ID: 922112011

View in Genome Browser
Species Human (GRCh38)
Location 1:222568601-222568623
Sequence TCCACATCTGTGCCAACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1270
Summary {0: 1, 1: 18, 2: 84, 3: 288, 4: 879}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922112011_922112012 15 Left 922112011 1:222568601-222568623 CCAAGTGTTGGCACAGATGTGGA 0: 1
1: 18
2: 84
3: 288
4: 879
Right 922112012 1:222568639-222568661 TATTGCTGTGTGAATGTCGATGG 0: 1
1: 0
2: 0
3: 5
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922112011 Original CRISPR TCCACATCTGTGCCAACACT TGG (reversed) Intronic
900037445 1:428340-428362 TCCACATCCTCTCCAACACTTGG + Intergenic
900059073 1:664081-664103 TCCACATCCTCTCCAACACTTGG + Intergenic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900588220 1:3444102-3444124 TCCACATCCTTGCCAGCACTTGG + Intergenic
901551964 1:10002115-10002137 ACCACATCTGGCCCTACACTGGG + Intronic
901862430 1:12083158-12083180 TCCACATCCTTGTCAGCACTTGG - Intronic
901899996 1:12352567-12352589 TCCACATCTTTGTCAACACTTGG - Intronic
902088296 1:13880310-13880332 TCCACAGCTTTTTCAACACTTGG + Intergenic
903287002 1:22283613-22283635 TCAACATCTGTGTCTCCACTTGG + Intergenic
903748771 1:25605695-25605717 TCCACATCCTTGCCAACACTTGG - Intergenic
904104998 1:28072543-28072565 TCCACATCCTTGCCAGCATTTGG - Intronic
904133884 1:28296052-28296074 TCTGCATCTTTGCCAACACTTGG + Intergenic
904334665 1:29789180-29789202 TCCACATCCTTCTCAACACTTGG - Intergenic
904481144 1:30794152-30794174 TCCACATCCTCACCAACACTTGG - Intergenic
904728505 1:32569102-32569124 TCCACATCCTTGCCAACATTTGG + Intronic
904982268 1:34516309-34516331 TCCATATATTTGTCAACACTTGG - Intergenic
905098395 1:35496009-35496031 TCCACATTCTTGCTAACACTTGG - Intronic
905496096 1:38388535-38388557 TCCAAGTCTTTGCCAATACTTGG - Intergenic
905590761 1:39161259-39161281 TCCAGACCTGTGCCATGACTGGG + Intronic
905903957 1:41604031-41604053 ACCACATCCTTGCCAACACTTGG - Intronic
905966472 1:42102460-42102482 TTCACATCTTTGCCAATACTTGG - Intergenic
905968693 1:42122617-42122639 TCCACATCTTTGCCAACACTTGG - Intergenic
906369315 1:45238876-45238898 TCCACATCCTTTCCAACATTTGG - Intronic
906937746 1:50229192-50229214 TCCACATCTCAGCCTATACTAGG - Intergenic
906968307 1:50482651-50482673 TCCTCATCTTTGCCAGTACTTGG + Intronic
907660519 1:56388481-56388503 TCCACTTCTCTGCCAACCCTTGG + Intergenic
907776277 1:57518895-57518917 TCAACATCTGAGCCAGCTCTGGG + Intronic
907865332 1:58394215-58394237 TCCACATCTCTGCCAACACTTGG - Intronic
908587625 1:65589055-65589077 TCCACATCTTCACCAATACTTGG + Intronic
908699136 1:66879673-66879695 TCCACATCTTTGCCAGCAATTGG + Intronic
908750402 1:67417050-67417072 TACACACCTGTGCCAACTCCTGG - Intronic
908779872 1:67680532-67680554 GCCAAATCTGTGCCTACAATAGG - Intergenic
908944141 1:69474028-69474050 TCCACATCTTCACCAACACTTGG + Intergenic
909137946 1:71825129-71825151 TCCATATCTCTGTCAACACTTGG + Intronic
909495780 1:76276803-76276825 TCCACATCTTTGCCAACACTTGG + Intronic
909499315 1:76316128-76316150 TCCACATCCTCGTCAACACTTGG - Intronic
909567466 1:77069668-77069690 TCCACATCCTTGCCAACATTTGG + Intergenic
909868805 1:80711765-80711787 TCTACATCCTTACCAACACTTGG - Intergenic
910198461 1:84671738-84671760 TCTACATCTTTGCCAACACTGGG - Intronic
910477272 1:87620496-87620518 TCCACATCTTTGCCAACACTTGG - Intergenic
910958557 1:92734977-92734999 TCTACATCCTTGTCAACACTTGG - Intronic
911026307 1:93438979-93439001 TCCACATCTTTACTAACACTTGG + Intergenic
911260456 1:95679475-95679497 ACCACATCTCTCCCAACACTAGG + Intergenic
911328789 1:96501413-96501435 TCTATATTTGTGCCATCACTTGG + Intergenic
911351050 1:96756004-96756026 TCCACATCCTTGCCAGCATTTGG - Intronic
911628290 1:100152453-100152475 TCTTCATCTGTGCCTTCACTGGG + Exonic
911800035 1:102124947-102124969 TCCATATCTTTGCGAATACTTGG - Intergenic
911850297 1:102809933-102809955 TTCACATCTTTGCCAAAACTTGG + Intergenic
912039617 1:105371819-105371841 TTCAGATCTTTGCCAACATTTGG - Intergenic
912086143 1:106007297-106007319 TCCACATCTTCACCAACATTTGG - Intergenic
912499395 1:110112124-110112146 GCCACCTCTGTGCCAGCACCTGG - Intergenic
912610629 1:111039720-111039742 TCCACATCCTTGCCAGCATTTGG - Intergenic
913041192 1:115025840-115025862 TCCACATCCTTGCTAACCCTTGG + Intergenic
913457641 1:119049659-119049681 TCCACAGCTGTCCCATCTCTTGG + Intronic
914407075 1:147386136-147386158 TCCATATCTTTGGCAACACTTGG + Intergenic
914460657 1:147880372-147880394 TTCACATCCTTGCCAACATTTGG + Intergenic
914892075 1:151634111-151634133 TCCACATCTTTGGCAAAACTTGG + Intronic
915824534 1:159061150-159061172 TCCAAATCTTTGTCAGCACTTGG + Intergenic
916149322 1:161770975-161770997 TCCACATCCTTGCTAACATTTGG + Intronic
916196753 1:162231127-162231149 TCCACATCCTTGCCAACACTTGG + Intronic
916298928 1:163252146-163252168 TCCACATCCTTCCCAACACTTGG + Intronic
916325265 1:163549818-163549840 TCTACATCTTTGCAAACACATGG + Intergenic
917014391 1:170512898-170512920 TCCACATCTTTGTCAGCACTTGG - Intergenic
917124290 1:171671916-171671938 TCTACATCTTTGTCAACATTTGG + Intergenic
917529384 1:175820767-175820789 TCCACATCATTGCCAATACTTGG + Intergenic
917819480 1:178747923-178747945 TTCACATCTTTGCGAACACTTGG - Intronic
917830076 1:178873454-178873476 TCCACATTTGTGCTAACAATTGG - Intronic
918010137 1:180578915-180578937 TCCACATCTGTGTCAGTACTCGG + Intergenic
918089097 1:181272480-181272502 CCCACATGTCTGCCAACACTGGG + Intergenic
918161714 1:181907280-181907302 TTCATATTTTTGCCAACACTTGG + Intergenic
918352477 1:183671474-183671496 TCCACATCCTTGCCAACACTTGG + Intronic
918677166 1:187301869-187301891 TCCACATCATTGCTAACAATTGG + Intergenic
919168656 1:193927213-193927235 CCGACATCTGTGCCAGCACCTGG - Intergenic
919311997 1:195922754-195922776 TCCACATCTTTGCCAACATGTGG - Intergenic
919456251 1:197823292-197823314 TCCAAATCCTTGCCAACACTTGG - Intergenic
919520105 1:198577616-198577638 TCCACATCCTTGGCAACACTTGG + Intergenic
920205841 1:204291273-204291295 TCTACATTTTTGCCAGCACTTGG - Intronic
920384624 1:205561727-205561749 TCCTCATCCTTGTCAACACTTGG - Intergenic
920633259 1:207673665-207673687 TCCACTTTATTGCCAACACTTGG - Intronic
921029072 1:211321216-211321238 TTCACATCCCTGACAACACTTGG - Intergenic
921163082 1:212486657-212486679 TCCCCATCTGTGCTAGGACTGGG - Intergenic
921204695 1:212838421-212838443 TCCATATCTTTGCTAACACATGG - Intronic
921428191 1:215030051-215030073 TCCACATCCTTGCCAGCATTTGG + Intronic
921470988 1:215549148-215549170 TCTACATCCTTGCCAACTCTTGG + Intergenic
921609946 1:217200137-217200159 TTCACATCTTTGCCAACATTTGG + Intergenic
922112011 1:222568601-222568623 TCCACATCTGTGCCAACACTTGG - Intronic
922118702 1:222641063-222641085 TCCACATCTTCTCCAACACATGG - Intronic
922254386 1:223880052-223880074 TCCAAATTCTTGCCAACACTTGG + Intergenic
922296432 1:224253836-224253858 TCCATATCCTTGCCAACATTTGG + Intronic
922382729 1:225048847-225048869 TCCATATCTTTGCCAGCACTTGG + Intronic
922412989 1:225393732-225393754 TCCACATCCCTGCCAACACTCGG + Intronic
923423966 1:233849703-233849725 TCTACATCCTTGCCAACATTTGG - Intergenic
923452370 1:234130672-234130694 TCCACCTCCTTGCCCACACTTGG - Intronic
923737846 1:236628504-236628526 TCCACATCTTTACCAACATTTGG - Intergenic
924664549 1:246057601-246057623 TCCACATCCTTGCCAGCATTTGG - Intronic
924781387 1:247151496-247151518 CCCACATCCTTGCCAACACATGG - Intronic
924910094 1:248500704-248500726 TCCAGATCTACACCAACACTAGG - Intergenic
924914008 1:248547343-248547365 TCCAGATCTACACCAACACTAGG + Intergenic
1062849680 10:734630-734652 TCCACATCCATGCCAACATCTGG - Intergenic
1063255024 10:4317929-4317951 TCCACAATTTTGCCCACACTTGG + Intergenic
1063397616 10:5705619-5705641 TCCTCATCCTTGCCAACGCTTGG + Intronic
1064381332 10:14844143-14844165 TTCACATCTGTGACAAAGCTAGG - Intronic
1064388193 10:14918012-14918034 TCCACATCGTTGCCAATACTTGG - Intronic
1064661177 10:17609623-17609645 TGCACATCCTTGCCAACCCTTGG - Intronic
1064663190 10:17626827-17626849 TCCACATCCTAGTCAACACTTGG + Intergenic
1064710268 10:18116101-18116123 TTCACATCCTTTCCAACACTTGG - Intergenic
1065086268 10:22180923-22180945 TCCACATCCTTGCCAACACTTGG - Intergenic
1065096769 10:22288420-22288442 TCCACATCCCTGTCAAAACTTGG + Intergenic
1065546890 10:26830724-26830746 TCCACATCCTTGCCAACACTTGG + Intronic
1065641764 10:27789726-27789748 TCCACATCCTCACCAACACTTGG + Intergenic
1065666187 10:28063939-28063961 TTCACATCCTTGCCAACACTTGG - Intronic
1065744656 10:28828964-28828986 TCCACATTCCTGCCAATACTTGG - Intergenic
1065906370 10:30256274-30256296 TCCACATCCTTGACAACACTTGG + Intergenic
1066245219 10:33576421-33576443 CCCACATCCTTGCCCACACTTGG - Intergenic
1066981162 10:42418017-42418039 ACCACCTCTGTGACAGCACTAGG + Intergenic
1067052997 10:43035524-43035546 TCCACATCCCTGTTAACACTTGG - Intergenic
1067058661 10:43066590-43066612 TCCACATTTGGGCCTACACTTGG - Intergenic
1067184940 10:44019303-44019325 TCCACATTCCTGTCAACACTTGG - Intergenic
1067566559 10:47342972-47342994 TCCACATTAGTGGCAACAATTGG - Intergenic
1067571288 10:47372964-47372986 CTCACATCTGTGTCAACACCCGG - Intronic
1067968217 10:50938842-50938864 TCAACATTTTTGCCAACATTGGG + Intergenic
1068613437 10:59086073-59086095 TCCAAATGTGTGCCAACAGCAGG + Intergenic
1068616628 10:59125592-59125614 TCCCCATCTTTGCCAGAACTTGG + Intergenic
1068663164 10:59645287-59645309 TCCATATCTCTCCCAAGACTTGG + Intergenic
1068875469 10:61991335-61991357 TCCACATCCTTGCCAACACTTGG + Intronic
1068930830 10:62588299-62588321 TTTGCATCTTTGCCAACACTTGG + Intronic
1069025539 10:63536854-63536876 TACACATCTTTGCCAACACTTGG - Intronic
1069292710 10:66802489-66802511 TCCACATCCTTGCCAACATTTGG - Intronic
1069295999 10:66845362-66845384 ACCATATCTTTGCCAACACTTGG - Intronic
1069644275 10:69981114-69981136 TCCATATCTCTTCCAAGACTTGG - Intergenic
1069670793 10:70201180-70201202 TCCACATCCTTGCCAGCATTTGG - Intergenic
1069854167 10:71430313-71430335 CCCACATCTTTGCCATCACTGGG - Intronic
1070088612 10:73261092-73261114 TCCACATCTTTGTTAATACTTGG + Intronic
1070220728 10:74441272-74441294 TCCACATCCTTGTCAACACTTGG - Intronic
1070311539 10:75276875-75276897 TCCACATCCTCGCCAACACGTGG + Intergenic
1070778792 10:79125789-79125811 TCCTCATCTGTGCCATGAGTGGG - Intronic
1071254272 10:83855165-83855187 CCCACATCCTTGCCAACATTTGG + Intergenic
1071452869 10:85816024-85816046 TCCACATTTTTGCCAGCATTTGG - Intronic
1071582232 10:86782473-86782495 TCCACATCCTTGCCAACACTTGG + Intronic
1071965624 10:90849305-90849327 TCCATATCCTTCCCAACACTTGG + Intronic
1072657869 10:97343078-97343100 TCCACATTGTTGCCAACAGTTGG - Intergenic
1072866854 10:99071838-99071860 TCAACAACTGTGCCAAGAATAGG - Intronic
1073262866 10:102203701-102203723 TCCTCATCTGAGCCAACCTTAGG + Intergenic
1073368854 10:102968549-102968571 TCCACATCTTTGTCAACACTTGG + Intronic
1073826226 10:107325509-107325531 TCCACATCCTTGCTGACACTTGG + Intergenic
1074422469 10:113321542-113321564 TCCACACATGTTCCAAGACTCGG - Intergenic
1075086188 10:119415864-119415886 TCCCCATCTGTGCCATGAGTGGG + Intronic
1075422450 10:122312253-122312275 TCCATATCCTTGCCAACACTAGG + Intronic
1075423086 10:122318876-122318898 TCCACATCCTTGCTAACATTTGG + Intronic
1075503511 10:123000698-123000720 TCCACATCCTTGACAATACTTGG + Intronic
1075548125 10:123371280-123371302 TTCACATCCTTGGCAACACTTGG + Intergenic
1075757129 10:124821710-124821732 CCCACAGCCTTGCCAACACTGGG - Intronic
1075832487 10:125423352-125423374 ACCACTCCTGTGACAACACTTGG - Intergenic
1075854887 10:125621335-125621357 TCCACATCCTCACCAACACTTGG + Intronic
1075962189 10:126578482-126578504 TCCATATCCTTGCTAACACTTGG - Intronic
1076052807 10:127348728-127348750 TCCCCATCTGACCAAACACTGGG + Intronic
1076129686 10:128004875-128004897 TCTACATCCGTGCCAACACTGGG + Intronic
1076178951 10:128391084-128391106 TCCGTATCTTTGCCAACACTTGG + Intergenic
1076288078 10:129320952-129320974 TCCATGTCTTTGTCAACACTTGG + Intergenic
1076584705 10:131537727-131537749 TCCACACCCTTGCCAATACTTGG + Intergenic
1076964171 11:66263-66285 TCCACATCCTCTCCAACACTTGG + Intergenic
1077387033 11:2274736-2274758 TCCACATCCCCGCCCACACTTGG + Intergenic
1077446735 11:2596179-2596201 GACACATCTTTACCAACACTTGG - Intronic
1077470604 11:2758403-2758425 TCCACATCCTCGCCAACATTTGG - Intronic
1077579867 11:3409974-3409996 GCCACATCTGTGGACACACTCGG - Intergenic
1077657228 11:4031529-4031551 TCCATATCTTTACAAACACTTGG + Intronic
1077821855 11:5753257-5753279 TCTACATCTTTGCCAATGCTTGG + Intronic
1078151499 11:8763236-8763258 TTCACATCCTTGCCAACAGTAGG - Intronic
1078239536 11:9518313-9518335 TCCACATCTTTGCCAACATTTGG - Intronic
1078287758 11:9975014-9975036 GCCACATCTTTACTAACACTTGG - Intronic
1078435615 11:11322643-11322665 TCTACATCCTTGCCAACATTTGG - Intronic
1078578578 11:12521367-12521389 TCTACATCCTTGCTAACACTTGG - Intronic
1079184284 11:18222008-18222030 TCTACATCCTTGCCAAAACTTGG + Intronic
1079317364 11:19420282-19420304 TCCATATCCTTGCCAACACCTGG - Intronic
1079641872 11:22815853-22815875 TCCATATCCTTGCCAACAATTGG + Intronic
1079888914 11:26025598-26025620 TTCACATCTTCACCAACACTTGG - Intergenic
1080473370 11:32567786-32567808 TCCACATCCTGGCCAACATTGGG + Intergenic
1080881365 11:36323923-36323945 TCCACATCCTTGCCAATACACGG - Intronic
1081105491 11:39062437-39062459 TCCACATGCTAGCCAACACTTGG + Intergenic
1081624411 11:44640217-44640239 TCCACAGCCTTGCCAACACTTGG - Intergenic
1081670702 11:44940883-44940905 TCCACATCCTCACCAACACTCGG + Intronic
1082873539 11:57965688-57965710 TCCACATCTTTGCCAACACTTGG + Intergenic
1082910673 11:58370696-58370718 TTCATATCTTTGCCATCACTTGG + Intergenic
1083357647 11:62078988-62079010 TCCACATCCTTGGCAACACTTGG + Intergenic
1083483895 11:62970612-62970634 TCCACATCTTTGTCAAAACTTGG - Intronic
1083979538 11:66155592-66155614 GCCACATCCTTGCCAACACCTGG - Intronic
1084180194 11:67442273-67442295 TTTCCATCTGTGCTAACACTTGG + Intronic
1084434929 11:69133439-69133461 TCCACATCTTTGTCAACACTTGG + Intergenic
1084507585 11:69578377-69578399 TCCACATCCTTGCCAGCATTTGG + Intergenic
1085368067 11:75971483-75971505 TCCATATCTTTGCCAGCATTTGG + Intronic
1085504846 11:77052511-77052533 CGCACATCCTTGCCAACACTTGG - Intergenic
1086340949 11:85847612-85847634 TCCACATCCTTGCCAACACATGG + Intergenic
1086426642 11:86690553-86690575 TTCACTTCTTTGCCTACACTTGG - Intergenic
1086472913 11:87134882-87134904 CCTACATCTATGCTAACACTTGG + Intronic
1086504390 11:87489292-87489314 TCCACATCCTTGCCAACACTTGG - Intergenic
1086777795 11:90860993-90861015 TTCACATCATTGCCAACACTTGG - Intergenic
1087578304 11:100018816-100018838 TCCACGTCTTTGCCAAAACTTGG + Intronic
1087611611 11:100441230-100441252 TCCACATCCTTGCCAGCATTTGG - Intergenic
1087980236 11:104603702-104603724 TTCACATCTTTCACAACACTTGG + Intergenic
1088305512 11:108403200-108403222 TCCATATCCTTGCCAACAATTGG + Intronic
1088350424 11:108880755-108880777 TCCACATCTGTCTCAAGTCTGGG - Intronic
1088539529 11:110899053-110899075 TCCACATTTTTGCCAGCATTTGG + Intergenic
1088873456 11:113912686-113912708 TACACATCCCTGCCAACATTTGG + Intronic
1088926703 11:114310249-114310271 TGCAAATCCTTGCCAACACTTGG + Intronic
1089112281 11:116066244-116066266 CCCACATCTGTGCCAGACCTTGG - Intergenic
1089123304 11:116157734-116157756 TTCACATTTTTGGCAACACTTGG - Intergenic
1089145024 11:116322056-116322078 TCCACATCTTTGCCATTACTTGG - Intergenic
1089280315 11:117369694-117369716 AAAACATCTGTGCTAACACTTGG - Intronic
1089854070 11:121525569-121525591 TTCACATCTTTGCCAACACTTGG + Intronic
1090002975 11:122977930-122977952 TCCAAATCTGAGCCATCGCTGGG + Intronic
1090053168 11:123398569-123398591 TCCACATCCTTGGCACCACTTGG + Intergenic
1090115121 11:123962876-123962898 TCCACATGCTTGTCAACACTTGG - Intergenic
1090445736 11:126763332-126763354 TCCACATCTGTGCCAAGGGCTGG + Intronic
1090746779 11:129711962-129711984 TCCACATCCTTGCCAACATTTGG + Intergenic
1090811056 11:130243818-130243840 TCCATATCCTTACCAACACTTGG + Intronic
1091423408 12:364078-364100 TCCACATCCTGGTCAACACTTGG - Intronic
1091704206 12:2682710-2682732 CCCACATTTGTTCCCACACTTGG - Intronic
1091851636 12:3703924-3703946 TCCACATCTTTGCCAAGAGTTGG - Intronic
1091860646 12:3779394-3779416 TCCACATCATTGTCAACACTTGG + Intergenic
1092010759 12:5110323-5110345 TACACATCCCTGTCAACACTTGG - Intergenic
1092014288 12:5144169-5144191 TTCCCATGTTTGCCAACACTTGG + Intergenic
1092014371 12:5145443-5145465 TCCACATCTTAGTCAGCACTCGG + Intergenic
1092395452 12:8121931-8121953 ACCCCAACTGGGCCAACACTAGG - Intergenic
1092445071 12:8547935-8547957 TCTACATCCTTTCCAACACTTGG - Intergenic
1092771214 12:11898763-11898785 TCCACCTCCTAGCCAACACTTGG - Intergenic
1092775290 12:11939410-11939432 TCTACATCTTTGCCAGCATTTGG - Intergenic
1093188804 12:16051755-16051777 CCTACATCTTTGCCAACACTAGG - Intergenic
1093271739 12:17071002-17071024 TCCACATCTTTAACAAAACTTGG + Intergenic
1093899276 12:24611565-24611587 TCCATATTCTTGCCAACACTTGG + Intergenic
1093900754 12:24628765-24628787 TCCACATCCCTGCCAGCAGTTGG + Intergenic
1094006646 12:25760138-25760160 TCCACATCCTTGTCAATACTTGG - Intergenic
1094110926 12:26861895-26861917 CCCACCTCTTTGCCAGCACTTGG + Intergenic
1094242132 12:28241032-28241054 TCCACATCCTTGCCAGCATTTGG + Intronic
1094452342 12:30595930-30595952 TCCGTATCCTTGCCAACACTTGG - Intergenic
1094534901 12:31312515-31312537 TTCAGATATTTGCCAACACTTGG + Intronic
1094579006 12:31716488-31716510 TCCATATCCTTGCCAACACTTGG + Intronic
1094774189 12:33704004-33704026 TCCACAGCTTTGCCAACACTGGG + Intergenic
1095381581 12:41600894-41600916 TCCATGTCTTTGCCAACACTTGG + Intergenic
1095682096 12:44989647-44989669 TCCACATTCTTGACAACACTTGG - Intergenic
1095742447 12:45621905-45621927 TCCACATTTTCACCAACACTTGG - Intergenic
1095847753 12:46764205-46764227 TCCACAGCCCTGCCAACATTTGG - Intergenic
1096342881 12:50817011-50817033 TCCAAATCCTTGCCAACTCTTGG - Intronic
1096474682 12:51901093-51901115 TCCAGGTCTGTGCCCAGACTGGG + Intergenic
1096564287 12:52464273-52464295 TCCACATCCTTGCCAGCATTTGG - Intergenic
1096607333 12:52776297-52776319 TCAAGATCTGTGCTAACACAAGG + Intronic
1096654856 12:53082777-53082799 TCCACATCCTTGCCATCACTTGG + Intergenic
1096902275 12:54897017-54897039 TCCACATTCTTGCCAACACACGG + Intergenic
1097289475 12:57902158-57902180 TCCACACTGCTGCCAACACTGGG + Intergenic
1097513561 12:60573763-60573785 TCCACATCTTCGCCAGTACTTGG - Intergenic
1097625918 12:62000393-62000415 TCCACATCCTTGCCAACATTTGG - Intronic
1097663728 12:62457509-62457531 TCCACATTTCCACCAACACTTGG - Intergenic
1098043269 12:66373615-66373637 TGCACATGTGTGCCAACACTTGG - Intronic
1098776345 12:74624217-74624239 TCCGTATCTTTGCCAGCACTTGG - Intergenic
1098864648 12:75747917-75747939 TCTACATCCTTGCCAGCACTGGG + Intergenic
1099160491 12:79235243-79235265 TCTACATCCTTGCTAACACTTGG + Intronic
1099581298 12:84450648-84450670 TCCACATTCTTGCCAACATTCGG + Intergenic
1100077623 12:90804563-90804585 TCCACATCATTACCAACAATTGG + Intergenic
1100349815 12:93769634-93769656 TCCTTATCTTTGGCAACACTTGG + Intronic
1100357628 12:93846421-93846443 TCCACACCCTTGCCAACATTTGG + Intronic
1100499514 12:95160378-95160400 TCCACATCCTCACCAACACTAGG - Intronic
1100520075 12:95366199-95366221 TTCACATCTTTGTCAACACTTGG + Intergenic
1100681205 12:96923485-96923507 TCCACATTTTTGCTAATACTTGG + Intronic
1100683472 12:96957417-96957439 TCCACATCATAGCCAACAGTTGG - Intergenic
1101040705 12:100752716-100752738 ATCACATCTTTGCCAACTCTGGG - Intronic
1101369344 12:104111384-104111406 TTCACATCTTGGCTAACACTTGG + Intergenic
1101847800 12:108376476-108376498 CCCCCATCTTTGTCAACACTTGG - Intergenic
1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG + Intronic
1102069556 12:110006296-110006318 TTCACATCCTTGTCAACACTTGG + Intronic
1102089729 12:110175728-110175750 TCCACATCATCACCAACACTTGG + Intronic
1102220334 12:111189968-111189990 TCCACATCCTTGTCAACACTTGG + Intronic
1102265252 12:111478600-111478622 TCTGCATCCTTGCCAACACTTGG - Intronic
1102445250 12:112997358-112997380 TCCACATCTTTGTCAAGACTTGG + Intronic
1102547740 12:113668911-113668933 TCCTCATCTGTGACAATAATAGG - Intergenic
1102553406 12:113709638-113709660 TCCACATCCTTGCCAACATTTGG + Intergenic
1102660067 12:114518584-114518606 TCCACATCTTTGCTAACATTGGG - Intergenic
1102744823 12:115241538-115241560 TACACACCTGTGCGAACCCTAGG + Intergenic
1104107110 12:125673504-125673526 TCCACATCTTTGCCAACAATGGG - Intergenic
1104837991 12:131804264-131804286 TCCACCTCAGGGCCAACATTTGG + Intergenic
1105043485 12:132981307-132981329 TCCACATACTTGCCTACACTAGG + Intergenic
1105052971 12:133071285-133071307 TCCACATTATTGCCAGCACTTGG - Intergenic
1105525527 13:21174805-21174827 TCCACATCTTTCCAAACACTTGG + Intronic
1105661480 13:22500239-22500261 TCCACATCCTTTCCAACATTTGG + Intergenic
1105698392 13:22914221-22914243 TCTACATCCTTGCCATCACTTGG - Intergenic
1105850050 13:24326460-24326482 TCTACATCCTTGCCATCACTTGG - Intergenic
1105890331 13:24678007-24678029 TCTACATCTGTCCCAATAGTTGG + Intergenic
1106201593 13:27542350-27542372 TCCACATTCTTGCCAACATTTGG - Intergenic
1107068348 13:36242249-36242271 TCCACATCCTTGACAACACTTGG + Intronic
1107345614 13:39457477-39457499 TCCACATCCTTTCCAGCACTTGG - Intronic
1107445211 13:40464484-40464506 TCTACATCTTTGCCAACACCTGG + Intergenic
1107645446 13:42490089-42490111 TCCACATCCTTGTCAACACTTGG - Intergenic
1107813540 13:44222743-44222765 TACAAATCCTTGCCAACACTTGG + Intergenic
1108056094 13:46486867-46486889 TCCACATCTTTGTCAACACTTGG - Intergenic
1108211783 13:48146817-48146839 TCTATATCCTTGCCAACACTTGG + Intergenic
1108278364 13:48835376-48835398 TCCACATCCTTATCAACACTTGG + Intergenic
1108368048 13:49737338-49737360 TCCACATCTTCGCCAGCATTTGG + Intronic
1108430671 13:50350525-50350547 TCCATATCCTTGGCAACACTTGG + Intronic
1108606394 13:52043788-52043810 TCAACATCCTTACCAACACTTGG - Intronic
1108873175 13:55012472-55012494 TCCACATCATTGCCCACAATTGG + Intergenic
1109739458 13:66533042-66533064 GCCACTTATGTGCCCACACTGGG + Intronic
1109989663 13:70038547-70038569 TTCACATCTTTGCCAGCATTTGG + Intronic
1110203010 13:72875580-72875602 TCCATATCTTTGCCAGCATTTGG + Intronic
1110230711 13:73164616-73164638 TCCATATCTTTGCCAATGCTGGG - Intergenic
1110348186 13:74473590-74473612 TCCACATCCTTGTAAACACTTGG - Intergenic
1111021909 13:82460855-82460877 TCTACATCTTTGCCAAAACCTGG + Intergenic
1111642588 13:90988405-90988427 TCCTTATCTTTGCCAACACTGGG - Intergenic
1111717898 13:91903495-91903517 TCCACATCTTTGCCAACACTTGG + Intronic
1111751577 13:92338282-92338304 TCCACATCCTTGCCAGCATTTGG - Intronic
1111978200 13:94989728-94989750 TCCACATCCCTGCCATCACTGGG + Intergenic
1111992579 13:95131797-95131819 TTCACATCCCTGCCAACACTTGG - Intronic
1112023124 13:95389345-95389367 TCCACACACTTGCCAACACTTGG + Intergenic
1112263075 13:97895760-97895782 TCCTCATCTTTGTCAACACTTGG - Intergenic
1112406910 13:99129030-99129052 TCCACATCTTTGCCAGTATTTGG - Intergenic
1112602064 13:100866847-100866869 TCCATATCTCTTCCAAGACTTGG + Intergenic
1112964077 13:105165471-105165493 TCCACATCTCTGCCAACACTTGG - Intergenic
1113829346 13:113282868-113282890 TCCACATCTCTGCCAAAACTTGG - Intergenic
1114175457 14:20315281-20315303 TCCACATCTTTGCCAGAAGTTGG - Intronic
1114366255 14:22029887-22029909 TCCACATATTTGCCAATATTGGG - Intergenic
1114531864 14:23401532-23401554 TCTACATCTGTGGCATCTCTGGG + Intronic
1115093804 14:29610518-29610540 TCCACATCCTTGCCAGCATTTGG - Intronic
1115127198 14:30010273-30010295 TCCATATTCATGCCAACACTTGG - Intronic
1115329827 14:32185179-32185201 TCCACATCTCTGCCAACCCTGGG + Intergenic
1115932865 14:38517179-38517201 TCCACATCCTTAGCAACACTTGG - Intergenic
1115947486 14:38678424-38678446 CCCACATCTGTACCAGCAATAGG + Intergenic
1116539425 14:46080647-46080669 TCCACATTCTTGCCAACATTTGG + Intergenic
1116569164 14:46493108-46493130 TCTACATCTTTACCAACACTTGG - Intergenic
1116574989 14:46562736-46562758 TCCATATCTTTACCAACACCTGG - Intergenic
1116733890 14:48663483-48663505 TCCACATCCTTACCAACACTAGG - Intergenic
1117042817 14:51782515-51782537 TCCACATCCTTGCCAATACTTGG + Intergenic
1117226113 14:53661073-53661095 TCCATATCTTTGCCAGCATTTGG + Intergenic
1117234906 14:53763111-53763133 TCCACATCTTTGATAACACTTGG - Intergenic
1117706890 14:58479164-58479186 TCCACATCCTCCCCAACACTTGG + Intronic
1117709499 14:58510484-58510506 TCCACATCCTTGCCGACACTTGG - Intronic
1117801858 14:59452585-59452607 TCCATATCTTTGCCAGCATTTGG - Intronic
1118097464 14:62553808-62553830 TCCACATTCCTGCCAACACAAGG - Intergenic
1118131683 14:62972349-62972371 TCCACATCCTTGCCAACACTTGG - Intronic
1118825872 14:69380717-69380739 TGCACATCTATGCCATCATTGGG - Intronic
1118840620 14:69507651-69507673 TCCACATCCTTGCCAGCATTTGG + Intronic
1118988063 14:70773753-70773775 TTCACAGCTCTGCCAACTCTTGG - Intronic
1119014087 14:71031330-71031352 TGCACACCTGTCCCAGCACTTGG - Intronic
1119096385 14:71835827-71835849 TCTACATCTTTGCCAATGCTTGG + Intergenic
1119203350 14:72775745-72775767 TCCGAATCTCTGCCAACACCTGG - Intronic
1119534272 14:75389589-75389611 TCCACATCTTTGCCAGCATTTGG - Intergenic
1120452793 14:84691327-84691349 TCCTCATCCTTGCCAACATTTGG + Intergenic
1120836746 14:89045709-89045731 TCTCTATCTTTGCCAACACTTGG - Intergenic
1120895505 14:89528013-89528035 TTCACATCTTTGCTAAAACTTGG - Intronic
1121200655 14:92114619-92114641 TCTACATCCTTGCCAACAATTGG + Intergenic
1121402878 14:93696460-93696482 CCCACATCTTTGTCAACACTTGG + Intronic
1121468838 14:94136183-94136205 TCCATATCCTTGTCAACACTTGG - Intergenic
1121475532 14:94198176-94198198 TCCTCATCCTTGCCAACATTTGG + Intronic
1121878318 14:97475462-97475484 TCCACATTCTTGCCAACACTTGG + Intergenic
1121958085 14:98232536-98232558 TCCACATCCTTGTCAACATTTGG - Intergenic
1121968519 14:98334299-98334321 TCCACATTTTGGCAAACACTTGG - Intergenic
1121992262 14:98570094-98570116 TCCACATCTTTACCAACATTTGG + Intergenic
1122276934 14:100595812-100595834 TCCACATCTTTGCTGACACTTGG + Intergenic
1122376405 14:101262560-101262582 TCCACATTCTTGCCAACACTTGG + Intergenic
1122628840 14:103098249-103098271 TCCACATCTGACCCCACTCTGGG + Intergenic
1122840001 14:104454434-104454456 TCTACATCCTTGCCATCACTTGG - Intergenic
1123425271 15:20165622-20165644 TCCACATGCTTGCCAACAATTGG + Intergenic
1123534495 15:21172156-21172178 TCCACATGCTTGCCAACAATTGG + Intergenic
1123738377 15:23208934-23208956 TCCGCATCTTTGCCAACACTTGG + Intergenic
1123897630 15:24844078-24844100 TCCACATCCTTACCAGCACTTGG + Intronic
1124190317 15:27569687-27569709 TTTACATCTTTGACAACACTTGG + Intergenic
1124289586 15:28437598-28437620 TCCGCATCTTTGCCAACACTTGG + Intergenic
1124293636 15:28479713-28479735 TCCGCATCTTTGCCAACACTTGG - Intergenic
1124352184 15:28964298-28964320 TCCACATCCTTGCCAGCATTTGG + Intronic
1124466836 15:29947891-29947913 AGCACAGCTGTGCCAACCCTGGG + Intronic
1124552166 15:30691689-30691711 GTCACATCTTTGCCAACACTCGG + Intronic
1124558891 15:30752920-30752942 CCCACATCCTTGTCAACACTTGG + Intronic
1124672368 15:31652829-31652851 CCCACATCCTTGTCAACACTTGG - Intronic
1124679075 15:31713977-31713999 GTCACATCTTTGCCAACACTCGG - Intronic
1124891036 15:33733095-33733117 TCCACATCCTTGCCAGCATTTGG - Intronic
1125053189 15:35326048-35326070 TCCATATCTTTGTCAACAGTTGG - Intronic
1125082281 15:35689053-35689075 TACACATCTTTAGCAACACTTGG + Intergenic
1125178255 15:36850812-36850834 TCCACATCTTTGCCAACACTTGG - Intergenic
1125304759 15:38298207-38298229 ACCACATCCTTGCCAATACTTGG - Intronic
1125372491 15:38993481-38993503 CCCACATCTATGACAACATTTGG - Intergenic
1126076018 15:44910694-44910716 TCCACTGCTTTGCCAACCCTAGG + Intergenic
1126356150 15:47798544-47798566 TCCACATCCTTTCCAAAACTTGG - Intergenic
1126458792 15:48893698-48893720 TTCCCATCTTTTCCAACACTGGG - Intronic
1126595461 15:50380235-50380257 TCCAAATCCTTGCCAACTCTTGG - Intergenic
1126658513 15:51007443-51007465 TCCACATCCTTGCCAGCATTTGG + Intergenic
1127216629 15:56830250-56830272 TCCACATCCTTACCAACACTTGG - Intronic
1127276507 15:57450196-57450218 TCCACATCCTTGCCACCATTTGG + Intronic
1127322384 15:57859452-57859474 TCTACTGCTGTGCCCACACTAGG - Intergenic
1127362644 15:58258463-58258485 TCCACATCCTTGTAAACACTTGG - Intronic
1127399036 15:58566861-58566883 TCCACATCTTTACTAACTCTGGG - Intronic
1127401255 15:58588263-58588285 TCCACATCTGTTATGACACTTGG - Intergenic
1127677519 15:61256269-61256291 TTCACATCTTTGCTAACATTTGG - Intergenic
1127739533 15:61888193-61888215 TCCACATCCTTGCCAAAATTTGG - Intronic
1128387425 15:67160283-67160305 TCCACATCCTTGCCAATACATGG + Intronic
1128660334 15:69496144-69496166 TCCACATCGTCACCAACACTTGG + Intergenic
1128785189 15:70390897-70390919 TCCATATCCTTGTCAACACTTGG - Intergenic
1128908530 15:71491186-71491208 TCCACACCCTTGACAACACTGGG + Intronic
1129041514 15:72690852-72690874 TCCACATCCCTGTCAACACTTGG + Intronic
1129129205 15:73477004-73477026 TCCACATCCTCACCAACACTTGG + Intronic
1129279438 15:74472574-74472596 TTCACATCCTTGCCAACACTTGG - Intergenic
1129647561 15:77450838-77450860 TCCACATCCTTGCCAGCATTTGG + Intronic
1129774529 15:78227550-78227572 CCCACATCTTTGTCAACAGTGGG - Intronic
1129882358 15:79015879-79015901 ACCACCACAGTGCCAACACTTGG + Intronic
1129965421 15:79730584-79730606 TCCACATCTTCACCAACACATGG - Intergenic
1129995576 15:80002274-80002296 TCTATATCTGTCCCAACACTTGG - Intergenic
1130628062 15:85536330-85536352 TCTTCATCTTTGCCAGCACTTGG - Intronic
1130637230 15:85635206-85635228 TCCACATCTTTGCCAACATTTGG + Intronic
1131066634 15:89438906-89438928 ACTAAATGTGTGCCAACACTAGG + Intergenic
1131102906 15:89707649-89707671 TGCATATCTTTGCCAACACTTGG - Intronic
1131104674 15:89724810-89724832 TCCACATCTTCACCATCACTTGG - Intronic
1131273870 15:90964208-90964230 TCCACATCTTCACCAACAGTTGG - Intergenic
1131320088 15:91380368-91380390 TCCACATCCTTGCCAGCAGTTGG + Intergenic
1131395956 15:92086264-92086286 TTCAGATCCTTGCCAACACTTGG + Intronic
1131400595 15:92122500-92122522 TCCACATCCTCCCCAACACTTGG - Intronic
1131492085 15:92872123-92872145 TCCACATCCTTACCAACACTTGG + Intergenic
1132097600 15:98999431-98999453 TCCTCATCCTTGCCAACATTTGG - Intronic
1132285595 15:100660039-100660061 ACCAGATTTGTGCCAGCACTTGG + Intergenic
1132444379 15:101898920-101898942 TCCACATCCTCTCCAACACTTGG - Intergenic
1132755644 16:1483428-1483450 TCCACATCCTTGTCCACACTTGG - Intergenic
1133193169 16:4149618-4149640 TCCATATTTTTGCCAACATTTGG - Intergenic
1133380488 16:5326101-5326123 TCCACATCCTTGTCAGCACTTGG + Intergenic
1133650698 16:7811213-7811235 TCCATATCCTTGCCAACAGTTGG - Intergenic
1133813032 16:9176029-9176051 TCCACATCTTTGCCAACACTTGG + Intergenic
1135528732 16:23234256-23234278 TCCACATCTTCACCAGCACTTGG + Intergenic
1135554957 16:23428595-23428617 TCCACATCCTTGCCAAAATTAGG - Intronic
1135740378 16:24970176-24970198 TCTAAATCTGAGCCAACACCTGG + Intronic
1135893515 16:26377857-26377879 TTCATATCTTTGCCATCACTAGG - Intergenic
1136674405 16:31889289-31889311 TCCATAATTATGCCAACACTGGG + Intronic
1136709087 16:32219057-32219079 TCCACATCTTTGCCAACACTTGG - Intergenic
1136758822 16:32710367-32710389 TCCACATCTTTGCCAACACTTGG + Intergenic
1136809285 16:33160017-33160039 TCCACATCTTTGCCAACACTTGG - Intergenic
1136815761 16:33270097-33270119 TCCACATCTTTGCCAACACTTGG - Intronic
1136859585 16:33690121-33690143 TCCACATGCTTGCCAACAATTGG - Intergenic
1137740650 16:50769334-50769356 TCCATATCTTTGCCAACACTTGG + Intronic
1137779587 16:51086715-51086737 CCCACATCATTACCAACACTTGG + Intergenic
1138114092 16:54346611-54346633 TCCACATCCTCGCCAACATTTGG + Intergenic
1138197827 16:55066687-55066709 TCCACACCTCCGCCAACATTTGG - Intergenic
1138374822 16:56555683-56555705 TCTACATCCTTGTCAACACTTGG - Intergenic
1138888046 16:61104702-61104724 TCCACATACTTGCCAGCACTTGG + Intergenic
1139041932 16:63007909-63007931 TCCACATCCTTGCCAGCATTTGG + Intergenic
1139177073 16:64701248-64701270 TCCATGTCTGTTCCAGCACTAGG + Intergenic
1139370281 16:66463285-66463307 TCCACATCCTCACCAACACTTGG + Intronic
1139588528 16:67919823-67919845 GTCACCTCTGTGCCACCACTGGG + Intronic
1140683360 16:77408203-77408225 TCCTCATCTTTGCCAGTACTTGG - Intronic
1140988528 16:80184937-80184959 TTCACATCTTTTCCAACACTTGG - Intergenic
1141013993 16:80430506-80430528 TCCACATCTTCCCCAACACTTGG + Intergenic
1141163794 16:81647096-81647118 TCCACACCTTTGCCAACACTTGG + Intronic
1141237930 16:82237139-82237161 TCCACATCCTTGCCAGCAATTGG - Intergenic
1141415631 16:83870540-83870562 TCCACATCCCTGCCAACAGTTGG - Intergenic
1141575540 16:84961150-84961172 CCACCATCCGTGCCAACACTGGG + Intergenic
1141737697 16:85865158-85865180 TCCACATCCTTGTCAGCACTTGG + Intergenic
1141757863 16:86004561-86004583 TCCACATCCTTGTCAATACTTGG + Intergenic
1203060976 16_KI270728v1_random:970692-970714 TCCACATCTTTGCCAACACTTGG + Intergenic
1203121091 16_KI270728v1_random:1538300-1538322 TCCACATGCTTGCCAACAATTGG - Intergenic
1142524238 17:527576-527598 TCCACATCCTTACCAACACTTGG + Intronic
1143341098 17:6211725-6211747 TCCACATCAGTGCCGGCCCTGGG + Intergenic
1143468161 17:7152349-7152371 TCCACATCCTTGCCAACATTTGG - Intergenic
1143743162 17:8968724-8968746 TCCACATCCTTGCCAACATTTGG - Intergenic
1144234118 17:13240380-13240402 TCCTCATCTCTGCCAATGCTTGG + Intergenic
1144336262 17:14271807-14271829 TCCACATCTTTGCCAACAATTGG + Intergenic
1144451699 17:15385838-15385860 TCTACATCCTTGCCAACACTTGG - Intergenic
1144681293 17:17197013-17197035 TCCACATCCTTGCCAACATATGG - Intronic
1144894956 17:18523634-18523656 CCTACATCGGTACCAACACTGGG + Intergenic
1144937151 17:18909147-18909169 TCCACATCTTCACCAACACTTGG - Intronic
1144953638 17:19007160-19007182 TCCACATCCTTGCCAACATGTGG + Intronic
1145087558 17:19955289-19955311 CCCACCTCTATCCCAACACTTGG - Intronic
1145094529 17:20014103-20014125 TCCACATTCTTGCCAACTCTTGG + Intronic
1145974608 17:28976931-28976953 TCCCCATCCCTGCCAGCACTGGG + Intronic
1146106672 17:30044634-30044656 TCCACATCTTTCCCAACACTTGG - Intronic
1146317169 17:31816583-31816605 TCCATATCATTGCCAACACTTGG - Intergenic
1147272757 17:39287858-39287880 TCCAAATCCTTGTCAACACTTGG + Intronic
1148802342 17:50238113-50238135 TCCATATCCTTGCCAACATTTGG + Intergenic
1149399610 17:56281834-56281856 TCTACATCTTTACCAACATTTGG - Intronic
1149779299 17:59384091-59384113 TACACATTCATGCCAACACTTGG + Intronic
1150153713 17:62832521-62832543 TCCACATCTTTGCCAGCATTAGG + Intergenic
1150453366 17:65287825-65287847 ACCAGATCTGTGCCACCACGTGG - Intergenic
1150495153 17:65602200-65602222 TTCATATCTTTGCCAACACATGG - Intronic
1150536282 17:66045394-66045416 TTCACATCCTTGCCAAGACTTGG - Intronic
1150540655 17:66095035-66095057 TCTACATTACTGCCAACACTGGG - Intronic
1150555178 17:66247947-66247969 TTCACAACTGTGCCAGCACATGG - Intronic
1151010704 17:70492220-70492242 TCCACATCTTTGCCAACAATTGG - Intergenic
1151410114 17:73919534-73919556 TCCACATCCCTGCCAGCATTTGG - Intergenic
1151948565 17:77333103-77333125 TCCACATCCTGGCCAACATTTGG + Intronic
1152402689 17:80077616-80077638 TCCACATCCTCGCCAACATTTGG + Intronic
1152620294 17:81360354-81360376 TCCACATCCTTGCCAACATTTGG + Intergenic
1152893999 17:82899768-82899790 CCCACATCTGTGCCAACGCTTGG + Intronic
1153031338 18:715867-715889 TTCACATCCTTGCCAATACTTGG - Intergenic
1153143813 18:2005630-2005652 TCCACATCCTTGGAAACACTTGG - Intergenic
1153251324 18:3125112-3125134 TCTGCATCCTTGCCAACACTTGG - Intronic
1153697151 18:7655403-7655425 TCCACATCCTTGCCAGCATTTGG - Intronic
1154931413 18:21000759-21000781 TCCATATCCCTGCCAACACTTGG - Intronic
1155048323 18:22124025-22124047 TCCACATCTTCACCAACACTTGG - Intergenic
1155082184 18:22421185-22421207 TCCACATTTTTGCCACCATTTGG - Intergenic
1155180597 18:23342707-23342729 TCCACATCCTTGCCAACATTTGG + Intronic
1155274644 18:24174606-24174628 TCCACATCCTTGTCAGCACTTGG + Intronic
1155419518 18:25639862-25639884 TACACATCTCTGCCACCACTTGG + Intergenic
1155665391 18:28301753-28301775 TCCACATCCTTGACAACATTTGG - Intergenic
1155904668 18:31435312-31435334 TCCACATCTTTGACAGCACTTGG - Intergenic
1155992766 18:32296998-32297020 TCCACACCTGGCCCACCACTTGG + Intronic
1156576424 18:38321887-38321909 TCCACAGCTTTGCCAATACTTGG - Intergenic
1157326314 18:46671420-46671442 TCCACATCTGTGCACAAACATGG - Intronic
1157490767 18:48122181-48122203 CACACCTCTGTGCCTACACTGGG - Intronic
1157788914 18:50512571-50512593 TCCACATCATTGCCAACTCTTGG + Intergenic
1157934254 18:51856380-51856402 TCAACATCTGTGTCAACCCATGG - Intergenic
1158408692 18:57185404-57185426 TCCATATCTCTCCCAAGACTTGG + Intergenic
1158783527 18:60680352-60680374 TCCACATCCTTGCCAGGACTTGG - Intergenic
1159044601 18:63357189-63357211 GCCACATCCCTGCCAATACTTGG - Intronic
1159167683 18:64723849-64723871 TCCAGATATATGCCAACACTTGG + Intergenic
1159487227 18:69078077-69078099 TCCACATCATTGCCAGCATTTGG - Intergenic
1159523308 18:69554770-69554792 TCCATATCCTTACCAACACTTGG + Intronic
1159698055 18:71586551-71586573 TCTACATTTTTGACAACACTAGG + Intergenic
1159772635 18:72564759-72564781 TTCACATCTCTCCCAAAACTTGG - Intronic
1159874450 18:73794692-73794714 TCTACATCCCTGCCAGCACTTGG - Intergenic
1160075642 18:75673458-75673480 TCCACATCCTGACCAACACTTGG + Intergenic
1160307116 18:77750251-77750273 TCCACATCTGTGCAGAAGCTTGG - Intergenic
1160315010 18:77835114-77835136 TCAGCTTCCGTGCCAACACTTGG - Intergenic
1160405126 18:78640085-78640107 CCCACATCAGTGTCAACACTGGG - Intergenic
1160640974 19:135895-135917 TCCACATCCTCTCCAACACTTGG + Intergenic
1162703148 19:12534417-12534439 TTCACATCTTTGCCATCATTTGG - Intronic
1162830153 19:13279413-13279435 TCCACATCCTTGTCAACACTTGG - Intronic
1162858196 19:13485714-13485736 TTCACAACCTTGCCAACACTTGG - Intronic
1164006668 19:21156059-21156081 TCCACACCTCTCCCAGCACTAGG + Intronic
1164484782 19:28645638-28645660 TTCCCATCTTTGCCAACACCTGG - Intergenic
1164838717 19:31376185-31376207 TAGACATGTTTGCCAACACTTGG + Intergenic
1164855908 19:31520806-31520828 TCCACATCCTCACCAACACTTGG + Intergenic
1164980372 19:32609133-32609155 TCCACATCCCTGCCAACATTTGG - Intronic
1165066126 19:33229595-33229617 TCCACATCCTTGCCAACATTGGG - Intergenic
1165255091 19:34572680-34572702 TCCATATCTTCACCAACACTTGG - Intergenic
1165581339 19:36867153-36867175 CCCACATCTTTACCAACATTTGG + Intronic
1165886209 19:39080638-39080660 TCCACATCGCTGCCAACACTTGG - Intergenic
1166230456 19:41423270-41423292 GCCACATCTGAGACATCACTGGG - Intronic
1166462076 19:42996379-42996401 TCCACATCCTTGCCAAAACTTGG - Intronic
1166479345 19:43156349-43156371 TCCACATCCTTGCCAACACTTGG - Intronic
1166501865 19:43347510-43347532 TCCACATCCTTGCCAACACTTGG - Intergenic
1166508254 19:43385945-43385967 TCCACATCCTTGCCAACACTTGG + Intergenic
1167701571 19:51050613-51050635 TCCACATCTCTGCTAATACTTGG + Intergenic
1167784215 19:51624329-51624351 TACATATATGTGACAACACTAGG + Intronic
1167790135 19:51671173-51671195 CCCACATCCTTGCCAACCCTTGG + Intergenic
1168150592 19:54445612-54445634 TCCACATTTCTGCCAGCATTTGG - Intergenic
1168592032 19:57644512-57644534 TTCACATCCTTGCCAATACTTGG + Intergenic
926301430 2:11606319-11606341 TCCACATCTTTGTCAGCACTTGG + Intronic
926433275 2:12812565-12812587 TCCACAGCTTTGCCAGTACTTGG - Intergenic
926709245 2:15863725-15863747 TTCACATCTTTGCCAATGCTTGG - Intergenic
926791866 2:16581446-16581468 TCCACATCTTCTCCAACATTTGG - Intronic
926906892 2:17814336-17814358 ACCACATCCATGCCAACATTTGG - Intergenic
927348499 2:22076821-22076843 TCAAAATCTTTGCCAACATTAGG + Intergenic
927535587 2:23855444-23855466 TCCTCATCCTTGCCAACAATTGG - Intronic
927580015 2:24234843-24234865 TCCACATCCTTGCCAGCATTTGG - Intronic
927762787 2:25774827-25774849 TCTACATCCTTGCCAACACTTGG + Intronic
927792902 2:26024447-26024469 TTCACATCTTTACCAACACTTGG + Intergenic
928003843 2:27545534-27545556 TCCACCTTCTTGCCAACACTTGG + Intronic
928311678 2:30216183-30216205 TTAACATCTTTCCCAACACTTGG - Intergenic
928511081 2:32004524-32004546 TTCTCATCTTTGCTAACACTTGG - Intronic
928939268 2:36711047-36711069 TCCACATCCTCACCAACACTTGG + Intronic
928991715 2:37239025-37239047 TCCACATCTTCACCAATACTTGG - Intronic
929110300 2:38400699-38400721 TCCACAACCTTGTCAACACTTGG - Intergenic
929278847 2:40055916-40055938 TCCACATCCTCACCAACACTGGG + Intergenic
929327402 2:40633384-40633406 TCCACAGCTTCACCAACACTTGG + Intergenic
929341706 2:40826842-40826864 TCTACATCTTTACCAATACTTGG + Intergenic
929626203 2:43410243-43410265 TCCATATCCTAGCCAACACTTGG - Intronic
930233671 2:48868413-48868435 ACAACATCTGTCCCATCACTAGG + Intergenic
930246998 2:48994069-48994091 TCAACTACTGTGCCAACATTGGG - Intronic
930383840 2:50666574-50666596 TCCACATTTTCGCCAACACTTGG + Intronic
930733666 2:54753159-54753181 TCCACATTCTTGCCAAGACTTGG + Intronic
931112853 2:59131784-59131806 TCCACATCGCTGACAACATTTGG - Intergenic
931215418 2:60237790-60237812 TGCATATCTTTTCCAACACTTGG + Intergenic
931405686 2:61975511-61975533 TCCACATTTTTGTCAACATTTGG + Intronic
931506563 2:62934193-62934215 TCCACATCCTTGCCAATACTTGG + Intronic
931531966 2:63225377-63225399 TCCCCATCCTTGCCAACACTTGG - Intronic
931568098 2:63637784-63637806 TCCACATTTTTGCCAACGCTTGG - Intronic
931865561 2:66407199-66407221 CCCACATCCTAGCCAACACTTGG - Intergenic
931911786 2:66907559-66907581 TCCACATTCTTGTCAACACTTGG + Intergenic
931965366 2:67527855-67527877 TCCACATCCTTGCCAGCATTTGG - Intergenic
932171558 2:69562220-69562242 TCCACATCCTTACCAACACTTGG + Intronic
932645866 2:73500977-73500999 TCCACATCCTTGCCAACACTGGG + Intronic
932873250 2:75425103-75425125 CCCATTTCTGTGCCAGCACTGGG - Intergenic
933081091 2:77987606-77987628 TCCACATCCTTGCCAGCATTTGG - Intergenic
933134343 2:78713021-78713043 TCCCCATTTTTGCCCACACTGGG + Intergenic
933381960 2:81559308-81559330 TCCACATCTCTGCCAGCATTTGG - Intergenic
933883400 2:86694873-86694895 TCCACATCCTTGACAACACTTGG - Intronic
933930023 2:87140449-87140471 TCTACATAGTTGCCAACACTTGG + Intergenic
933982255 2:87560637-87560659 TCCACATCCACACCAACACTTGG - Intergenic
934001356 2:87716234-87716256 TCTACATAGTTGCCAACACTTGG + Intergenic
934028332 2:88018906-88018928 CCCACTCCTGTGCCAGCACTTGG - Intergenic
934457947 2:94191231-94191253 TCCACATGCTTGCCAACAATTGG - Intergenic
935119426 2:100169855-100169877 TCCACATCATCTCCAACACTTGG - Intergenic
935119670 2:100172968-100172990 TCCACATCTTTATCAACACTTGG - Intergenic
935152713 2:100452082-100452104 TCCAAATCCTTGTCAACACTTGG - Intergenic
935222943 2:101030508-101030530 TCCACATCCTTGCTAAAACTTGG - Intronic
935531748 2:104240991-104241013 TCCACATCTCTCCCAAGACTTGG - Intergenic
935793533 2:106616518-106616540 TCCATATCTTTGGCAGCACTTGG + Intergenic
936311583 2:111390173-111390195 TCCACATCCACACCAACACTTGG + Intergenic
937170949 2:119868327-119868349 TCCACATCCTTGTCAACATTTGG - Intronic
937280254 2:120712786-120712808 CCAACACCTGTGCCAACACCTGG + Intergenic
937344024 2:121111978-121112000 TCCACAACCTTGCCAACATTTGG - Intergenic
937351157 2:121163060-121163082 TCCACATCCTCACCAACACTTGG + Intergenic
937485654 2:122312304-122312326 TCCACATCCTTGCCAGCATTTGG + Intergenic
938295355 2:130174943-130174965 TGCACAGCAGTGCCAAGACTTGG - Exonic
938411734 2:131070396-131070418 TCCACATCCTTAACAACACTTGG - Intronic
939121262 2:138120301-138120323 TCCATATCTTTGCCAACACTTGG + Intergenic
939165176 2:138633614-138633636 TCCACGTTCTTGCCAACACTTGG - Intergenic
939358685 2:141139696-141139718 CCTACATCTTTGCCAACACTTGG - Intronic
939546193 2:143556995-143557017 TCCACATCTTGGCCAGCATTTGG - Intronic
939834545 2:147112703-147112725 CCCACATCCTTGCCAAGACTTGG + Intergenic
940150965 2:150600089-150600111 TCCACATTAGTGCCACCAATAGG - Intergenic
940962354 2:159799398-159799420 TCCACATCTTTGCCAGCATGTGG - Intronic
941223702 2:162817701-162817723 TCCACATCTTCACCAACATTTGG + Intronic
941338256 2:164271519-164271541 TCCAAATCTTCACCAACACTTGG - Intergenic
941837056 2:170034814-170034836 TCCACATCTTTGTCAACATTTGG + Intronic
941956166 2:171206900-171206922 TCCACATCCTTGTCAGCACTTGG - Intronic
942477798 2:176346892-176346914 TCTATATCTTTGCCAACATTTGG + Intergenic
942682128 2:178487836-178487858 TCTGCATCTTTGCCAAAACTTGG + Intronic
942918351 2:181340253-181340275 TCTGCATCTTTGTCAACACTTGG + Intergenic
943097305 2:183445550-183445572 TCCACATTCTTGTCAACACTTGG + Intergenic
943456128 2:188109607-188109629 ACCACATCCTTGCCAATACTAGG - Intergenic
943468025 2:188254612-188254634 TCCACCTTCTTGCCAACACTTGG - Intergenic
943550698 2:189336239-189336261 TCCACATCCTTGCCATTACTTGG - Intergenic
944105293 2:196073119-196073141 CCCACTTCTGTGGCCACACTGGG - Intergenic
944185833 2:196947762-196947784 TACACATCTTTTCCAACATTTGG - Intergenic
944205745 2:197156451-197156473 TCCACATCTTCACCAACACTTGG - Intronic
944219566 2:197289271-197289293 TCCACATCCTTGTCAACACTTGG - Intronic
944534244 2:200694152-200694174 TCCACATATGGGCTAACCCTGGG + Intergenic
944734480 2:202549850-202549872 TCTGCATCTTTGCCAACATTTGG + Intronic
944750950 2:202708999-202709021 TCTACATCCTTACCAACACTTGG + Intronic
944758850 2:202792195-202792217 TCCACATCTTTGCCAACATTTGG - Intronic
945542154 2:211101502-211101524 TCCACATCTTCATCAACACTTGG - Intergenic
945931751 2:215862170-215862192 TCCTTATCTTTGCCAACATTTGG - Intergenic
945977265 2:216280678-216280700 CCCACATCTACGCCACCACTCGG + Intronic
946235229 2:218320595-218320617 TCCCCTTTTGTGCCAACTCTGGG - Intronic
946556477 2:220864247-220864269 TCCACATCCTTGTCAACACTTGG - Intergenic
946625559 2:221608904-221608926 TTCACATTTGTGACAACACTTGG + Intergenic
946685314 2:222263474-222263496 TCTGCATCTGTGCCAACCCTTGG - Intronic
947086886 2:226463346-226463368 TCCACATCCTTGTCAACACTTGG - Intergenic
947241658 2:228001027-228001049 TCCACATCTTTGCCAGCATCTGG + Intronic
947304348 2:228727238-228727260 TCCACATCCTTGCCAAAACTAGG - Intergenic
947590939 2:231385124-231385146 TCCACATCCTCACCAACACTTGG + Intergenic
947867669 2:233411333-233411355 TCCACATCCTCACCAACACTTGG + Intronic
947881250 2:233515362-233515384 TCCACATCCTTGCTAACACTTGG + Intronic
948203868 2:236150751-236150773 TCCATATCTTTGCCATCACTTGG + Intergenic
948527810 2:238583211-238583233 TCCACATCCTTGCCAGCATTTGG + Intergenic
948625397 2:239265194-239265216 CCCACATGTGTGCCAACCCCAGG + Intronic
948683210 2:239651767-239651789 TCCACATCCTTGCCAGCATTTGG - Intergenic
1168781437 20:494546-494568 TTCACATTTTTGCCAGCACTTGG + Intronic
1168834604 20:869697-869719 TCCACCTCTGTGCCCTCTCTCGG - Intergenic
1169086557 20:2829068-2829090 TCCACATCCTTGCCAGTACTTGG - Intergenic
1169177376 20:3529212-3529234 TCCACATCAGTTCCCACATTTGG - Intronic
1169528525 20:6457566-6457588 TTCACATCCTTGACAACACTTGG - Intergenic
1169802843 20:9529218-9529240 TCCACATCATCACCAACACTTGG + Intronic
1171450912 20:25235726-25235748 TCCACATCCATGCTAGCACTTGG + Intergenic
1172041359 20:32048530-32048552 TCCACATCCTTGCCAACATTTGG - Intergenic
1172580064 20:36040174-36040196 TCCACATCTTTGCCAGCATTTGG - Intergenic
1173887285 20:46471096-46471118 TCCACATTCTTGCCAAAACTTGG + Intergenic
1173909390 20:46652892-46652914 TCCACATCTTTGCCAACATTTGG + Intronic
1173962379 20:47084741-47084763 TCCACATCCTTGCCAGCCCTTGG - Intronic
1174065157 20:47859368-47859390 TCCAAATGTTTGCCAACACTTGG - Intergenic
1174211792 20:48885402-48885424 TCCACATCCTTGCCAGCATTTGG - Intergenic
1174479741 20:50822530-50822552 TCTACATCCTTGCCAACACTTGG - Intronic
1174529733 20:51201642-51201664 CCCACATCTTCACCAACACTTGG + Intergenic
1174675753 20:52352651-52352673 TCCACATCCTCACCAACACTTGG + Intergenic
1175360827 20:58411172-58411194 TCCACATCCTCACCAACACTTGG + Intronic
1175459418 20:59140704-59140726 TCCACATCTTTGCCAGCATTTGG + Intergenic
1175467569 20:59201123-59201145 TCTACATTATTGCCAACACTTGG + Intronic
1175548382 20:59796884-59796906 TCCATCTCTCTGCCAACACATGG + Intronic
1175609281 20:60336918-60336940 TCCACTTCTTTGCCAGCATTTGG + Intergenic
1175652487 20:60737630-60737652 TCCACATCTTAGCCCACACCAGG + Intergenic
1175695053 20:61096653-61096675 CCCACATCTTTGCCATCACTTGG + Intergenic
1175698369 20:61119485-61119507 TCCACATCCTTGCCAGCATTTGG - Intergenic
1175918047 20:62436642-62436664 TCCACGTCTTTTCCAACACTTGG + Intergenic
1176050912 20:63119350-63119372 CCCACAACTGTGCCAACACAGGG + Intergenic
1176080612 20:63271123-63271145 TCTGCATCTCTGTCAACACTTGG - Intronic
1176902421 21:14459169-14459191 TCTTCATCCTTGCCAACACTTGG - Intergenic
1177011962 21:15741480-15741502 TCTACATTTTTGCCAACACCTGG + Intronic
1177127022 21:17206959-17206981 TTCACATCCTTTCCAACACTTGG - Intergenic
1177283066 21:19010167-19010189 TCCACATTTTTACCAACATTTGG - Intergenic
1177933426 21:27314655-27314677 TCTAAATCTGTCCCAAGACTAGG + Intergenic
1177996133 21:28100863-28100885 TCCACTTCCTAGCCAACACTTGG + Intergenic
1178274901 21:31228291-31228313 TCCATATCTTTGCCAACACTGGG - Intronic
1178388695 21:32180708-32180730 TCCATATCCTTGCCAACACATGG + Intergenic
1178483690 21:33003583-33003605 TCCACATCCCTGCCAACACTGGG + Intergenic
1178586061 21:33872150-33872172 CCCAGATCTTTGCCAACACTGGG - Intronic
1179099238 21:38342005-38342027 TTCACATCTCTGCCCTCACTTGG - Intergenic
1179160950 21:38898597-38898619 TCTACATCTTGGCCAACATTTGG - Intergenic
1179312783 21:40211526-40211548 TCCACATCTTTGCCAGCATGTGG + Intronic
1179480769 21:41676895-41676917 TACACATCCTCGCCAACACTTGG + Intergenic
1180507470 22:16027195-16027217 TCTACATCTTTGCCAGCATTTGG - Intergenic
1180977637 22:19857858-19857880 TCCACATCCTCACCAACACTTGG + Intergenic
1181619503 22:24079537-24079559 TGCACATCTGTGTCAGCCCTAGG + Intronic
1181835334 22:25602321-25602343 TCCACATCCTTGTCAACACTTGG - Intronic
1181897008 22:26119049-26119071 TCCATATCTTTGCCAGCATTTGG - Intergenic
1182247676 22:28972751-28972773 TCCACATTCTAGCCAACACTTGG + Intronic
1182295550 22:29309711-29309733 TCCACATCAGTGCCCACCCAGGG + Intronic
1182406553 22:30138048-30138070 TCCACATCCTTACCAGCACTTGG + Intronic
1182648694 22:31832396-31832418 TCCATATCCTTGTCAACACTTGG + Intronic
1182938488 22:34250187-34250209 TCCACATCCTTGCCAAAATTTGG + Intergenic
1183798811 22:40144067-40144089 TCCACATTCTTGCCAACACCTGG - Intronic
1183833703 22:40434861-40434883 TCCCCATCTCTACCCACACTGGG + Intronic
1184072982 22:42157762-42157784 TCCACATCCTTGCCAGCATTTGG - Intergenic
1184123227 22:42467605-42467627 TCCATATCTTTGCCTATACTTGG - Intergenic
1184255981 22:43287215-43287237 TCCTCCTCTGTGCCCACACTGGG - Intronic
1184655389 22:45939105-45939127 TCCACATCCTCACCAACACTTGG - Intronic
1184862349 22:47179989-47180011 TCCACATCCTTGCCCACACTGGG + Intergenic
1184972215 22:48032314-48032336 TTCACATCCTTGCCAACATTTGG + Intergenic
1185265080 22:49897466-49897488 TCCACATCCGCACCAGCACTTGG + Intergenic
1185349861 22:50329209-50329231 TCCACATCCTTCCCAACATTTGG + Intergenic
1203331486 22_KI270738v1_random:95936-95958 TCTACATCTTTGCCAGCATTTGG - Intergenic
949497597 3:4647584-4647606 TCCATATCCTTACCAACACTTGG + Intronic
949833370 3:8241276-8241298 TCCACATCCTTGCCAACAATTGG - Intergenic
950237061 3:11331928-11331950 TCCACATCTTCGACAACACTTGG - Intronic
950246645 3:11426179-11426201 TCCACATCCTTGCCAGCACTTGG + Intronic
950286067 3:11745941-11745963 TTCAGATCTTTGCCAACACTTGG - Intergenic
950616396 3:14163111-14163133 TCCAAATCTTTACCAACACTTGG - Intronic
950685117 3:14611583-14611605 TCCACATCCTTACCAATACTTGG + Intergenic
950727868 3:14929490-14929512 TCCACATCATTGCTAACACTTGG + Intronic
950878146 3:16297340-16297362 TCCACATCCTTGCCAACGCTTGG - Intronic
950958051 3:17076159-17076181 ACCACATCCTTGTCAACACTTGG + Intronic
951479646 3:23146260-23146282 TCCACATTTTAGGCAACACTTGG + Intergenic
951571564 3:24069045-24069067 TCCACATCCTTGAAAACACTTGG - Intergenic
951605626 3:24431487-24431509 TCCACATCCTTGCTAACATTTGG - Intronic
951692714 3:25413621-25413643 TCCACATCTTCACCAACCCTTGG + Intronic
951905291 3:27700384-27700406 TCCATATCCTTGCTAACACTTGG + Intergenic
951982905 3:28585355-28585377 TCCACATCATTGTGAACACTCGG + Intergenic
952002887 3:28807740-28807762 TCCACATCTTTACCAACACTTGG + Intergenic
952097803 3:29975398-29975420 TCCACATCCTTACCAACACTTGG + Intronic
952120366 3:30235722-30235744 TCCACATCCTTGCCAATACTTGG - Intergenic
953484409 3:43281779-43281801 TCCACATCCCTGCCAACACTTGG - Intergenic
953753609 3:45628508-45628530 TCCACATCCTTGCCAACACTTGG - Intronic
953819510 3:46193116-46193138 CCCACATCTTTACCAACACTTGG - Intronic
954339382 3:49940586-49940608 TCCAATTCTGTGGCATCACTAGG + Intronic
954475447 3:50740511-50740533 TCCACATCTTTACTAACATTTGG + Intronic
954494437 3:50941415-50941437 TCCACATCCTTGGCATCACTTGG - Intronic
954522942 3:51245747-51245769 TCCACAGCCTTGCCACCACTGGG - Intronic
954606302 3:51912994-51913016 TCTACATCCTTGCCAACATTTGG - Intergenic
954641687 3:52103843-52103865 TCCACCTCCCTTCCAACACTTGG - Intronic
954942419 3:54386546-54386568 ATCACATCAGTGTCAACACTGGG - Intronic
955673034 3:61421923-61421945 TCCACACCTCCACCAACACTTGG + Intergenic
956050140 3:65239082-65239104 TCCACAGCCTTGCCAACATTTGG + Intergenic
956871713 3:73424878-73424900 TTCACATCCCTGCCAACACTTGG - Intronic
957351807 3:79033235-79033257 TCCACAAATGTGCCAACAATTGG - Intronic
957532531 3:81459160-81459182 TCCACATCCTTGACAACATTTGG - Intergenic
957834523 3:85569560-85569582 CCCACATCTTTGCCAGCATTTGG + Intronic
958086750 3:88818950-88818972 TCCACATCCTTGCCAGCATTTGG + Intergenic
958964586 3:100544975-100544997 TCCACATCCATACCAACACTTGG + Intronic
959499999 3:107095877-107095899 TCCACATCCTTGCCAGCATTTGG - Intergenic
959789393 3:110339478-110339500 TCCACATCCTTTCCAAAACTTGG + Intergenic
960037500 3:113116612-113116634 CCCACATCTCTGCCAGCAGTTGG + Intergenic
960091072 3:113638424-113638446 TCCACATCTTTGCCAACATTTGG + Intergenic
960849060 3:122033134-122033156 TCCACATCCTTGGCAACATTTGG + Intergenic
960904599 3:122587437-122587459 TCCACATCCTTGCCAGCATTTGG + Intronic
961065728 3:123874982-123875004 TCCACATCTTTGTCAGTACTTGG - Intronic
961188519 3:124937218-124937240 TCCCTATCCTTGCCAACACTTGG + Intronic
961325546 3:126107210-126107232 TCCACGTCTGTGAAAACAGTTGG + Exonic
961427224 3:126857802-126857824 ACCACATCCTTGCCAGCACTTGG - Intronic
961462522 3:127061465-127061487 TCCACATCCTTGCCAGCATTTGG + Intergenic
961661643 3:128471879-128471901 TCCATTTCCTTGCCAACACTTGG - Intergenic
961679527 3:128590029-128590051 TCCACATCCTTGCCAGCATTTGG + Intergenic
961991829 3:131200330-131200352 TCCACATCCTTAACAACACTTGG - Intronic
962139592 3:132774749-132774771 TCCATATCCTTGCCAACATTTGG + Intergenic
962516979 3:136161209-136161231 TTCACATCTTTGCCAACTTTTGG - Intronic
962614813 3:137114606-137114628 TCCACATCCTTGCCAACGCGTGG + Intergenic
962864130 3:139433248-139433270 TCCATATCTTTGTCAACACTTGG - Intergenic
963407373 3:144883298-144883320 TCCATATCTTTGTCAACATTAGG + Intergenic
963701209 3:148629218-148629240 TCCACATCCTTGCCAACACTTGG - Intergenic
963822976 3:149919885-149919907 TCCACTTCCGTGCCAACGCTTGG + Intronic
963845787 3:150156534-150156556 TCCACATCCTTGCCAGCATTTGG - Intergenic
964033245 3:152164278-152164300 TCCACATCCTTGCAAACATTTGG - Intergenic
964180511 3:153877992-153878014 TCCATACCCTTGCCAACACTTGG - Intergenic
964215128 3:154271630-154271652 TCCACATCCTTGCCAGTACTTGG - Intergenic
964341114 3:155709429-155709451 TCTACATCTTTGCCAGCATTTGG + Intronic
964509211 3:157431710-157431732 TCCACATTCTTGCCAACATTTGG + Intronic
964642326 3:158922322-158922344 TCTGCATCTTTGCCAACATTTGG + Intergenic
964833738 3:160914075-160914097 TCCACATCTTTGCCAACACTTGG + Intronic
964973996 3:162598542-162598564 TCAGCTTCTGTCCCAACACTTGG - Intergenic
964985185 3:162729545-162729567 TCCATATCTTTGCCAATATTTGG - Intergenic
965008983 3:163062023-163062045 TCCACATCTTTGCTAATACTTGG - Intergenic
965326999 3:167318952-167318974 TCCAAATCCCTGCCAACACTTGG - Intronic
965831353 3:172793111-172793133 TCCACATCCTTACCAACAATTGG + Intronic
966332542 3:178830603-178830625 TCCAAATCTTTGCCAACATTTGG + Intronic
966476296 3:180351532-180351554 TCCACATCCTTGCCAACACTTGG + Intergenic
966608017 3:181841527-181841549 TCCACATCCTTGCCAGCATTTGG - Intergenic
967188973 3:186968983-186969005 TTCACTTCCTTGCCAACACTTGG + Intronic
967509928 3:190299067-190299089 TCCACATATGCTACAACACTTGG + Intergenic
967784933 3:193482748-193482770 TCCACATTCTTGACAACACTTGG - Intronic
967800549 3:193653904-193653926 TCTACATCCTTGCCAACACTTGG - Intronic
967807140 3:193725763-193725785 TCCATATCTTTGTCAACACTTGG - Intergenic
967862787 3:194164992-194165014 TTCACATCTTTGCCAATGCTTGG - Intergenic
967898271 3:194418645-194418667 TTCACATCATTGCCAACACTTGG - Intronic
967909695 3:194531726-194531748 TCTACATCTTTGCCAGCATTTGG + Intergenic
968254389 3:197253396-197253418 TCCACATCCTTGCCAGCATTTGG - Intronic
968270247 3:197397914-197397936 CCCACATCCCTGCCAATACTTGG - Intergenic
968345809 3:198006537-198006559 TCCACATCTTTGCCAGCATTTGG + Intronic
968716663 4:2164908-2164930 TCCACATCCTTGCCAGCACTTGG - Intronic
968931695 4:3582991-3583013 TCCACATCCTTGTCAACACTTGG + Intronic
969218282 4:5740938-5740960 TCCACATCTTTGCCAGAATTTGG - Intronic
969368045 4:6711250-6711272 TCCACATCTTCCCCAACACTTGG - Intergenic
969686578 4:8678392-8678414 TCCACACCTTTGACAACACTTGG + Intergenic
969833616 4:9819322-9819344 TCCAAATTCTTGCCAACACTTGG + Intronic
969842913 4:9896242-9896264 TCCACATCCTTGGCAACACGTGG + Intronic
970034441 4:11716511-11716533 TCTACATCCTTGCCAACACATGG + Intergenic
970226381 4:13862062-13862084 TCTATATCTTTGCCAATACTTGG + Intergenic
970379334 4:15491236-15491258 TCCACATCTTTTCCAATACTTGG + Intronic
970419715 4:15894228-15894250 TCCGCAGCCTTGCCAACACTTGG + Intergenic
971235063 4:24833966-24833988 CCCACATCAGTGATAACACTGGG + Intronic
971628671 4:28959349-28959371 TCCACATCCTTGCCAGCACATGG + Intergenic
972756462 4:42053209-42053231 TCCACATCTTCACCAACATTTGG - Intronic
973203096 4:47527737-47527759 TCTACATCCTTGCCAACACTTGG - Intronic
974752416 4:66157626-66157648 TCCATATCCTTGCCAACTCTTGG + Intergenic
974755832 4:66206164-66206186 TCCACACCTTTGTCAACACTTGG + Intergenic
975213179 4:71724400-71724422 TCCATATCTTCACCAACACTTGG + Intergenic
975354390 4:73383633-73383655 TCCACATCTTTGCCAGCATTTGG + Intergenic
975567774 4:75777691-75777713 TCCACATCTTCGCCATCATTTGG - Intronic
975653171 4:76614711-76614733 TCCAGATTTCTGGCAACACTGGG - Intronic
975825157 4:78311704-78311726 TCCACATCCTTGCCACCACTTGG + Intronic
975932592 4:79543483-79543505 TTCACATCCTTGCCAACATTTGG + Intergenic
976028632 4:80723098-80723120 TCCACATCCTTGCCAACAGTTGG - Intronic
976581086 4:86738351-86738373 TCCACATCCTTGACAACACTTGG + Intronic
977054389 4:92172391-92172413 TCCACACCCTTGTCAACACTTGG + Intergenic
977158184 4:93600567-93600589 TCCACATTTTTGCCAATATTTGG - Intronic
977282850 4:95063986-95064008 TCCACATCCTTGCCAAACCTTGG - Intronic
977472706 4:97461216-97461238 TCCACATCTTTTCCAACATTTGG + Intronic
977702930 4:100040835-100040857 TCCACATTCTTGTCAACACTTGG + Intergenic
978204680 4:106067155-106067177 TCCTCATCCTTGCCAACACTTGG + Intronic
978475303 4:109121622-109121644 TCCACATCTTTGCCATCATTTGG - Intronic
978659066 4:111101378-111101400 TCCACATCCTTGCCAGCATTTGG - Intergenic
978670476 4:111242824-111242846 TCCACATCCCTGTCAACACTTGG - Intergenic
979036440 4:115725538-115725560 TGCACATCTTTGCCAAGATTTGG - Intergenic
979038070 4:115750881-115750903 TCCCTATCTTTGCCAATACTTGG + Intergenic
979084738 4:116393022-116393044 TCCAAATCTTTGCCAACACTGGG + Intergenic
979121493 4:116907995-116908017 TCCGCATCCTTGCCAACATTTGG - Intergenic
979355766 4:119702747-119702769 TCTACATCTTTGCCAACACTTGG - Intergenic
979495939 4:121382045-121382067 TCCACATCCTTGCCAGCATTTGG + Intergenic
979517535 4:121627298-121627320 TCCACATCTTTGCCAGTATTTGG + Intergenic
979781886 4:124662106-124662128 TCTACATCTTTACCAACATTTGG - Intergenic
979905697 4:126288137-126288159 TCCAAACCCCTGCCAACACTTGG + Intergenic
980150853 4:129046807-129046829 TCCACATCTTTGTCAACACTTGG + Intronic
980469488 4:133233454-133233476 TTCACATCTTTGCAAACACTTGG + Intergenic
980618518 4:135266592-135266614 TCCACATCTGTCCCAGCTCTTGG - Intergenic
981445277 4:144829636-144829658 TCCACATCCTTGCCAACACTTGG - Intergenic
981726870 4:147857168-147857190 TCCACGTCTGTGCCAAAATCTGG + Intronic
981743740 4:148031459-148031481 CCCACATCTGTGACAAAGCTAGG + Intronic
981910320 4:149972453-149972475 TCCACAACCTTTCCAACACTTGG - Intergenic
982211871 4:153044111-153044133 TCCACATCCTTGTCAGCACTTGG - Intergenic
982639513 4:157940491-157940513 TCCACATTCTTGCCAGCACTTGG - Intergenic
982698709 4:158634163-158634185 TCCACATCCTTCCCAACACTTGG + Intronic
982735390 4:159001143-159001165 TCCACATCTTTGCCAACACTTGG + Intronic
983240911 4:165231898-165231920 TCCACATCCTTGCCAACACTTGG + Intronic
983281557 4:165687272-165687294 TCCACATCTTTGCTGACTCTAGG - Intergenic
983352465 4:166609364-166609386 TACACATCCTTGCCAGCACTTGG - Intergenic
983586025 4:169355520-169355542 TCCACATCTCTGCCAACACTTGG - Intergenic
984297713 4:177874668-177874690 TCCACATTTTGACCAACACTTGG + Intronic
984379274 4:178969762-178969784 TCTACATTTTTGCCATCACTTGG + Intergenic
984572247 4:181408261-181408283 TCCACATCCTTGCCAGCATTTGG - Intergenic
984588608 4:181591223-181591245 TCCACATTCTTGCCAACACTTGG - Intergenic
984703035 4:182830756-182830778 TCCACATCCTTGCCAGCATTTGG - Intergenic
984842961 4:184085081-184085103 TCTACATCCTTGCCAACATTTGG - Intergenic
984941266 4:184934298-184934320 TTCCCATCTGTACCAGCACTTGG - Intergenic
985181352 4:187267377-187267399 TTCACATCCTTGCTAACACTTGG + Intergenic
985910968 5:2882573-2882595 TCTACATCCCGGCCAACACTGGG - Intergenic
985919181 5:2955915-2955937 TTCATATCTCTGCCAAGACTGGG + Intergenic
986590909 5:9369043-9369065 GCCATATCCTTGCCAACACTTGG + Intronic
986726327 5:10600794-10600816 TCCACACCCTTGCCAACATTTGG + Intronic
987435627 5:17890601-17890623 TCCACATTTTCACCAACACTTGG - Intergenic
987680395 5:21128936-21128958 TCCACATTCTTGTCAACACTTGG + Intergenic
988244623 5:28663731-28663753 TCCACATCTTTGTCAGCATTTGG - Intergenic
988247036 5:28699337-28699359 TCTATATCCTTGCCAACACTTGG + Intergenic
988299774 5:29406851-29406873 TCCATATCTCTCCCAAGACTAGG - Intergenic
988434675 5:31159951-31159973 TCCACATCCTTGCCAACATGTGG + Intergenic
988626645 5:32883529-32883551 TGCCCATCTGTCCCAACACCTGG + Intergenic
988720579 5:33874429-33874451 TCCATATCTTTGCCAGCATTTGG - Intronic
989063031 5:37428890-37428912 TCCATATCCTTGCCTACACTTGG + Intronic
989160915 5:38390634-38390656 TCCACATCCTTGTCAACACTTGG + Intronic
989462814 5:41720545-41720567 TCCATATCTTTACCAACATTTGG + Intergenic
989628513 5:43456746-43456768 TCCACATCTTTGTCAACATCTGG - Intronic
989672372 5:43933703-43933725 TCCGCATCTTTGCTAACACTTGG + Intergenic
990284063 5:54282195-54282217 TCCACATGATTTCCAACACTAGG + Intronic
990488927 5:56285018-56285040 TGGACATCTCTGCCAGCACTAGG + Intergenic
990648767 5:57874722-57874744 TCCACATCTGGGCAATCACTAGG - Intergenic
990847180 5:60155235-60155257 TCCACATTCTTGCCAACACTAGG + Intronic
991008142 5:61852326-61852348 TCCACATCCTTGCCAGCATTTGG - Intergenic
991293128 5:65052226-65052248 TCCACATCCTTGCTAACATTTGG + Intergenic
991338521 5:65578477-65578499 TCCACATCTGTGCCACCATTTGG + Intronic
991551282 5:67838923-67838945 TCCACATCCTCTCCAACACTTGG + Intergenic
991586387 5:68206362-68206384 TCCATATCCTTGGCAACACTTGG + Intergenic
992028825 5:72700043-72700065 TCCACATCTATACCAACACATGG + Intergenic
992504324 5:77370799-77370821 TGCACATCCTTGCCAACAGTTGG + Intronic
992533774 5:77677694-77677716 TCCACATCTATGCCAGCATTTGG - Intergenic
993633153 5:90312100-90312122 TCAACATCTTTGCCTCCACTAGG - Intergenic
993803063 5:92369138-92369160 TTTATATCTTTGCCAACACTTGG + Intergenic
994867755 5:105299355-105299377 TCCACATCGTTGCCAACATTTGG - Intergenic
995249463 5:109974124-109974146 TCCACATATTTGCTAATACTTGG + Intergenic
995292366 5:110471364-110471386 TCCATATCTCTTCAAACACTTGG - Intronic
996047373 5:118888748-118888770 TCCACAGCTTTGCCAACACATGG + Intronic
996106312 5:119508150-119508172 TCCAGATGTTGGCCAACACTTGG + Intronic
996320803 5:122213068-122213090 TCCACATCTCAGTCAACATTTGG + Intergenic
996656188 5:125939799-125939821 TCCACATCTTTGCCAGCATTTGG - Intergenic
997154831 5:131544054-131544076 TCCACATCCTCACCAACACTTGG - Intronic
997267605 5:132504669-132504691 TCCACGTCATTGCCAACACTTGG - Intergenic
997447195 5:133949780-133949802 TCTGCATCTTTGCTAACACTTGG - Intergenic
997480638 5:134181818-134181840 TCCACATCCTTGCTAATACTTGG - Intronic
997558982 5:134827995-134828017 TCTACATATTTGCCAACACATGG + Intronic
997609533 5:135205697-135205719 TCAACATCCTTGCCAACACCTGG - Intronic
997922241 5:137992739-137992761 TTCACATCCTTGCCAACACTTGG - Intronic
998361682 5:141593785-141593807 TCCACATCTTTGCAAGCATTTGG - Intronic
998571775 5:143266169-143266191 TCCACATCTTCACCAACACTTGG + Intergenic
998819337 5:146044098-146044120 TCCACATCCTCACCAACACTTGG + Intronic
999055856 5:148575452-148575474 TCCAGATCTCTGTCAACACATGG - Intronic
999236485 5:150100574-150100596 TCCAAATCTTAGCCAACACTTGG - Intronic
999277638 5:150342179-150342201 TCCACATCCTTGCCAACACTTGG - Intergenic
999348163 5:150842758-150842780 TCCACATCTGTGCTAAGGCCAGG + Intergenic
999695249 5:154183007-154183029 TCCACATCCTTGCCAGCTCTTGG - Intronic
999974739 5:156900105-156900127 TCTACATACTTGCCAACACTTGG - Intergenic
1000394251 5:160756514-160756536 TCCACATCCTTGTCAATACTTGG + Intronic
1000649534 5:163799762-163799784 TACACATCCTTGCCTACACTTGG + Intergenic
1001326124 5:170726473-170726495 TCCACATCTTTGCCAATGCTTGG - Intronic
1001807669 5:174601863-174601885 CCCACATCTTTGCCAACACTTGG + Intergenic
1002648800 5:180676347-180676369 TCCACATCCTTGCCAGCATTTGG + Intergenic
1002736376 5:181390526-181390548 TCCACATCCTCTCCAACACTTGG - Intergenic
1002748321 6:84298-84320 TCCACATCCTCTCCAACACTTGG + Intergenic
1003330722 6:5126195-5126217 TCCAGAGCTGTGCAAACACAAGG + Intronic
1003504881 6:6732581-6732603 TCCACATCCTTGCCAACATTTGG - Intergenic
1003651519 6:7965172-7965194 TCCACATCCTTGCCAACACTTGG - Intronic
1003786794 6:9495691-9495713 TCCACATCCATGCCAACAGTTGG - Intergenic
1004060043 6:12185792-12185814 TCCACATCCTTGCCAACACTTGG - Intergenic
1004218731 6:13726348-13726370 TGCACATCCTTGTCAACACTTGG - Intergenic
1004427564 6:15516735-15516757 TCCACATCTATTCCAGCACTAGG + Intronic
1004952102 6:20684661-20684683 TCCGCATCCTTGCCAACATTTGG + Intronic
1005839178 6:29729912-29729934 TCCACATCTTCGCCAACACTTGG - Intronic
1005854253 6:29848577-29848599 TCTGCAGCTGTGCCCACACTTGG - Intergenic
1005876675 6:30015775-30015797 TCCATATCTTCACCAACACTTGG - Intergenic
1006590594 6:35152845-35152867 TCTACATCTTTACCAACACTTGG + Intergenic
1006968197 6:38011448-38011470 TCCATATCCTTGCCAACACCTGG + Intronic
1007145814 6:39629315-39629337 TCCACATCCTTGCCAGCATTTGG + Intronic
1007365069 6:41385759-41385781 TCCACACCTTTGCCAGCATTTGG + Intergenic
1007538614 6:42620156-42620178 TCCACATCCTCACCAACACTTGG + Intronic
1007679546 6:43624892-43624914 TCCTCGTCAGTGCCAACACTGGG - Exonic
1007874331 6:45078974-45078996 TCCACATCTCTCCCCATACTTGG + Intronic
1008073580 6:47121996-47122018 TCCACACCTTTGCCAGCATTTGG + Intergenic
1008361717 6:50626825-50626847 GCCACATCTTTGCTAAAACTTGG - Intergenic
1008531066 6:52459558-52459580 TTCACATCCTTGTCAACACTTGG - Intronic
1008639914 6:53451367-53451389 TCCACATCCTTGCCAGCATTTGG + Intergenic
1008743429 6:54638482-54638504 TCCAAATCTCTGCCAGCACTTGG - Intergenic
1008956661 6:57222804-57222826 TCTACATCCTGGCCAACACTTGG - Intergenic
1009025521 6:57995326-57995348 TCTAAATGTTTGCCAACACTTGG + Intergenic
1009201082 6:60746784-60746806 TCTAAATGTTTGCCAACACTTGG + Intergenic
1009795198 6:68457213-68457235 TGCACATCTTTACCAATACTTGG + Intergenic
1009798858 6:68506835-68506857 TACACTTCCTTGCCAACACTTGG - Intergenic
1009996124 6:70897051-70897073 TCCACATCCTCACCAACACTTGG + Intronic
1010056142 6:71567451-71567473 TTCACATACATGCCAACACTTGG - Intergenic
1010244687 6:73652382-73652404 TCCACATCTCTGCTAACATTTGG + Intronic
1010297484 6:74217091-74217113 TCCACATCTTTGCCAATATTGGG + Intergenic
1010579954 6:77583555-77583577 TCCATATTTTTGCCAACACCTGG - Intergenic
1010867986 6:81004340-81004362 TCCACATCCATGCCAGCATTTGG + Intergenic
1010870034 6:81025678-81025700 TCCCCTACTGTGCCAACTCTGGG - Intergenic
1010877273 6:81123068-81123090 TCCACATCCTTGACAACACTTGG + Intergenic
1011498015 6:87955673-87955695 TCCACATCCTTGCTGACACTTGG + Intergenic
1011509125 6:88080644-88080666 GACAGATCTGTGCCCACACTTGG + Intergenic
1011706961 6:90010731-90010753 TTCACATCCTTGCCAACATTTGG + Intronic
1012082239 6:94774937-94774959 TCCCCATCTTTGACAACACTTGG + Intergenic
1012325583 6:97911855-97911877 TCTACATCCTTGCCAAGACTTGG + Intergenic
1012539162 6:100340441-100340463 TCCACATCTTTGCCAACACTTGG - Intergenic
1012741752 6:103025186-103025208 TCCTTATCTTTGCCAACATTTGG - Intergenic
1012848190 6:104416237-104416259 CAAACATCTGTGCCAACACCTGG + Intergenic
1013263070 6:108466152-108466174 TCCACATCCTTGCCAATACTTGG - Intronic
1013472983 6:110481619-110481641 CCCACATCTTTGCCAATACTTGG + Intergenic
1013761181 6:113520492-113520514 TCCACATCCTTGCCAACATTTGG - Intergenic
1013971327 6:116023152-116023174 TCCACATCTTTGCCAATATTTGG - Intronic
1014058607 6:117044724-117044746 CCCACATCCTTGCCATCACTTGG - Intergenic
1014077607 6:117254094-117254116 TCCATATCTTTGCCAAGATTTGG + Intergenic
1014334281 6:120112947-120112969 TCTACATCCATGTCAACACTTGG - Intergenic
1014483272 6:121965345-121965367 TCGAAATATTTGCCAACACTTGG + Intergenic
1014737504 6:125111585-125111607 TCCATATCTTTTCCAATACTTGG + Intergenic
1014857355 6:126418095-126418117 TCCACATCCTTTCCAACACTTGG - Intergenic
1014861478 6:126472784-126472806 TCCACATCCTTGCCAACACTTGG + Intergenic
1014966610 6:127761203-127761225 TTCACATCCTTGCCAACACTTGG - Intronic
1015086665 6:129302171-129302193 TCCACATCTTTGCCAACTCTTGG + Intronic
1015148292 6:130012102-130012124 TTTACATCAGTGCCAACACTTGG - Intergenic
1015194767 6:130513547-130513569 TCTACATCTCTGCCAAGTCTTGG + Intergenic
1015217961 6:130771727-130771749 TCCACATCCTTGCCAGCATTTGG - Intergenic
1015885851 6:137917717-137917739 TCCACATCATTGCCAGCATTTGG - Intergenic
1016231644 6:141812960-141812982 TTCACATCTTTGCCAGCATTTGG - Intergenic
1016351248 6:143171065-143171087 TTCATATCTCTCCCAACACTTGG - Intronic
1016405600 6:143726234-143726256 TCCACATCCTTGTCAACACTTGG + Intronic
1016446234 6:144134906-144134928 TCCACATCCTTGCCAGCATTTGG - Intergenic
1016458194 6:144253941-144253963 TCTACATCCATGTCAACACTTGG + Intergenic
1016488980 6:144575032-144575054 TCCACATTCCTGCCAACCCTTGG + Intronic
1016657161 6:146532875-146532897 TCCACATCTTTGTCAACAATTGG + Intergenic
1017032220 6:150234233-150234255 TCCACATCTTTCCCAACACTTGG - Intronic
1017127131 6:151076679-151076701 TCCACATCCTTGCCAACATTTGG - Intronic
1017572662 6:155764098-155764120 TCCACATGCTTACCAACACTCGG - Intergenic
1017684005 6:156893790-156893812 TCCATATCCTTGACAACACTTGG - Intronic
1017921086 6:158872600-158872622 TTCACATCCTTGCCAACAATTGG + Intronic
1018042667 6:159938961-159938983 TCTACATCTTTGCCAACACTTGG - Intergenic
1018083648 6:160280168-160280190 TCCACATCCTTGCCAACACTTGG + Intergenic
1018244808 6:161812734-161812756 TCTATATCCTTGCCAACACTTGG - Intronic
1018451704 6:163914920-163914942 TCCACTTCTGTGTCAACTCTTGG + Intergenic
1018653562 6:166010894-166010916 TCCCCATCTGGGGGAACACTAGG - Intergenic
1018901847 6:168055617-168055639 CTCACATCTGAGCCAGCACTAGG + Intergenic
1018948198 6:168361418-168361440 TCCACATCCTTGCCAACACCTGG - Intergenic
1019000710 6:168748020-168748042 TCCACAACCTTTCCAACACTTGG + Intergenic
1019166772 6:170102446-170102468 CCCACATCAGTGCCAACATTTGG - Intergenic
1019241474 6:170666055-170666077 TCCACATCCTCTCCAACACTTGG - Intergenic
1020206101 7:6117684-6117706 TCCACATCCTTCCCAATACTTGG + Intronic
1020219065 7:6220596-6220618 TCCACATCTTTGCCAGCCTTTGG - Intronic
1020544680 7:9511748-9511770 TCCATATCTTTAACAACACTTGG - Intergenic
1020851212 7:13355665-13355687 TCCCCATCCATGTCAACACTTGG - Intergenic
1020948114 7:14641126-14641148 TGCACATTCTTGCCAACACTGGG + Intronic
1021181867 7:17516545-17516567 TCCACATCCTTGCCACCATTTGG - Intergenic
1021218993 7:17952534-17952556 TCCACAGCTGGGCCAACTGTTGG - Intergenic
1021667016 7:22993752-22993774 TCCATATCTTTTTCAACACTTGG - Intronic
1021826131 7:24553452-24553474 TCCACATCTGTCCCTACAAAAGG - Intergenic
1021910871 7:25385070-25385092 TCCACTTCTCTGCCAAGACAGGG + Intergenic
1022032157 7:26502105-26502127 TTCACATCCTTGCCAACATTTGG + Intergenic
1022043764 7:26606458-26606480 TCCACATCCTTGCCAGCATTTGG - Intergenic
1022086681 7:27075241-27075263 TCCACATCCTTGCCAACACTTGG - Intergenic
1022356962 7:29624985-29625007 TTCACAGCCTTGCCAACACTGGG - Intergenic
1022380112 7:29851663-29851685 TCACCATCTGTGCCAACAGCAGG - Intronic
1022549431 7:31224745-31224767 TCCTCATTTGTGTCAACATTTGG + Intergenic
1022623667 7:32011676-32011698 TCCATATCCTTGTCAACACTTGG - Intronic
1022657434 7:32332380-32332402 TCTGAATCTTTGCCAACACTTGG - Intergenic
1022804929 7:33812083-33812105 TCCACATCCTTGCCAGCATTTGG - Intergenic
1022820655 7:33956941-33956963 TCCACGTCTTTGCCAGCATTTGG - Intronic
1023168864 7:37370763-37370785 TCCACATACTTGCCAAAACTTGG - Intronic
1023269502 7:38446163-38446185 TCCACATCTTTGCCAACAGTTGG - Intronic
1024004259 7:45213614-45213636 TTCACATCTTAGCCAACACTTGG + Intergenic
1024012436 7:45280815-45280837 TCCACATCCTAGCCAACATTTGG - Intergenic
1024017586 7:45332027-45332049 TCCACATCCTTACCAACACTTGG + Intergenic
1024341302 7:48264424-48264446 TCCACTTCCTTACCAACACTTGG + Intronic
1024535932 7:50433164-50433186 TCCAAATATTTGCCAACACTGGG + Intergenic
1024577140 7:50773546-50773568 TCCACATTCTTGCCAACACTTGG - Intronic
1024602139 7:50993022-50993044 TCCACATCCTTGCAAACACATGG - Intergenic
1024763782 7:52631610-52631632 TCCAAATCTTTGCCATCACTTGG - Intergenic
1024951173 7:54861842-54861864 CCCACATCCCTGCCTACACTTGG + Intergenic
1025963219 7:66243272-66243294 CTCACATCTTTACCAACACTTGG + Intronic
1026610288 7:71852699-71852721 TCCACATCCTTGCCAACATTCGG + Intronic
1027572702 7:79890700-79890722 TCCACATCATTGCCCACACTTGG - Intergenic
1027695673 7:81407035-81407057 TCCACATCCTTATCAACACTGGG - Intergenic
1027746523 7:82081897-82081919 CCCGCTTCTGTGCCAGCACTTGG - Intronic
1028046305 7:86123982-86124004 TCCACATCCTTGCCAACACTTGG - Intergenic
1028058837 7:86283246-86283268 TCCACATTCTTGCCAATACTTGG - Intergenic
1028858520 7:95620043-95620065 TCCACATCCATGTCAACACTTGG + Intergenic
1029103695 7:98156504-98156526 TCCACATCCTTGCCAGCATTTGG - Intronic
1029167791 7:98606633-98606655 TCCACATCTTTGCTAACACTTGG + Intergenic
1029325777 7:99807683-99807705 TCCTCATCTGGGCCAAACCTAGG + Intergenic
1029330683 7:99851442-99851464 TCTACATTCTTGCCAACACTTGG + Intronic
1029950674 7:104581168-104581190 CCCACATCTTTGCCAAAATTTGG + Intronic
1030032095 7:105378875-105378897 TTCACATTTTTGCCCACACTTGG - Intronic
1030128105 7:106173798-106173820 TCCACATTTTTGCCAGTACTTGG + Intergenic
1030180099 7:106697949-106697971 TCCACATCCTTGCCAGCATTTGG + Intergenic
1030728855 7:112960276-112960298 TCTACATCCTTGCCAACACTTGG + Intergenic
1030774038 7:113511767-113511789 TCCGCAACATTGCCAACACTTGG + Intergenic
1031256209 7:119451664-119451686 TCCACATCCTTGCCAACTCTTGG - Intergenic
1031440104 7:121784005-121784027 TCCACATCTGAGCCAACAGTTGG - Intergenic
1031674969 7:124598714-124598736 TCCAAATCTTCGCCAACATTTGG - Intergenic
1031938143 7:127757530-127757552 TCCACATCCATGCCAACACTTGG + Intronic
1032234145 7:130105104-130105126 TCCATATCCTTGCCAATACTTGG - Intronic
1032611047 7:133414317-133414339 TTCTCATCCTTGCCAACACTTGG - Intronic
1032980542 7:137277269-137277291 TCCACATTTTTGCCAACACTTGG - Intronic
1033393806 7:140954673-140954695 TTCACATCCTTGCCAACATTTGG - Intergenic
1033523891 7:142190630-142190652 TCCACATCCTTGCCAACACTCGG + Intronic
1033632973 7:143179337-143179359 TTCATATCTTTGCCAGCACTTGG - Intergenic
1034395591 7:150822030-150822052 TCCACATCCTAACCAACACTTGG - Intergenic
1034399136 7:150849828-150849850 CCCACATCTCTGTCAACACTTGG + Intronic
1035478873 7:159165546-159165568 TCCATATCATTGCCAAGACTTGG - Intergenic
1035506642 8:142041-142063 TCCACATCCTCTCCAACACTTGG + Intergenic
1035678011 8:1468526-1468548 ACCACACCTGTTCCAACACATGG + Intergenic
1036629570 8:10501450-10501472 TTTACATCCTTGCCAACACTCGG + Intergenic
1036763601 8:11530986-11531008 TCCATATGCTTGCCAACACTTGG + Intronic
1037112010 8:15174687-15174709 TCCACATGCCTTCCAACACTCGG + Intronic
1037250177 8:16883735-16883757 TCCACATCCTTGTCAACACTTGG - Intergenic
1037255958 8:16953937-16953959 TCCACATCTTTGCCAGCATTTGG - Intergenic
1037327507 8:17708448-17708470 TCCACAGCCTTGTCAACACTTGG - Intronic
1037413660 8:18624248-18624270 TCCAAATCCTTACCAACACTTGG + Intronic
1037792061 8:21953651-21953673 TCCACATCTTTGCCATCATCTGG + Intronic
1037798093 8:22013784-22013806 TCTACATCTTTGCCTACACTTGG - Intergenic
1038457129 8:27682716-27682738 TTTACATCCTTGCCAACACTTGG - Intergenic
1038508097 8:28103684-28103706 TCCACATCCTTGCTAACACTTGG + Intronic
1038555449 8:28510072-28510094 TCCACATCTTGGCTAACACTAGG + Intronic
1038881784 8:31622326-31622348 TCCAGATCCTTGCCAACATTTGG - Intergenic
1039141112 8:34389428-34389450 TCCACATCTTTGCCAATACTTGG - Intergenic
1039168121 8:34709378-34709400 TCCACAACATTGCCAACGCTAGG + Intergenic
1039864416 8:41489014-41489036 TCCACATCTTTGCCAAGACTTGG - Intergenic
1039903580 8:41769786-41769808 TCCACATCCTTGTCAAGACTTGG + Intronic
1040349325 8:46547961-46547983 TCCACATCTTTGCTAACACTTGG + Intergenic
1040681180 8:49811775-49811797 TCCACATCTTTGTCAGCATTTGG - Intergenic
1040839421 8:51769373-51769395 TTCAAATCTCTGCCAACTCTGGG + Intronic
1041216087 8:55601614-55601636 TCCAGATCCTTACCAACACTTGG + Intergenic
1041553650 8:59128290-59128312 TCCAAATCCTTGTCAACACTTGG + Intergenic
1041668861 8:60472651-60472673 TCCACATTCTTGCCAACCCTTGG - Intergenic
1041791830 8:61704822-61704844 TCTACATATGTACCAACATTTGG - Intronic
1041951101 8:63503473-63503495 TCCACATCCTTGCCAGCATTTGG + Intergenic
1042373748 8:68023268-68023290 TCTATATCTTTGCCAACACTTGG + Intronic
1042401380 8:68351840-68351862 TTCACATCCTTGCCAACATTTGG + Intronic
1042746252 8:72109969-72109991 TCCACAACTTTGTCAACACTTGG + Intronic
1042907081 8:73782912-73782934 TCCACATCCTTGCCACAACTTGG + Intronic
1043168018 8:76928507-76928529 TCTACATCCCTGCCAACACCTGG + Intergenic
1043361507 8:79477953-79477975 TCCACATCATTGTCAACAGTTGG - Intergenic
1043439504 8:80264788-80264810 TCCACATCTTTGTCAACACTTGG + Intergenic
1043590285 8:81824134-81824156 TCCACATCCTTGCCAGAACTTGG + Intronic
1043836887 8:85058772-85058794 TCCATATCTCTCCCAAGACTAGG + Intergenic
1044050394 8:87495099-87495121 TCCACATCCTTGCCAGCATTTGG + Intronic
1045001562 8:97882710-97882732 TTCACATCTTCACCAACACTTGG + Intronic
1045048202 8:98299075-98299097 TCCACATCCTTATCAACACTTGG - Intergenic
1045229550 8:100289641-100289663 TCCACATCCTTGCTAACACTTGG - Intronic
1046053400 8:109050592-109050614 TCCACATCCTTACCAACACTTGG - Intergenic
1046196382 8:110868361-110868383 TCCACATCCTCGCCAACACTTGG + Intergenic
1046233413 8:111388736-111388758 TCCTCATCTTTGCTAACACTTGG - Intergenic
1046799082 8:118405097-118405119 TCCACATCCTTGTCAACACTTGG - Intronic
1046833197 8:118770147-118770169 TCCACATCCTTGCCAGCATTTGG + Intergenic
1046837478 8:118818889-118818911 CCTACATCTTTGCCAACACTTGG + Intergenic
1047190729 8:122676864-122676886 TCCACATCCCTGCCAGCATTTGG - Intergenic
1048487236 8:134859716-134859738 TGGACATCTCTGCCATCACTGGG - Intergenic
1048821949 8:138388245-138388267 TCCACATGTTTGCCATCATTTGG - Intronic
1049072447 8:140367070-140367092 TCCACATCCTTGCCAGCATTTGG - Intronic
1049135328 8:140892847-140892869 TTCACATCCTTGCCTACACTTGG - Intronic
1049569538 8:143362724-143362746 TCCTCATCTGAGCCACCACGGGG + Intergenic
1049630682 8:143654355-143654377 TCCATATCTTTGCTAACACTTGG + Exonic
1049837133 8:144743699-144743721 TCCACATCTTGGCCAGCACTGGG + Intronic
1049993687 9:1014452-1014474 TCTACATCCTTGCCAACAGTTGG + Intergenic
1050046868 9:1555661-1555683 TCAAAACCTTTGCCAACACTTGG + Intergenic
1050145581 9:2563697-2563719 TCTACATCTTTGCCAGCATTTGG - Intergenic
1050226560 9:3464146-3464168 TCTACATCCTTGTCAACACTTGG - Intronic
1050260618 9:3837280-3837302 TCCACATCCTTGCCAGCATTTGG - Intronic
1050378636 9:4999926-4999948 CTCATATCTTTGCCAACACTGGG + Intronic
1050701534 9:8345248-8345270 TCCCCTTCTCTGACAACACTTGG + Intronic
1051007605 9:12366212-12366234 TGCACATCCTTGCCAGCACTTGG - Intergenic
1051435317 9:17024319-17024341 TTCACATCCTCGCCAACACTTGG - Intergenic
1051558759 9:18415248-18415270 TCAACATCTGTGACAATTCTGGG - Intergenic
1051885016 9:21883378-21883400 TCCACATCTTTGCCCAAACTTGG - Intronic
1051950855 9:22631123-22631145 TCTACATCCTTGCCAACACTAGG - Intergenic
1051962016 9:22777938-22777960 TCCACATCGTTGCCAGCAGTTGG - Intergenic
1052087423 9:24284612-24284634 TCCACATCTTTGTCAACATTTGG + Intergenic
1052247549 9:26354814-26354836 TCCACATCCTTGCCAACTTTTGG - Intergenic
1052426354 9:28310003-28310025 TCCACACCCTTGCCAACACTTGG - Intronic
1052428507 9:28336077-28336099 TCAACATCTTTGCCAACATTTGG + Intronic
1052643607 9:31202359-31202381 TCTACATCCTTGCCAACATTTGG - Intergenic
1052677800 9:31649408-31649430 TCCACATCCTTGCCAACATGTGG - Intergenic
1052715472 9:32111077-32111099 TCCACATCCTTGCCAGCATTTGG - Intergenic
1052863026 9:33448259-33448281 TCCACAGCTGTGTCTACACATGG + Intergenic
1052921654 9:33975456-33975478 TCCACATCTTTGTCAACACTTGG - Intronic
1053522554 9:38795124-38795146 TCCACATCTTCACCAACACTTGG + Intergenic
1053688456 9:40567036-40567058 TCCACATGCTTGCCAACAATTGG - Intergenic
1054194782 9:62019546-62019568 TCCACATCTTCACCAACACTTGG + Intergenic
1054275574 9:63064022-63064044 TCCACATGCTTGCCAACAATTGG + Intergenic
1054299697 9:63367947-63367969 TCCACATGCTTGCCAACAATTGG - Intergenic
1054399259 9:64700909-64700931 TCCACATGCTTGCCAACAATTGG - Intergenic
1054432837 9:65185174-65185196 TCCACATGGTTGCCAACAATTGG - Intergenic
1054458430 9:65448936-65448958 TCCACATCCTTGTCAACACTTGG - Intergenic
1054497548 9:65836501-65836523 TCCACATGGTTGCCAACAATTGG + Intergenic
1054643626 9:67569144-67569166 TCCACATCTTCACCAACACTTGG - Intergenic
1054705700 9:68459644-68459666 TCCACATCTTTACCAGCACTTGG + Intronic
1054900726 9:70366718-70366740 TTCACATCCTTGTCAACACTTGG - Intergenic
1054995119 9:71378306-71378328 TCCACATTCTTGCCAACTCTTGG - Intronic
1055005571 9:71502028-71502050 TCCACATCTTTGCCATTATTTGG - Intergenic
1055150997 9:72999471-72999493 TCCACACCTTTGCCAGCATTTGG + Intronic
1055588738 9:77786681-77786703 TTCACATCTTTGTCAACCCTTGG - Intronic
1055857753 9:80711273-80711295 TCCACATCTGCACCAACATTTGG + Intergenic
1056104220 9:83330951-83330973 TCCACATCCTTGCCAACATTTGG - Intronic
1056148351 9:83758079-83758101 TCCACAACTGCACCAACGCTAGG - Intronic
1056675855 9:88676776-88676798 TCTACATCCTTACCAACACTTGG + Intergenic
1056697921 9:88875896-88875918 CTCACATCTCTGCCAATACTTGG + Intergenic
1056754512 9:89373370-89373392 TCCCCACCTGCCCCAACACTTGG - Intronic
1057104180 9:92395653-92395675 TCCACATCCTTGCCAACATTTGG + Intronic
1057508922 9:95661660-95661682 TCCACACCTGTGCTGAGACTTGG - Intergenic
1057718216 9:97512267-97512289 TCCACAACCTTGTCAACACTTGG - Intronic
1057848279 9:98542726-98542748 ACCACATCTTTGCCAACACAGGG + Intronic
1058013471 9:100003979-100004001 TCCACACCTGCCCCAGCACTAGG - Intronic
1058226358 9:102369348-102369370 TCCACACCTTCACCAACACTAGG - Intergenic
1058588361 9:106534185-106534207 ACCACATCATTGACAACACTTGG + Intergenic
1059100173 9:111463782-111463804 TTCCCATCTTTGCCAACATTTGG - Intronic
1059404666 9:114092405-114092427 TCAACATCTCTGCCAGGACTCGG + Exonic
1059439343 9:114296554-114296576 CCCATGTCTTTGCCAACACTTGG - Intronic
1059787417 9:117600534-117600556 TCCAGATCTCTCCCAAGACTTGG - Intergenic
1059952331 9:119478716-119478738 TCCACATCCTTGACAACATTTGG - Intergenic
1060305535 9:122407682-122407704 GCCACATCTTTGGCAACACTTGG + Intergenic
1060433544 9:123571944-123571966 TCCACATCTTTGACAATACTTGG + Intronic
1060503010 9:124177199-124177221 TCCATATCCTTGCCAACACTTGG + Intergenic
1060533526 9:124364173-124364195 TCCTCATCTGTACCAGCAGTTGG - Intronic
1060597746 9:124858292-124858314 TCCACAGCTTTGCCAAGACTTGG - Intronic
1060757039 9:126221650-126221672 TCCACATCCATGTCAACACTTGG - Intergenic
1060761428 9:126253156-126253178 GCCATATCTGCTCCAACACTGGG + Intergenic
1060775697 9:126372514-126372536 TCCACATCCTTGCCAACATTTGG + Intronic
1060928158 9:127470005-127470027 TCCACATCTTTGCTAATTCTTGG - Intronic
1060948310 9:127583891-127583913 TCCACATTCTTGCCAACATTTGG + Intergenic
1061025469 9:128045936-128045958 TCCACATCCTTGCCAACATTTGG - Intergenic
1061111473 9:128574893-128574915 GCCGTATCTGTGCTAACACTGGG - Intronic
1061376421 9:130227542-130227564 TCCACATCCTTGCCAACACTGGG + Intronic
1061617468 9:131789913-131789935 TCCACATCCTTACCAACATTTGG + Intergenic
1062127734 9:134872917-134872939 TCCACATCCTTGTCAGCACTGGG + Intergenic
1062148907 9:135007439-135007461 CCCCCATCTCTCCCAACACTTGG - Intergenic
1062727711 9:138085490-138085512 TCCACATCTCTCCCCAGACTTGG - Intronic
1203601666 Un_KI270748v1:15289-15311 TCCACATCCTCTCCAACACTTGG - Intergenic
1186318905 X:8402420-8402442 TCCATATCTTCACCAACACTTGG - Intergenic
1186549553 X:10488445-10488467 TTCACATTTTTGCCAACACTTGG + Intronic
1186643093 X:11478075-11478097 TTTATATCTTTGCCAACACTTGG - Intronic
1186681640 X:11881145-11881167 TCCACATCCTTGCCAGCATTTGG - Intergenic
1186932821 X:14413492-14413514 TTCACATCCTTGCCAATACTTGG + Intergenic
1187101102 X:16193354-16193376 TTCACATCCTTGCCATCACTTGG - Intergenic
1187201839 X:17141660-17141682 TCCGCGTCTTTGCCAACATTTGG + Intronic
1187365650 X:18663905-18663927 TCCACAGCCTTGTCAACACTAGG - Intronic
1187541096 X:20196166-20196188 TTCACATCTTTGCTTACACTGGG - Intronic
1187669312 X:21653146-21653168 TCCAAATCTATGAGAACACTTGG + Exonic
1187758513 X:22553165-22553187 TCCACATCTTCACTAACACTTGG - Intergenic
1187772421 X:22715191-22715213 TCCACATCCTTACCAGCACTTGG - Intergenic
1187780754 X:22820210-22820232 TCCACATCTTTGCCAGCATTTGG + Intergenic
1187988095 X:24836493-24836515 TCCACATTCTTACCAACACTTGG + Intronic
1188083202 X:25871024-25871046 TCTACATCCTTGCGAACACTTGG + Intergenic
1188457631 X:30384830-30384852 TCCACATCCTTAGCAACACTTGG - Intergenic
1188511716 X:30943509-30943531 TCCACATCCTTGCCAACACTTGG + Intronic
1188680863 X:33002603-33002625 TGCACTTCTGTGCAAAGACTGGG + Intronic
1189022707 X:37357889-37357911 TCCACATCCTTGCCAGCATTTGG + Intronic
1189057936 X:37718710-37718732 TCCATATCCTTGCCAGCACTTGG + Intronic
1189489894 X:41462437-41462459 TCCACATGTTCTCCAACACTTGG + Intronic
1189525880 X:41821417-41821439 TCCACATCCTTGCCAATACTTGG - Intronic
1189789986 X:44594509-44594531 TCCACATCCTTGTCAACACTTGG + Intergenic
1189982736 X:46527467-46527489 TTCACATCCTTGCCAGCACTTGG - Intronic
1190024342 X:46909930-46909952 TCCACATCTTTGTCAGCATTTGG - Intergenic
1190091901 X:47445516-47445538 TCCACATACTTGCCAACATTTGG - Intergenic
1190599542 X:52076131-52076153 TCCACATCATTGCTAGCACTGGG - Intergenic
1190609282 X:52177942-52177964 TCCACATCATTGCTAGCACTGGG + Intergenic
1190642024 X:52489128-52489150 TCCACATCTTCGCCAGCATTTGG + Intergenic
1190645649 X:52523738-52523760 TCCACATCTTCGCCAGCATTTGG - Intergenic
1190724087 X:53175600-53175622 TCCACATATTTCCCAACCCTTGG - Intergenic
1191164145 X:57369337-57369359 TCCACATCTCTTCCAAAATTTGG - Intronic
1191920495 X:66251343-66251365 TCCACATCCTTGCCAGCATTTGG + Intronic
1192104768 X:68304304-68304326 TCCACATACTTGCCAACACCTGG + Intronic
1192382902 X:70636286-70636308 TCCACATCTGCCCCAACTCCAGG + Intronic
1192431409 X:71114642-71114664 TCCACATCCTTGCCAGCATTTGG - Intergenic
1192576797 X:72249309-72249331 TCCATATCTTTGCTAACACTTGG - Intronic
1192677915 X:73219048-73219070 TCTACATCTTTGCCAAAATTTGG - Intergenic
1193109091 X:77709334-77709356 TCCACATCCTTGCCAACACTGGG - Intronic
1193651788 X:84144525-84144547 TCCACATCCTTGCCAACATTTGG - Intronic
1193902330 X:87196842-87196864 TGCATATGTATGCCAACACTTGG - Intergenic
1194076964 X:89406715-89406737 TCCACCTCTTTGCCAGCATTTGG + Intergenic
1194297951 X:92150239-92150261 TTCACATCCTTGCCAACATTTGG + Intronic
1194311165 X:92308987-92309009 TCCACATCTTCACCAACACTTGG - Intronic
1194429102 X:93778631-93778653 TCTACATCTTTGCCAAAACTTGG + Intergenic
1194430784 X:93801629-93801651 TCCACATCTTTACCAACACCTGG + Intergenic
1194609527 X:96023994-96024016 TCCACATCCTTGTCAACACTTGG - Intergenic
1194856591 X:98936907-98936929 TCCACCTTTTTGCCAACACATGG - Intergenic
1195238737 X:102929232-102929254 TCCACATCCTCACCAACACTTGG + Intergenic
1195267002 X:103191459-103191481 TCCACGTCCTTGCCAGCACTCGG + Intergenic
1195334493 X:103837372-103837394 TCCACATCCTCACCAACACTTGG - Intergenic
1195335664 X:103851349-103851371 TCCACTTCCTTGCCAACACATGG + Intergenic
1195549816 X:106155336-106155358 TCCACATTTTCACCAACACTAGG - Intergenic
1195635631 X:107112381-107112403 TCTACATCTTTGTCAGCACTTGG - Intronic
1195653378 X:107310780-107310802 TCCACATCCACACCAACACTTGG - Intergenic
1195919484 X:109968546-109968568 TTCACATCCTCGCCAACACTTGG + Intergenic
1196018890 X:110968470-110968492 TCTACATCTTTGCCAACATTTGG + Intronic
1196107778 X:111914827-111914849 TCCCCATCTCTCCCAACTCTAGG - Intronic
1196324051 X:114380585-114380607 TCCACATCTTTGCCAGCTTTTGG - Intergenic
1196861188 X:120028594-120028616 TCCACATCCTTACCAACACTGGG - Intergenic
1197324692 X:125077926-125077948 TCTCCATCTGTTTCAACACTTGG - Intergenic
1197334973 X:125202668-125202690 TCCACGTCTGTGTCGCCACTGGG - Intergenic
1197524987 X:127549644-127549666 TCCATATCTAAGCCAGCACTAGG + Intergenic
1197651472 X:129069837-129069859 TCCACATCCTTGCCAGCATTTGG - Intergenic
1197895621 X:131310863-131310885 TCCACATCTATGCCAACAATTGG - Intronic
1198454246 X:136800060-136800082 TTTACATCTTTGCCAACATTTGG + Intergenic
1198501254 X:137249697-137249719 TTCACATCCTTGCCAACACCTGG - Intergenic
1198766245 X:140082045-140082067 TCCACATCCTTTCCATCACTTGG + Intergenic
1198865663 X:141120484-141120506 ACCACATCAGTGCCCCCACTAGG - Intergenic
1199273219 X:145910199-145910221 TTCACATCTTGGCCAACACTAGG - Intergenic
1199323816 X:146473422-146473444 TCCACATCCCTACCAACACTTGG + Intergenic
1199444574 X:147907246-147907268 TCCACATCCTTGCCAACATTTGG - Intergenic
1199823482 X:151474481-151474503 TCCACATCCTTGCCAGCATTTGG + Intergenic
1199963903 X:152802055-152802077 TCCACATCCTTGCCAACATTTGG + Intergenic
1199969770 X:152851192-152851214 TTCACATCTTTGCCAACACTGGG + Intronic
1199974844 X:152887852-152887874 TACATATCCTTGCCAACACTTGG - Intergenic
1200055634 X:153458733-153458755 TCCTCATCCTGGCCAACACTGGG + Intronic
1200298744 X:154950344-154950366 TCTACATCTTTACCAATACTTGG + Intronic
1200324149 X:155220475-155220497 TCCGTATCCTTGCCAACACTTGG + Intronic
1200429607 Y:3062244-3062266 TCCACCTCTTTGCCAGCATTTGG + Intergenic
1200615560 Y:5375210-5375232 TTCACATCCTTGCCAACATTTGG + Intronic
1200619438 Y:5423274-5423296 TCCACATCTTCACCAACACTTGG - Intronic
1201348484 Y:13011515-13011537 TTCACATCCATGCCAATACTTGG + Intergenic
1202095483 Y:21244766-21244788 TCAACATCTGGGCCAACAAGGGG + Intergenic