 29 Left 922101596 1:222481842-222481864 CCCCTACTTCTCCCCTCTGACCA No data
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data
922101605_922101609 -4 Left 922101605 1:222481875-222481897 CCACCACGACCCTGGTCAGGACC No data
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data
922101606_922101609 -7 Left 922101606 1:222481878-222481900 CCACGACCCTGGTCAGGACCACC No data
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data
922101601_922101609 16 Left 922101601 1:222481855-222481877 CCTCTGACCATCTCTCAACACCA 0: 13
1: 4
2: 1
3: 26
4: 233
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data
922101600_922101609 17 Left 922101600 1:222481854-222481876 CCCTCTGACCATCTCTCAACACC No data
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data
922101597_922101609 28 Left 922101597 1:222481843-222481865 CCCTACTTCTCCCCTCTGACCAT No data
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data
922101598_922101609 27 Left 922101598 1:222481844-222481866 CCTACTTCTCCCCTCTGACCATC No data
Right 922101609 1:222481894-222481916 GACCACCATCATCTCCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922101609 Original CRISPR GACCACCATCATCTCCCGCC TGG Intergenic
No off target data available for this crispr