ID: 922119119

View in Genome Browser
Species Human (GRCh38)
Location 1:222644611-222644633
Sequence GGACCCAAGCTGTCACAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922119105_922119119 24 Left 922119105 1:222644564-222644586 CCTTCATAGCCAAGCTGCTGGAG 0: 1
1: 0
2: 3
3: 17
4: 178
Right 922119119 1:222644611-222644633 GGACCCAAGCTGTCACAGGCGGG No data
922119114_922119119 -8 Left 922119114 1:222644596-222644618 CCGATTCCCGGGGAGGGACCCAA 0: 1
1: 0
2: 0
3: 6
4: 97
Right 922119119 1:222644611-222644633 GGACCCAAGCTGTCACAGGCGGG No data
922119113_922119119 -7 Left 922119113 1:222644595-222644617 CCCGATTCCCGGGGAGGGACCCA No data
Right 922119119 1:222644611-222644633 GGACCCAAGCTGTCACAGGCGGG No data
922119107_922119119 15 Left 922119107 1:222644573-222644595 CCAAGCTGCTGGAGGTGACAGTC 0: 1
1: 0
2: 2
3: 35
4: 521
Right 922119119 1:222644611-222644633 GGACCCAAGCTGTCACAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922119119 Original CRISPR GGACCCAAGCTGTCACAGGC GGG Intronic
No off target data available for this crispr