ID: 922117535

View in Genome Browser
Species Human (GRCh38)
Location 1:222628948-222628970
Sequence CCATGAGTGGTGCACTACCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922117535_922117542 13 Left 922117535 1:222628948-222628970 CCTGGGTAGTGCACCACTCATGG 0: 1
1: 0
2: 0
3: 7
4: 63
Right 922117542 1:222628984-222629006 TAACGCATCCAGAGACAGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 80
922117535_922117544 17 Left 922117535 1:222628948-222628970 CCTGGGTAGTGCACCACTCATGG 0: 1
1: 0
2: 0
3: 7
4: 63
Right 922117544 1:222628988-222629010 GCATCCAGAGACAGTGTGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 229
922117535_922117543 16 Left 922117535 1:222628948-222628970 CCTGGGTAGTGCACCACTCATGG 0: 1
1: 0
2: 0
3: 7
4: 63
Right 922117543 1:222628987-222629009 CGCATCCAGAGACAGTGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 90
922117535_922117546 28 Left 922117535 1:222628948-222628970 CCTGGGTAGTGCACCACTCATGG 0: 1
1: 0
2: 0
3: 7
4: 63
Right 922117546 1:222628999-222629021 CAGTGTGGAGGGAGACGCTTTGG 0: 1
1: 0
2: 1
3: 23
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922117535 Original CRISPR CCATGAGTGGTGCACTACCC AGG (reversed) Exonic
901951145 1:12747796-12747818 CCATGGGTGATGCAGTACTCAGG + Intronic
902896641 1:19484672-19484694 CCCTGCCTGGTGCACGACCCAGG - Intronic
913662623 1:121018171-121018193 CAAAGAGTAGTGCACTGCCCTGG + Intergenic
914014010 1:143801432-143801454 CAAAGAGTAGTGCACTGCCCTGG + Intergenic
914163813 1:145159765-145159787 CAAAGAGTAGTGCACTGCCCTGG - Intergenic
914652628 1:149709988-149710010 CAAAGAGTAGTGCACTGCCCTGG + Intergenic
919183368 1:194114390-194114412 CCATGAGGGCTGGATTACCCAGG - Intergenic
919691975 1:200535825-200535847 CAATGAGTGACTCACTACCCAGG + Intergenic
922117535 1:222628948-222628970 CCATGAGTGGTGCACTACCCAGG - Exonic
922700470 1:227756729-227756751 CCATGGGAGGTGCAATCCCCAGG - Intronic
1069501436 10:68956460-68956482 CCAGGAGTGGTGCGCTCCCCGGG + Intronic
1069629811 10:69890579-69890601 CCATGACTGGGGCACTGCCAGGG + Intronic
1070817077 10:79331387-79331409 CCATGAGGTGTGCCCTGCCCTGG + Intergenic
1071516802 10:86303394-86303416 CAAAGAGTGGAGCACTGCCCAGG + Intronic
1079218985 11:18542241-18542263 CCATGAGATGTGCAATAACCAGG + Intronic
1084119153 11:67058926-67058948 CCCTGTGTGGTGCTCTTCCCCGG - Intronic
1088284853 11:108177367-108177389 CCAAGAGTTCTGGACTACCCTGG - Intronic
1100304521 12:93338186-93338208 CAATAAGTGGTGCTCCACCCTGG - Intergenic
1105430436 13:20332612-20332634 CGATGAGAGGTGCACTACAGGGG - Intergenic
1110212100 13:72985939-72985961 CCAGGAGTTGTGTACTAGCCTGG + Intronic
1117278852 14:54218377-54218399 CCAGGAGTTGGACACTACCCTGG + Intergenic
1118300782 14:64614014-64614036 CTCTTAGTGGTGCATTACCCTGG + Intergenic
1119073462 14:71611141-71611163 ATCTGAGTGGTGCACTTCCCAGG + Intronic
1121777858 14:96602667-96602689 CCATGAGCTGTTCACTGCCCAGG - Intergenic
1123809140 15:23905586-23905608 CCAGGAGTGGAGCCCTAGCCTGG + Intergenic
1125310842 15:38376584-38376606 CCATGGGTGGTGAAGTACTCTGG - Intergenic
1128692806 15:69738047-69738069 CCATGAGTGGAGCACACCCCTGG - Intergenic
1129810479 15:78506314-78506336 GCATGAGTGGACCAGTACCCAGG + Intergenic
1136031622 16:27507282-27507304 GCATCAGTGGTGCCCAACCCAGG - Intronic
1141629667 16:85280343-85280365 CCAGGAGTGGTGCATTCCACGGG - Intergenic
1156042345 18:32836756-32836778 CTCTGAGTGGTGCACCACCATGG - Intergenic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
926800246 2:16653651-16653673 CAATGAGTTGTGCACTTCTCTGG - Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
929592272 2:43155028-43155050 CCATGATTGGGGCACTCCCCAGG - Intergenic
940787826 2:158001297-158001319 CAAGGAGTAGTGCAGTACCCTGG + Intronic
947396337 2:229690250-229690272 CCATGAGTGGTTCTCAACCCAGG - Intronic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1169879851 20:10334871-10334893 CCATGACTGGTTCACTAACTAGG + Intergenic
1173498573 20:43536092-43536114 CCAGGAGTGGGGCACTTCCTGGG - Exonic
1175597011 20:60243336-60243358 CCAGGAGTGGTGCTAGACCCTGG + Intergenic
1177836772 21:26193369-26193391 CAATGAGTGGTTCTCTATCCTGG + Intergenic
1181145287 22:20841586-20841608 CCATGATTTATGCACTACACTGG + Intronic
1181971143 22:26691054-26691076 CCAGGAATAGTGCACTTCCCTGG + Intergenic
1182159513 22:28107452-28107474 CCATGAGCTCTGCACTCCCCTGG + Exonic
955703436 3:61704702-61704724 CCATCAGTGGGGCACTAGGCAGG - Intronic
955802230 3:62698392-62698414 CTATGAGGGGTGCAGGACCCTGG + Intronic
958528435 3:95292238-95292260 CCAGGAGGGGTGCTGTACCCTGG + Intergenic
959332987 3:105030181-105030203 CAAGGAGTGGTGCAGCACCCTGG - Intergenic
964242919 3:154616881-154616903 ACATGGTTGGTACACTACCCTGG - Intergenic
965354896 3:167661834-167661856 ACATGTGTAGGGCACTACCCTGG + Intergenic
967798571 3:193627893-193627915 CCATGTTTGGTGCTCTACTCAGG - Intronic
969256513 4:6005859-6005881 CCATGAGAGGTGCAGTTCCCCGG + Intergenic
972781465 4:42290325-42290347 CCATGAGTGGTTAAGCACCCTGG - Intergenic
978291968 4:107152397-107152419 CCAGTAGTGGTCCACTGCCCGGG + Intronic
988594764 5:32581525-32581547 CCCTGAATGCTGCAGTACCCTGG + Intronic
994926268 5:106120910-106120932 CTATGAGTGGTGCTCAACCCTGG - Intergenic
995443258 5:112215028-112215050 CCATGGGTGGTGCACTGTTCTGG - Intronic
997897697 5:137734673-137734695 CCCTCAGTGGTGCACTGCCATGG + Intronic
1000923983 5:167171519-167171541 CAAGGAGTGGTGAACTACCCAGG + Intergenic
1003572503 6:7265030-7265052 CCCTGACTAGTGCACTGCCCTGG + Intergenic
1005883450 6:30076562-30076584 CCAGAAGTGGAGCCCTACCCTGG + Intergenic
1015530491 6:134216941-134216963 CCATGAGTCTTGCACTCCCATGG - Intronic
1021993098 7:26155103-26155125 CCTTGTGTGGTGCACTGGCCAGG + Intronic
1022883060 7:34610443-34610465 CAATGAGTGGTAAACTAACCTGG - Intergenic
1024639620 7:51317952-51317974 CCATGAGTGGAGCGCTTTCCCGG + Intergenic
1025116172 7:56260330-56260352 ACAGGAGTGGTGCATTTCCCAGG - Intergenic
1030317084 7:108127031-108127053 CCATCAGTGGTTCTCAACCCTGG - Intronic
1038664780 8:29528841-29528863 CCCTGAGTGGTGGCTTACCCAGG - Intergenic
1051191220 9:14515480-14515502 CCATGAGTGTTCCTCTAGCCAGG + Intergenic
1187736099 X:22305149-22305171 CCTTGAGTGGAACACTATCCAGG - Intergenic