ID: 922120031

View in Genome Browser
Species Human (GRCh38)
Location 1:222656591-222656613
Sequence ATGCAAAAGAAAAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1372
Summary {0: 1, 1: 0, 2: 7, 3: 112, 4: 1252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922120031_922120034 -8 Left 922120031 1:222656591-222656613 CCCTCCTGCTTTTTCTTTTGCAT 0: 1
1: 0
2: 7
3: 112
4: 1252
Right 922120034 1:222656606-222656628 TTTTGCATTTATACTGCTTGAGG 0: 1
1: 1
2: 8
3: 59
4: 417
922120031_922120035 15 Left 922120031 1:222656591-222656613 CCCTCCTGCTTTTTCTTTTGCAT 0: 1
1: 0
2: 7
3: 112
4: 1252
Right 922120035 1:222656629-222656651 TTATAAACATCTCTTGAGTTTGG 0: 1
1: 0
2: 3
3: 27
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922120031 Original CRISPR ATGCAAAAGAAAAAGCAGGA GGG (reversed) Intronic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902161250 1:14532159-14532181 CTGGGAAAGAAAGAGCAGGATGG - Intergenic
902391196 1:16107934-16107956 CTGGAAAAGAAAGATCAGGAGGG + Intergenic
903794444 1:25918296-25918318 GTGCAAGAGAAAATACAGGAGGG + Intergenic
904273474 1:29365359-29365381 AAGAAAAAGAAAAAGAAGGAAGG - Intergenic
904645603 1:31963827-31963849 AAACAAAAGAAGAAGAAGGAAGG - Intergenic
905205968 1:36343006-36343028 CTGAAAAATGAAAAGCAGGAAGG + Intronic
905502306 1:38449422-38449444 ATACTAAAGACAAAGTAGGAAGG - Intergenic
905529088 1:38662177-38662199 ATGAAGGAGAAAAAGAAGGAAGG + Intergenic
905589190 1:39147321-39147343 AGGAAAAAGAAAAGGAAGGAAGG - Intronic
906324548 1:44836710-44836732 ATGGAAAAGAAAAAGAAAAAAGG + Intronic
906499551 1:46331526-46331548 ATCAAAAAAAAAAAGCAGCATGG - Intergenic
906550377 1:46661231-46661253 ATGCAAAAGAAAAATTAGCCAGG - Intronic
906627686 1:47338591-47338613 AAGAAAAAGAAAGAACAGGAAGG - Intronic
906647592 1:47486872-47486894 AAGGAAAAGAAAAAGCAGGAAGG - Intergenic
906766256 1:48437266-48437288 ATACAGAAGAAAAAGCAGCAAGG - Intronic
907212082 1:52832609-52832631 CTACAAAAGAAAAAGGGGGAAGG - Intergenic
907233700 1:53025227-53025249 ATGCAAGAGGAAAACCAGCATGG - Intronic
907417661 1:54325662-54325684 AGGCAAAAAAACAACCAGGAAGG - Intronic
907560614 1:55384336-55384358 ATGCAAAAGCCACAGCATGATGG + Intergenic
907564254 1:55419990-55420012 ATTTAAAAGAAAAAGAAGAATGG + Intergenic
907755263 1:57304694-57304716 ATGCAAATGAAATAGAGGGAAGG - Intronic
908046988 1:60181548-60181570 ATGGAAAATAAATAGCAAGATGG - Intergenic
908406282 1:63817174-63817196 ATTCAAAAGCACAAGCAGGCAGG - Intronic
908425498 1:64003183-64003205 AAGAAAAAGAAAAAAAAGGAAGG - Intronic
908507896 1:64824101-64824123 ATGAAAAACAAAAATCAGGCCGG - Intronic
908744944 1:67367421-67367443 AAGAAAAAGAAAAAGAAAGAAGG + Intronic
909098067 1:71314620-71314642 CTGCAAAAGAAAAAAAAGGGGGG - Intergenic
909231836 1:73101295-73101317 ATGCAAAAGAAAAATCTTAAAGG + Intergenic
909280459 1:73744925-73744947 AAACAACAGAAAAAGCTGGAAGG + Intergenic
909334188 1:74451618-74451640 AAGAAAAAGAAAAGGAAGGAAGG - Intronic
909686529 1:78355136-78355158 AGAAAGAAGAAAAAGCAGGAAGG - Intronic
909723650 1:78808313-78808335 ATTTAAATGAAAAAGAAGGAAGG + Intergenic
909861621 1:80612605-80612627 AAGAAAAAGAAAAGGAAGGAAGG + Intergenic
909986166 1:82163108-82163130 ATGCAAAATACAAAGCTGAATGG - Intergenic
909989349 1:82203546-82203568 ATGCAAAATAAAAAACAGAGGGG + Intergenic
910115069 1:83723113-83723135 ATGAAAAAGAAAAAGAAATAAGG - Intergenic
910568641 1:88675694-88675716 ATGCGAAAGAAAAAGGAGCATGG - Intergenic
910771006 1:90832655-90832677 ATTCAAAAGAGCAAGCTGGAAGG - Intergenic
910817328 1:91305111-91305133 CTTGAAAAGAAAAAGAAGGAAGG - Intronic
910901310 1:92124102-92124124 AAGCAAAAGCAACAGCTGGAAGG - Intronic
910999678 1:93149853-93149875 ATGCATAGGAAAAAACAGGCCGG + Exonic
912088495 1:106040284-106040306 AAAGAAAAGAAAAAGAAGGAAGG + Intergenic
912176766 1:107168183-107168205 AAGAAAAAGAGAAAGAAGGAAGG - Intronic
913006134 1:114633455-114633477 AAAAAAAAGAAAAAGAAGGAAGG + Intronic
913038820 1:115003282-115003304 AAGCAAAAGAAAAAAAGGGAGGG - Intergenic
913324231 1:117612657-117612679 ATGCAAAACAAAAACCTGGATGG + Intronic
913676159 1:121142699-121142721 AAGAAAAAGAAAAATCAGGCCGG + Intergenic
913721597 1:121602013-121602035 ATGGAAAACAAAAAGAAGCAGGG - Intergenic
914028052 1:143930643-143930665 AAGAAAAAGAAAAATCAGGCCGG + Intergenic
914232610 1:145777830-145777852 ATTCAAAATAAAAAACAGGATGG + Intronic
914964025 1:152237076-152237098 AGGTAGAAGAAAAGGCAGGAAGG - Intergenic
915599135 1:156911588-156911610 ATGCAAAAGAAAAAAAGGGCTGG - Intronic
916008433 1:160682517-160682539 AGGAAAAAGAAAAAGAAGGGAGG + Intronic
916386390 1:164276402-164276424 AAGAAAAAGAAAAGGAAGGAAGG + Intergenic
916417665 1:164607787-164607809 AGGCAAGAGAAAAATCTGGAGGG + Intronic
916494466 1:165333150-165333172 AAACAAAACAAAAAGAAGGAAGG - Intronic
916609176 1:166373562-166373584 ATACAACAAAGAAAGCAGGAGGG + Intergenic
916832660 1:168508964-168508986 AAGCCAAAAAATAAGCAGGAAGG - Intergenic
917042454 1:170821069-170821091 AAGAAAAAGAAAGAGCAGGTTGG + Intergenic
917115385 1:171597995-171598017 ATGCAAAAGATAAATCTTGAAGG + Intergenic
917152601 1:171960804-171960826 CTGGAAGAAAAAAAGCAGGATGG + Intronic
917889491 1:179421341-179421363 AAGAAAAAGAAAAGGAAGGAAGG - Intronic
918219719 1:182425945-182425967 CTGAAAAAGAAAAAGAAAGAAGG + Intergenic
918327996 1:183428416-183428438 AAGCACAAGAGAAAGCAAGAGGG - Intergenic
918426332 1:184413822-184413844 AGTCAAAAGGAAAAGGAGGAAGG + Intronic
918675435 1:187279199-187279221 ATTCTAAAGAAAAAGAAGGCAGG + Intergenic
918773535 1:188596750-188596772 ATGCAAAGCAAAAAGCAAAAAGG + Intergenic
918827124 1:189338550-189338572 CTGAAAGAGAAAAAGCTGGAAGG + Intergenic
918995452 1:191753091-191753113 AGGCAAAAGAGAAGGAAGGAAGG - Intergenic
919083127 1:192890458-192890480 CTTCAAAAGGAAAGGCAGGAAGG - Intergenic
919108103 1:193180318-193180340 CAGCAAAAGAAAAGGCAGGCAGG - Exonic
919580330 1:199364490-199364512 ATGGAAAAGAAAAAAAAGGCAGG - Intergenic
919586181 1:199443321-199443343 ATGCAAAAGTTAACGCAAGATGG - Intergenic
919846123 1:201643291-201643313 AAGAAAAAGAAAGAGAAGGAAGG - Intronic
920226888 1:204445798-204445820 ATGAGAAAGAAAAAGCAAAAAGG + Intronic
920463526 1:206161537-206161559 AAGAAAAAGAAAAATCAGGCCGG + Intergenic
920493023 1:206433164-206433186 CTGCAAAAAGAAATGCAGGAAGG + Intronic
920517438 1:206596608-206596630 ATGCAGAAGCAAAAGAAGGCTGG - Intronic
920776864 1:208947251-208947273 ATAGTAAAGAAAAAGAAGGAAGG + Intergenic
921626426 1:217382011-217382033 ATGCAAAGCAAAAAACAGCAGGG + Intergenic
921883758 1:220282578-220282600 GCGCAAAAGAGAAAGCATGAGGG + Intergenic
921912956 1:220572223-220572245 AAGGAAAAGAAAAAACAGTAAGG - Intronic
922113093 1:222581830-222581852 ATGGAAAAGAAAAAACAAGCAGG + Intronic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
922124487 1:222709496-222709518 ATGAAAAAAATGAAGCAGGATGG + Intronic
922150187 1:222995185-222995207 ATGGGAAAGAAAAAGGAAGATGG - Intronic
922304329 1:224330683-224330705 GTGAAAAAGAAAAGGAAGGACGG + Intergenic
922820781 1:228484031-228484053 AGGGAAAAGAAAAAGAAGAAAGG - Intergenic
923337377 1:232982233-232982255 ATAAAAAAGAAAAAGAAGTATGG + Exonic
923582154 1:235228134-235228156 ATTTAAAAGAAAAATCAGGCCGG - Intronic
923849151 1:237774287-237774309 ATGCTAAGGATAAAACAGGAGGG + Intronic
924357459 1:243197118-243197140 ATACAAAATAAACTGCAGGAGGG + Intronic
924397338 1:243636111-243636133 ATATAAAAGAAAAAACAGAATGG + Intronic
924550186 1:245068879-245068901 TTGCACAAGAAAAAAAAGGAAGG + Intronic
924570196 1:245230767-245230789 AGGAAAAAGAAAACGAAGGAAGG + Intronic
924805864 1:247361111-247361133 AGAAAAAAGAAAAAGCAGAAGGG + Intergenic
1062839603 10:659858-659880 CTGGGAAAGAGAAAGCAGGAAGG - Intronic
1063255140 10:4319579-4319601 CTGAAAAAGAAAATGCATGAGGG - Intergenic
1063638554 10:7809117-7809139 AAGCAAAATACAAAACAGGATGG - Intergenic
1063768986 10:9176227-9176249 ATGAAAAAGAAAAATCAACATGG + Intergenic
1063866946 10:10374912-10374934 ATGGAGATGGAAAAGCAGGAAGG + Intergenic
1063900288 10:10725981-10726003 ATGCAAAACTAAAAGCCAGAAGG + Intergenic
1063923110 10:10951143-10951165 AAAGAAAAGAAAAAGGAGGATGG - Intergenic
1064165131 10:12979342-12979364 AAGGGAAAGAACAAGCAGGAGGG - Intronic
1064402815 10:15035480-15035502 GAGCAAAAGAGAAAGCTGGATGG + Intronic
1064464715 10:15567664-15567686 AGGCAAAAGAGAAAGTGGGAAGG + Intronic
1064762455 10:18635277-18635299 ATACAAAAGCAAAACCAGCAAGG - Intronic
1064938152 10:20703303-20703325 AGGCCAAAAAAAAGGCAGGAAGG - Intergenic
1065406968 10:25379090-25379112 ATGCAATATAAAAGGCAGGTGGG - Intronic
1066067599 10:31773640-31773662 ATGCAATACAAAAAGTAGGTGGG - Intergenic
1066239664 10:33521314-33521336 ATGCTAAAGAAACAGAAGGCAGG + Intergenic
1066275963 10:33868947-33868969 ATGCATAAGAAAAGTCAGGCCGG - Intergenic
1066394721 10:35008112-35008134 ATGAAAAGGAAAAAGGAGCAAGG - Intergenic
1066402859 10:35091927-35091949 AAACAAAACAAAAAGCAGGGGGG - Intergenic
1066617043 10:37305723-37305745 AAAAAAAAGAAAAAGAAGGAAGG + Intronic
1066653938 10:37682254-37682276 AGGCAAGAGCAAAAGCAGGGGGG + Intergenic
1066820319 10:39478842-39478864 ATGCAAAAATAAATTCAGGATGG - Intergenic
1067168895 10:43888468-43888490 AAGGAAAAGAGAAAGAAGGAAGG - Intergenic
1067395299 10:45910497-45910519 ATGAAAAAGACAAAGGTGGAAGG - Intergenic
1067519403 10:46985064-46985086 ATGCAAATGAAAAAGATGGAGGG + Intronic
1067538803 10:47136783-47136805 AAGAAAGAGAAAAAGAAGGAAGG - Intergenic
1067642844 10:48066775-48066797 ATGCAAATGAAAAAGATGGAGGG - Intergenic
1067731503 10:48815107-48815129 ATCCAAAAGAAAACGCCTGAAGG - Intronic
1067795947 10:49322379-49322401 CTGCAAAAGAAAAAGGTGCAGGG - Intronic
1067863621 10:49879621-49879643 ATGAAAAAGACAAAGGTGGAAGG - Intronic
1068050894 10:51947610-51947632 ATTTAAAACAAACAGCAGGAGGG - Intronic
1068303110 10:55171178-55171200 ATGTGAAGGAAAAAGCTGGAGGG - Intronic
1068381459 10:56259187-56259209 ATGCAAAAAAGTAAGGAGGAGGG - Intergenic
1068546987 10:58358748-58358770 AAGAAAAAGAAAAAGCAATAAGG - Intronic
1068620278 10:59174831-59174853 TTGAAAAAGTAAAAGTAGGATGG - Intergenic
1068767311 10:60778313-60778335 CGGCTAGAGAAAAAGCAGGAGGG - Intronic
1068885053 10:62089514-62089536 AAAAAAAAGAAAAAGAAGGAAGG - Intronic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1069230280 10:66000307-66000329 AATCAAAAGAGAAAGGAGGAAGG - Intronic
1069520515 10:69116326-69116348 ATACAAAAGAAAAAACAGCTGGG - Intergenic
1069985371 10:72279388-72279410 ATTCAAAAGAAAAATAAGGCTGG + Intergenic
1070163083 10:73877590-73877612 ATACAAAGGAAAAAGGAGGCTGG - Intergenic
1070361449 10:75693815-75693837 TTGAATAAAAAAAAGCAGGATGG + Intronic
1071142912 10:82533445-82533467 ATGCAAAAAAAAAATCAAAACGG - Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1072002376 10:91209458-91209480 ATTAAAAAGAAAAAGGAGGCCGG + Intronic
1072136628 10:92553125-92553147 AAGAAAAAGAAAAAGCAGGCTGG + Intronic
1072140154 10:92582505-92582527 TTGCAAAATAAAAAAGAGGAGGG - Intergenic
1072301006 10:94062271-94062293 ATGAAAAAAAACAAGAAGGAAGG - Intronic
1072512634 10:96143367-96143389 ATGAAAAAGAGAATGCATGATGG - Intronic
1072988518 10:100166121-100166143 ATGAAAAAGAGAAAACAGGCTGG + Intronic
1073294950 10:102433274-102433296 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1073676746 10:105655782-105655804 CTGCAACAGCAAAAGCAGAATGG + Intergenic
1073773241 10:106758492-106758514 TTGCTAATGAAAAAGCATGAGGG - Intronic
1073980828 10:109151747-109151769 ATTCAAAATAAAAAGCAAGAAGG - Intergenic
1074025821 10:109633128-109633150 ATGCAAACAAAAATGCAGGCTGG - Intergenic
1074165195 10:110868959-110868981 ATGCAAAAAAAAATGTGGGAGGG - Intergenic
1074372926 10:112914878-112914900 AGGGATAAGAAAAAGCAGGGAGG + Intergenic
1074668266 10:115756981-115757003 ATGCAAAACAAAAAAAAGCAGGG - Intronic
1074758800 10:116648495-116648517 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
1075081445 10:119386637-119386659 ATGCAGATGAAAACGCAGAAGGG - Intronic
1075249396 10:120851856-120851878 ACGAAAAAGAAAAGACAGGATGG - Intronic
1075496681 10:122926804-122926826 TTTCAAAAGATAAAGGAGGAAGG + Intergenic
1075591503 10:123694687-123694709 AAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1076571974 10:131438956-131438978 ATGCAAAAAAGAAAGGAAGAAGG - Intergenic
1076597248 10:131631718-131631740 AAGCAGAAGGAAAACCAGGAAGG - Intergenic
1077003836 11:341097-341119 AAGAAAAAGAAAAGGAAGGAAGG + Intergenic
1077363806 11:2153273-2153295 AATCAAAAAAACAAGCAGGAGGG - Intronic
1077720972 11:4628151-4628173 AAGCCAAAGAAAAAGCATGTAGG - Intergenic
1077787624 11:5401836-5401858 AAGCAGAAGAAAAAGAGGGAAGG - Intronic
1078034356 11:7787242-7787264 ATTAAAAACAAAAAGAAGGAAGG + Intergenic
1078302266 11:10144091-10144113 ATGCAATAGAAAAGGCTTGAAGG - Intronic
1078400324 11:11020557-11020579 AAGAAAAAGAAAAAGAAAGAAGG - Intergenic
1078707503 11:13759275-13759297 ATGCAAATGAAAAAGCTGCTGGG + Intergenic
1078965604 11:16337195-16337217 AAGCAAAAGAAAAAAAAGTAAGG + Intronic
1079187616 11:18251452-18251474 ATGCTAAAGAAACACAAGGAAGG + Intergenic
1079316355 11:19411017-19411039 ATGCAAAAGAAAAGGGAGATAGG - Intronic
1079445567 11:20553668-20553690 AGGAGAAAGAAAAAGGAGGAAGG - Intergenic
1079975011 11:27080022-27080044 TTTAAAAAGAAAGAGCAGGATGG - Intronic
1080023029 11:27583981-27584003 TTGCAAGAAAAAAAGGAGGAAGG - Intergenic
1080118948 11:28653275-28653297 ATACAGAAGAAAAATCAGCAAGG - Intergenic
1080149778 11:29037795-29037817 ATGGAAGATAAAAAGCAGAAGGG + Intergenic
1080209477 11:29769487-29769509 ATGGAAAACAAAAAGAAGGCAGG - Intergenic
1080219605 11:29886077-29886099 AGGAAAAAGACCAAGCAGGAGGG - Intergenic
1080319992 11:30997123-30997145 ATGTAAAAGGAAAAGCTGTAGGG + Intronic
1080364452 11:31554814-31554836 ATGCACAAGATAAAGCATAATGG - Intronic
1080556623 11:33422784-33422806 ATGAAAAAGAAAAAAAAGGAAGG + Intergenic
1080825265 11:35843230-35843252 ATACAAAAGAAAAACCATTATGG + Intergenic
1081378892 11:42390915-42390937 ATGCAAGAATAAAAGCATGAAGG + Intergenic
1081816730 11:45948840-45948862 AAGCAAAAGCAACAGCAGCAAGG + Intronic
1082043389 11:47705656-47705678 AAGAAAAAGAAAAAGAAGAAAGG + Intronic
1082211859 11:49513761-49513783 ATGAAAAAGAGAAAAAAGGAGGG + Intergenic
1083243907 11:61410836-61410858 AAGCAAAAGTAAATGCAGCAAGG - Intronic
1083577170 11:63800635-63800657 AAGAAAAGGAAAAAGAAGGAAGG + Intergenic
1083870143 11:65482292-65482314 AAGAAAAAGAAAAAGCAGCCTGG + Intergenic
1084374628 11:68767916-68767938 ATTTAAAAGGAAAAGCAGGCAGG - Intronic
1084467262 11:69332865-69332887 ATACAAAACAAAAATCATGATGG - Intronic
1085167967 11:74420984-74421006 ATGGAAAAGAAAGACCAGTATGG - Intergenic
1085808881 11:79662178-79662200 ATGCTAAGGAAAAAGATGGAGGG - Intergenic
1086067655 11:82763679-82763701 ATGGAAAGGAAAAACCAGTACGG - Intergenic
1086165316 11:83771282-83771304 ATGCAAAAGAAGGAGTAGTAGGG - Intronic
1086297878 11:85391395-85391417 TTCCAAAAGATAAAGAAGGAGGG + Intronic
1086342373 11:85859110-85859132 AAAAAAAATAAAAAGCAGGAAGG + Intronic
1086637779 11:89111069-89111091 ATGAAAAAGAGAAAAAAGGAGGG - Intergenic
1087068101 11:94046400-94046422 AAGGGAAAGAAAAAGCATGAAGG - Intronic
1087342494 11:96925273-96925295 ATGCAAAAGAAAATTAATGAAGG + Intergenic
1088007405 11:104959681-104959703 ATGGAAAAGAGAATGAAGGATGG - Intronic
1088086796 11:105990761-105990783 ATGGAAAAGGCAAAGCAGGGTGG + Intergenic
1088150972 11:106744580-106744602 ATGAAAAGTAATAAGCAGGAAGG + Intronic
1088197929 11:107296009-107296031 ATGCAAAACAAAAAAAAGCAGGG + Intergenic
1088238893 11:107753812-107753834 ATTAAAGAGATAAAGCAGGAGGG - Intergenic
1088530260 11:110800380-110800402 AAGCAAAAGCAAAAGCAAAAAGG + Intergenic
1088582046 11:111325931-111325953 AAACAAAAGAAAAAGAGGGAAGG - Intergenic
1088698276 11:112388988-112389010 AAGCAAAAGAAGAAGCAGCCTGG - Intergenic
1089447438 11:118564921-118564943 ATGCTACTGAAAGAGCAGGATGG - Intronic
1089531664 11:119133909-119133931 ATGTAGAAGAAAAGGCAAGAGGG - Intronic
1089636770 11:119819310-119819332 TTTCAAAAAAAAAAGCAGTAAGG - Intergenic
1089879727 11:121762291-121762313 AGAAAAAAGAAAAATCAGGAGGG + Intergenic
1090128117 11:124111008-124111030 ATGAAAAAGAAAAAGCCGTTTGG - Intergenic
1090403485 11:126463576-126463598 AAGCACAAAAGAAAGCAGGATGG + Intronic
1090685766 11:129117167-129117189 ATACAAAAGAACATGCAGAATGG + Intronic
1090892395 11:130935983-130936005 ATGAAAAATAAATAGCAAGATGG - Intergenic
1091072460 11:132580869-132580891 AAACAAAATAAAAAGAAGGATGG - Intronic
1091414712 12:271332-271354 AACCAAAAGAAGCAGCAGGAGGG - Intergenic
1092023174 12:5219255-5219277 ATGAAAATGAAAAAAGAGGATGG + Intergenic
1092037089 12:5345567-5345589 ATGGAAAAGAACATTCAGGAAGG - Intergenic
1092310137 12:7343569-7343591 AAGCAAAAGAGAGAGCAGGGAGG + Intergenic
1092394987 12:8118033-8118055 AGGGAAAAGAGCAAGCAGGAGGG + Intergenic
1092551119 12:9501291-9501313 CCGAAAAAGAAAAAGAAGGAAGG - Intergenic
1093060276 12:14595098-14595120 GTGGAAAAAAAAAAGAAGGAAGG - Intergenic
1093087358 12:14881531-14881553 AAGGAAAAGAGAAAGCAGAAGGG - Intronic
1093106016 12:15088035-15088057 AAGGAAAAGAGAAAGCAGGAGGG + Intergenic
1093200673 12:16182719-16182741 ATGCAAAGGATAAAGTGGGAGGG - Intergenic
1093209762 12:16293896-16293918 ATACAGAGGAAAAAGCAGGTTGG + Intergenic
1093269751 12:17045580-17045602 ATACAAAAGATAAAGCTGGTAGG - Intergenic
1093844971 12:23959212-23959234 TTGCAAAAGAAAAAGAATGAGGG + Intergenic
1094215756 12:27940284-27940306 TTGGAAAAGAAAAGGCTGGAGGG + Intergenic
1094231910 12:28115308-28115330 ATTTAAAAGACAAATCAGGAAGG - Intergenic
1094329697 12:29277701-29277723 ATGTTCAAGAAAATGCAGGAGGG + Intronic
1094491941 12:30966233-30966255 AGCCATAAGAAAAGGCAGGAGGG + Intronic
1094520685 12:31185065-31185087 CCGAAAAAGAAAAAGAAGGAAGG + Intergenic
1094622113 12:32089693-32089715 ATGCAATGGAAAAAGCCAGATGG + Intergenic
1094731834 12:33185598-33185620 AAGAAAAAGAAAAAGAAAGAAGG - Intergenic
1095178338 12:39118445-39118467 AAAAAAAAGAAAAACCAGGATGG + Intergenic
1095447737 12:42299208-42299230 AAAAAAAAGAAAAAGAAGGAAGG + Intronic
1095578220 12:43763932-43763954 AGGCAAGAAAAAAACCAGGATGG - Intronic
1096564532 12:52467555-52467577 ATGCAAAAGCAAAACAAGCATGG - Intergenic
1096643535 12:53014133-53014155 AGAAAAAAGAAAAAGCAGGCCGG + Intronic
1096688132 12:53302595-53302617 TGGCAAAAGAAAAAGCTGGAAGG - Intronic
1097148220 12:56956228-56956250 ATGATGAATAAAAAGCAGGAAGG + Intronic
1097681765 12:62656011-62656033 ATGGAAAACAAAAAGGAAGAGGG + Intronic
1098196159 12:68004294-68004316 ATGCAAAAGTAAATGCATCATGG - Intergenic
1098394273 12:70002022-70002044 TGGAAAAAGAAAAGGCAGGATGG - Intergenic
1098582275 12:72114164-72114186 ATGAAAAAAAAAAAGCATGCTGG + Intronic
1098816725 12:75175046-75175068 CTTCCAAAGAAAAAACAGGAGGG + Intronic
1099093648 12:78343890-78343912 ATCCACAAGAAACAGCAGTAGGG + Intergenic
1099452821 12:82828191-82828213 AAGCCAAAGAAAAAGCAAAAGGG - Intronic
1100065672 12:90641352-90641374 AAGCAAGACAGAAAGCAGGAAGG + Intergenic
1100291516 12:93219170-93219192 GAGTAAAAGAAAGAGCAGGAGGG + Intergenic
1100307313 12:93362596-93362618 TTGCAAAAGACATAGCAGGTTGG - Intergenic
1100952068 12:99862409-99862431 ATCAAAAAGAAAAAGCACAAAGG + Intronic
1100993554 12:100277734-100277756 ATACAAAATAAATAGCAAGATGG - Intronic
1101549598 12:105749747-105749769 ATGCAAAAGAGAAAGACAGAAGG - Intergenic
1101646966 12:106640311-106640333 AAGGAAAAGAAACATCAGGAAGG + Intronic
1101851828 12:108409469-108409491 ATGCAATTGAAAAAGCCAGAGGG + Intergenic
1102387872 12:112525966-112525988 ATGAAAGACAAAAAGAAGGAAGG - Intergenic
1102712492 12:114940313-114940335 ATGCAAGAGAGAAAGCAAGGAGG + Intergenic
1103115811 12:118330721-118330743 AGGGAAAAGAAAAAGAAAGAAGG + Intronic
1103137697 12:118522010-118522032 ATGCAATATATAAAGCAGAAAGG + Intergenic
1103810472 12:123609526-123609548 ATTAAAAAAAAAAAGCATGATGG - Intronic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104006147 12:124893940-124893962 AAGAAAAAGAAAAAGCAGGAAGG + Intergenic
1104144972 12:126024419-126024441 CTACAAAAGAAAAAGTAGGCCGG + Intergenic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104691091 12:130827028-130827050 AGGAAAAAGAAAAAGAAAGAAGG + Intronic
1104781261 12:131422032-131422054 AGGCAGGAGAAAAAGGAGGAGGG - Intergenic
1105204755 13:18211614-18211636 TTGAAAAAGAAAAAACAGAATGG + Intergenic
1105284255 13:18992015-18992037 CACCAAAAGAAAGAGCAGGAAGG + Intergenic
1105284595 13:18993938-18993960 AAGCAAAAGACAAGGCAAGAAGG + Intergenic
1105418903 13:20235764-20235786 GAGCAAGAGAAAAAGCAGGGAGG + Intergenic
1105584411 13:21730724-21730746 TTCCAAAAGAAAAATCTGGAAGG + Intergenic
1105956953 13:25292537-25292559 AACCACAAGAAAAGGCAGGAGGG + Intergenic
1106148862 13:27078546-27078568 ATTCAAAAAAGAAAGAAGGATGG + Intronic
1106345304 13:28871301-28871323 AGGGGAAAGAAAAAGCTGGAAGG + Intronic
1106525750 13:30539856-30539878 GAGGAAAAGAAAAAGAAGGACGG - Intronic
1106692794 13:32136508-32136530 CTCCAGAAAAAAAAGCAGGAAGG - Intronic
1107073667 13:36298283-36298305 ATGCAAAACAATAATCTGGAGGG - Intergenic
1107150733 13:37107733-37107755 ATGGGAAAGATAAAGCAGGCTGG - Intergenic
1107270604 13:38611379-38611401 TAGCAAAATAAAAAGCAAGACGG - Intergenic
1107276099 13:38681011-38681033 ATTCAAAAGTCTAAGCAGGATGG - Intergenic
1107320493 13:39181260-39181282 TTACAAATGAAAAAGCAGGTGGG - Intergenic
1107546437 13:41437821-41437843 AAACAAAAGAAAAAGCATGTTGG + Intergenic
1107659185 13:42621750-42621772 AAGCAGAAGAGAAAGGAGGAAGG + Intergenic
1107754701 13:43607756-43607778 ATGCATTAGAAAGAGCAGTAGGG - Intronic
1108020171 13:46120214-46120236 ATGAAAAAGATAAACCAGGAAGG + Intergenic
1108022461 13:46142131-46142153 CTGAAAAAAAAAAAGCAGAAAGG + Intronic
1108090219 13:46841695-46841717 ATGGAAAAGAAAAGGAAGGAGGG - Intronic
1108157823 13:47604515-47604537 ATAAAAAAAAAAAAGCAAGAGGG + Intergenic
1108347606 13:49561752-49561774 CTACAAAAAAAAAAGCAAGAAGG + Intronic
1108386654 13:49905206-49905228 AGGGAAAAGAGAAAGCAAGATGG - Intergenic
1108490199 13:50974380-50974402 AGGAAAAAGAAAAAGGAGGGAGG + Intergenic
1108676671 13:52743092-52743114 AGGCAGTAGAAAAAGCAGTAAGG + Intergenic
1108757865 13:53525882-53525904 AAGAAAAAGAAAAAACAGAAAGG + Intergenic
1108994832 13:56715590-56715612 ATACAAAAGAATAAACAGCAGGG - Intergenic
1109061800 13:57630688-57630710 ATGCAAGAGAAAAGGATGGAGGG - Intergenic
1109185770 13:59265797-59265819 ATGAAAAAGAAAAAAAAGGAAGG - Intergenic
1109205416 13:59477830-59477852 ATGCAAAGGACAAGGCATGAAGG - Intergenic
1109209444 13:59517650-59517672 TGGCAAAACAAAAAGCAGCAAGG - Intergenic
1109961595 13:69638933-69638955 ATGGAAAGGAAAGAGCAGAATGG - Intergenic
1110104599 13:71655793-71655815 AAGCAAATGAAAAAGAAAGATGG - Intronic
1110172800 13:72522647-72522669 ATGCAGAGGAAAAAGCAAAAAGG - Intergenic
1110593834 13:77295840-77295862 CTGCAAAAGAAAAGGCAATATGG - Intronic
1110744428 13:79036360-79036382 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1110751208 13:79118666-79118688 CTAAAAAAGAAAAAGAAGGAAGG + Intergenic
1110947641 13:81443228-81443250 ATGCAAGAGAAAGAACAGAAGGG + Intergenic
1111006287 13:82253689-82253711 ATACTAAAGAAAAAGAAGGAAGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111443729 13:88316590-88316612 CTGCTAAAGAAAAAGCATTAGGG + Intergenic
1111497020 13:89064086-89064108 ATGCATTAGAAAAAGATGGATGG + Intergenic
1111547567 13:89762411-89762433 CGGCAAAAGAAAAAGATGGAGGG - Intergenic
1112038079 13:95516169-95516191 ATACAAATGAAATAGTAGGAAGG + Intronic
1112351019 13:98633202-98633224 ATGCAATAGAACAGGCAGAAGGG - Intergenic
1112523503 13:100120338-100120360 ATGAAAAAGAAAAAGGAAGCAGG - Intronic
1112643175 13:101300331-101300353 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1112971018 13:105262637-105262659 ATTCACAAGAAACTGCAGGATGG + Intergenic
1112978435 13:105351099-105351121 GTCCAAAAGAAAAACCAGAACGG - Intergenic
1113010957 13:105765111-105765133 AGAAAAAAGAAAAAGAAGGAGGG - Intergenic
1113557403 13:111249428-111249450 AGGGGAAAGAACAAGCAGGAGGG + Intronic
1113601802 13:111574707-111574729 ATCCAAAAGTAAAAGCAGACTGG - Intergenic
1113991001 14:16027749-16027771 ATTCAAAAGCAAAAGTAGCAGGG + Intergenic
1114188285 14:20420404-20420426 ATGAAAAAGAAAAAAAAGGCCGG + Intergenic
1114189883 14:20432465-20432487 ATAAAAAAAAAAAAGGAGGAAGG + Intronic
1114225950 14:20738804-20738826 ATGCAAAGGAAAATGCATGTGGG + Intronic
1114252386 14:20972322-20972344 ATGGAAAAAATAAAGCAGGAAGG + Intergenic
1114739532 14:25081051-25081073 AAAGAAAAGAAAAAGAAGGAAGG - Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115095399 14:29630091-29630113 ATGCAAGAGAAGAAGAAGAAAGG - Intronic
1115467110 14:33727623-33727645 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1115485227 14:33903381-33903403 ATGCAAAAGATCAAGTAAGAAGG + Intergenic
1115546084 14:34465878-34465900 ATGAAAAAGAAAAAGGGAGATGG + Intergenic
1115621062 14:35141223-35141245 AAAAAAAAGAAAAAGAAGGAAGG - Intronic
1115831755 14:37350376-37350398 AAAGAAAAGAAAAAGCAGAATGG - Intronic
1115982661 14:39071143-39071165 AAGGAAAAGAAAAAGCATGCAGG + Intronic
1116100643 14:40429666-40429688 ATGCAAAAGGAAAATCTTGAAGG + Intergenic
1116249083 14:42457894-42457916 CTCAAAAAGAAAAGGCAGGATGG - Intergenic
1116875629 14:50108203-50108225 AAAAAAAAGAGAAAGCAGGAGGG + Intergenic
1117031829 14:51679953-51679975 ATGCCAAAGAAGAAGGGGGAAGG + Intronic
1117199410 14:53373021-53373043 ATGCAAAATAACAAGCAGCAAGG - Intergenic
1117206465 14:53448770-53448792 ATGCAAATGAGAAAGCATGTAGG + Intergenic
1117237741 14:53796662-53796684 ATGGCAAAGAAAATGGAGGACGG - Intergenic
1117720642 14:58625651-58625673 ATGCAAAAGAACCTGTAGGAGGG + Intergenic
1117797794 14:59411755-59411777 ATGGAAAACAAAAAAAAGGAAGG + Intergenic
1117959666 14:61150197-61150219 AAAGAAAAGAAAAAGAAGGAGGG - Intergenic
1118159957 14:63278190-63278212 ATGCAAAATGCAAAGCAAGAGGG - Intronic
1118379166 14:65203890-65203912 AAGAAAAAGAAAATGCAGCACGG - Intergenic
1118416861 14:65548483-65548505 CTGCAAAAAAAAAATCAAGATGG - Intronic
1118487524 14:66227913-66227935 AGGAAAAAGAAAAAGAAGGGAGG + Intergenic
1118506675 14:66421114-66421136 ATACGAAAGAAAAAAAAGGATGG - Intergenic
1118562924 14:67107050-67107072 ATGCAACTGAAAAAGCTGCAAGG - Intronic
1118570009 14:67184979-67185001 ATGCAAAAGAAATACCAAGAAGG + Intergenic
1119133259 14:72193886-72193908 ATGCAAAGGCCAAAACAGGAGGG + Intronic
1119724232 14:76912491-76912513 ACCCAAAAGAATCAGCAGGAAGG + Intergenic
1119754219 14:77103229-77103251 ATGCAAAAGTACGAGCAAGAGGG + Intronic
1119822492 14:77629830-77629852 ATGCAAAAGGAATAGAAGGAGGG + Intergenic
1119881098 14:78100646-78100668 ATGCAGAGGACAAAGCATGAGGG + Intergenic
1120035409 14:79691341-79691363 AAGAGAAAGAGAAAGCAGGAGGG + Intronic
1120147053 14:80990180-80990202 AGGAGAAAGAAAAGGCAGGAAGG + Intronic
1120242976 14:81971611-81971633 AAGAAGAAGAAAAAGAAGGAAGG - Intergenic
1120323061 14:82990473-82990495 ATGCTATAGAAAAAACATGAGGG - Intergenic
1120461107 14:84796534-84796556 ATGCAAAAAAAAAAAAAGAAAGG - Intergenic
1120613232 14:86668603-86668625 AAGGAAAAGAAAAAGGAAGAGGG - Intergenic
1120691280 14:87596121-87596143 AAACAAAACAAAAAACAGGATGG + Intergenic
1120748122 14:88170743-88170765 ATGAAAAACAAAAAACAGTAGGG + Intergenic
1121067660 14:90983644-90983666 AAGAAAAAGAAAAAGGAAGAAGG + Intronic
1121141375 14:91545386-91545408 ATGGAAAAGAAAAAGAAAGAAGG - Intergenic
1121189528 14:92013584-92013606 ATGGAATAGAAAAAAGAGGAAGG + Intronic
1121485394 14:94310587-94310609 AGGCAAAAAAACAAGCTGGATGG - Intronic
1121593299 14:95137291-95137313 AGGCAAAAGAAAAAGGAAAAGGG + Intronic
1122057504 14:99113674-99113696 AGGTAAAAAAAAAAGCATGAAGG - Intergenic
1122419363 14:101565337-101565359 AAGAAACAGAAAAAGAAGGAGGG - Intergenic
1122570170 14:102692748-102692770 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1122621645 14:103061128-103061150 AAGAAAAAGAAAAAGAAGGCCGG + Intergenic
1122703633 14:103606788-103606810 AAGAAAAAGAAAGAGAAGGAAGG - Intronic
1123791482 15:23725004-23725026 ATGCAAAGGGAAAAACAGCATGG - Intergenic
1124021344 15:25927364-25927386 ATTCAAAAGTAAAATTAGGATGG - Intergenic
1124601950 15:31140589-31140611 ATGGAAGAGAAGAAGCAAGAAGG - Intronic
1125057654 15:35381419-35381441 AAGAAAAAGAAAAAAGAGGAAGG + Intronic
1125121251 15:36161226-36161248 AAGAAAAAGAAAATGAAGGAAGG + Intergenic
1125144546 15:36451542-36451564 ATGAAAAAGATAAAAGAGGAAGG - Intergenic
1125306884 15:38327477-38327499 ATCCAAGAGAGAAAGCAAGATGG - Intronic
1125309970 15:38368058-38368080 AGACAAAACAAAAAGCAGGAAGG + Intergenic
1125640144 15:41223702-41223724 ATACAAAAGAAAAATCAGCCGGG + Intronic
1126259325 15:46669430-46669452 ATGACAGAAAAAAAGCAGGAAGG - Intergenic
1126861009 15:52883176-52883198 ATACAAAGGATCAAGCAGGATGG - Intergenic
1127283042 15:57508401-57508423 AGGCAAATCAAAAAGGAGGAAGG + Intronic
1127306493 15:57710903-57710925 ATGCAGAAGGAAGAGCAGAAAGG - Intronic
1127374475 15:58370444-58370466 AGGCAAAAGAGCAAGCAGGAGGG + Intronic
1127402120 15:58599151-58599173 AGAAAAAAGAAAAAGAAGGAAGG + Intronic
1127747434 15:61994217-61994239 ATGCAGTAGACAAAGAAGGATGG - Intronic
1127889879 15:63240595-63240617 ATGGAAAAAAAAAAGCAAGTGGG - Intronic
1127917786 15:63469635-63469657 ATGAAAAACAAAAAGGAGGCTGG + Intergenic
1128068660 15:64779871-64779893 ATTTAAAAGAAAAAGAAGAAAGG + Intergenic
1128560943 15:68667308-68667330 AAGCAGAGGAAGAAGCAGGATGG - Intronic
1129040162 15:72679018-72679040 AAGAAAAAGAAAAGGAAGGAAGG + Intronic
1129284648 15:74514758-74514780 ATGCAGAAGAAACTGCAGGCGGG + Intergenic
1129552822 15:76472099-76472121 ATGCCCAAGAAAAAGCTGAAGGG + Intronic
1129622328 15:77159636-77159658 ATGAAAAAAAGAAAGAAGGAAGG + Intronic
1129876961 15:78981952-78981974 ATGGAGAAGAAAAGGAAGGAGGG - Intronic
1130003517 15:80069314-80069336 ATGCAAAATAAAAAGAAACAGGG - Intronic
1130549876 15:84883549-84883571 ATGCAGAAGAAAAAGTTGTATGG + Intergenic
1130620712 15:85459493-85459515 AAAAAAAAGAAAAAGCAGGCTGG - Intronic
1130646321 15:85730368-85730390 ATGAAAAAGAAAAGGCAGTGTGG + Intronic
1130661307 15:85833475-85833497 ATAGAAAAGAAAAAGGATGACGG - Intergenic
1130819289 15:87477275-87477297 ATGGAATGGAAAAGGCAGGAAGG - Intergenic
1130866244 15:87935563-87935585 ATGCAGAAGAAGAAGAAGAAGGG + Intronic
1130892286 15:88143232-88143254 ATGAAATAGAAAAAGAAAGAAGG + Intronic
1131211867 15:90504463-90504485 AGGCAAAAGAATGAGCAGCAGGG - Intergenic
1131273733 15:90962771-90962793 ATCCAAAAGAAAAATCACTAAGG - Exonic
1131310849 15:91288667-91288689 AAGAAAGAGAAAAAGAAGGAAGG - Intronic
1131340897 15:91599654-91599676 AAGCAAAAAGAAAAGAAGGAAGG + Intergenic
1131744725 15:95434853-95434875 AGGAAGAAGAAAAAGAAGGAAGG - Intergenic
1131769228 15:95716832-95716854 AAGCAAAAGAGAAAGAAGGAAGG + Intergenic
1131902743 15:97105760-97105782 AGGCAAAAGAGATAGCAAGAAGG - Intergenic
1132117597 15:99148923-99148945 CTGAAAAACAAAAAACAGGAAGG - Intronic
1132537605 16:490776-490798 TGGCAAAAGAGAAAGCAGTATGG + Intronic
1133247595 16:4459512-4459534 CTGCAAAAAACAAAACAGGAAGG - Intergenic
1133501106 16:6367570-6367592 ATGCATAAGAAAATCCAAGAAGG - Intronic
1133873830 16:9714287-9714309 ATGAAGAAGAAAAAGCAGAGTGG - Intergenic
1133984983 16:10661635-10661657 ATCCAAAAGATGAAGTAGGAAGG + Intronic
1134019480 16:10911526-10911548 AAGGAAAGGAAAAAGAAGGAAGG - Intronic
1134593030 16:15472556-15472578 AATCAAAAGAAAAGCCAGGATGG - Intronic
1134651429 16:15912076-15912098 AAGAAAAAAAAAAAGAAGGAAGG - Intergenic
1134860813 16:17558764-17558786 ATGAAAAAGATACTGCAGGAGGG + Intergenic
1134896930 16:17896673-17896695 AGGAAAAAGAAAAAGGAGAAAGG + Intergenic
1135072669 16:19365755-19365777 ATGATAAAGAGAAAGCATGATGG + Intergenic
1136178602 16:28535695-28535717 AAGAAAGAGAAAAAGAAGGAAGG - Intronic
1136182850 16:28566283-28566305 AAGAAAAAGAAAAAGAAAGAGGG + Intronic
1136910185 16:34138874-34138896 ATTCAAAAGCAAAAGTAGCAGGG + Intergenic
1137061125 16:35792519-35792541 ATTCAAAAGAAAAAGCACTCCGG + Intergenic
1137219770 16:46437160-46437182 AAGGAAAAGGAAAAGAAGGAAGG - Intergenic
1137442863 16:48511084-48511106 ATGCAGGAAACAAAGCAGGATGG - Intergenic
1137574835 16:49592694-49592716 ACACAAAAGACAAAGCAGGCAGG + Intronic
1137613787 16:49835440-49835462 GTGCAAAATAAAAGGGAGGAAGG + Intronic
1138007057 16:53347527-53347549 GTCCACAAGAGAAAGCAGGAAGG - Intergenic
1138646274 16:58427361-58427383 CTGCAAAAGAGAAAGAAGGAAGG - Intergenic
1138690881 16:58767510-58767532 AAAAAAAAGAAAAAGCAAGAGGG + Intergenic
1138927621 16:61611726-61611748 ATGAAAAAAAATAAGCATGAGGG + Intergenic
1138961112 16:62030968-62030990 ATATGAAAGAAAAAGAAGGAGGG + Intronic
1139082743 16:63544205-63544227 AGGACAAAGAAAAAGAAGGAGGG + Intergenic
1139100027 16:63754500-63754522 ATGGGAAAGAGCAAGCAGGAGGG - Intergenic
1139254257 16:65526134-65526156 AGGCAAAAGAAAAAGGAAAAAGG + Intergenic
1140097835 16:71890756-71890778 AAAAAAAAAAAAAAGCAGGAAGG - Intronic
1140168235 16:72576779-72576801 ATGATAAAGTATAAGCAGGAAGG + Intergenic
1140554848 16:75910010-75910032 CTGCAAAAGAAACAGCAGGCTGG + Intergenic
1140594599 16:76393983-76394005 ATCCAAAGGAAAAACCAGCAGGG - Intronic
1140611409 16:76603281-76603303 AGGCTTAAGAAAAAGCATGATGG - Intronic
1140694377 16:77517828-77517850 ATGCTTAAGAAAGATCAGGAAGG - Intergenic
1140695365 16:77527278-77527300 ATGGAAAACAAAAAAAAGGAGGG + Intergenic
1140903589 16:79392214-79392236 AAGAAAAAGAGAAAGAAGGAGGG + Intergenic
1140990886 16:80210329-80210351 ATGCAAAAAAAAAAGTAGGCTGG + Intergenic
1141083211 16:81071811-81071833 ATGAGAAAAAAAATGCAGGAAGG + Intronic
1141389263 16:83650774-83650796 TTCGAAAAGAAAAAGCAGGGTGG + Intronic
1142668497 17:1475968-1475990 ATGCATAGAAAAAGGCAGGAGGG + Intronic
1142923299 17:3210141-3210163 ATGGAAAAGAAAAAAGAAGACGG - Intergenic
1143071626 17:4300079-4300101 ATCAAAAAAAAAAAGCAGGTAGG - Intronic
1143185149 17:5005626-5005648 TTGCAGAAGAGAAAGCAGTAAGG + Intronic
1143563052 17:7706358-7706380 ATGCAAAAGGGAAGGAAGGAGGG - Intronic
1143936393 17:10489764-10489786 AGGAAAAAGAAAAAGCATAAAGG - Intergenic
1144015427 17:11190773-11190795 ATCCAAAAGAAAATGGGGGAAGG + Intergenic
1144315973 17:14061965-14061987 AGAAAAAGGAAAAAGCAGGAGGG - Intergenic
1144394697 17:14832845-14832867 CTTTAAAAGAAAAAGCAGGCCGG - Intergenic
1144681171 17:17195878-17195900 ATGCAAAAGAAAATGAAGTTGGG + Intronic
1144741624 17:17586176-17586198 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1144994192 17:19255922-19255944 ATAAAAAATAAAAAACAGGAGGG - Intronic
1145049191 17:19646555-19646577 ATGAAAAAGAAAAAACAGGCCGG - Intergenic
1145091964 17:19993520-19993542 AAGAAAAAGAAAAGGAAGGAAGG - Intergenic
1145289279 17:21530471-21530493 GAGCAACAGGAAAAGCAGGAGGG - Exonic
1145735007 17:27222755-27222777 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
1146009569 17:29182455-29182477 ATGCAAAAAAAAAAAAAGGGGGG + Intergenic
1146455448 17:33005969-33005991 AAGAAAAAGAAAAAGAAAGAAGG - Intergenic
1146513415 17:33470012-33470034 ATGCATAATACAAAGCAGAATGG + Intronic
1146623507 17:34418786-34418808 TTGCCACAGAAAAAGCAGAAAGG - Intergenic
1146896029 17:36543010-36543032 AAACAAAACAAAAACCAGGACGG - Intronic
1147163233 17:38579676-38579698 AAGCAAAAGAAAGAGAAGGCCGG + Intronic
1147438060 17:40430116-40430138 ATGCTAAAGAAAGAGAAGGAAGG + Intergenic
1147534479 17:41310212-41310234 AAGAAAAAGAAAAAAAAGGAAGG + Intergenic
1147674936 17:42198635-42198657 ATGCAAAAGAACATGCAGGAAGG - Intergenic
1147783478 17:42960860-42960882 ATGCTAATGAAAGACCAGGAGGG + Intronic
1147884629 17:43676365-43676387 GGGCAGAAGAAAGAGCAGGAGGG + Intergenic
1148209058 17:45797255-45797277 AAGAAAAAGAAAAAACAGCATGG - Intronic
1148276947 17:46312711-46312733 ATGCCAAAAAAAAATCACGAAGG + Intronic
1148363600 17:47034822-47034844 ATGCCAAAAAAAAATCACGAAGG + Intronic
1149326966 17:55541642-55541664 ATACAAAACAAACAGCAAGATGG - Intergenic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1149702805 17:58669358-58669380 AAACAAAAAAAAAAACAGGAGGG + Intronic
1149900018 17:60467263-60467285 ATTTAAAAGAAAAACAAGGATGG + Intronic
1150027341 17:61690552-61690574 ATACAAAAGAAAAATGAGAAAGG + Intronic
1150092352 17:62338844-62338866 AGGCAAAAGAACAAGAGGGAAGG + Intergenic
1150466881 17:65401066-65401088 ATAAAAAAGGAAAAGCACGAAGG - Intergenic
1150690589 17:67363752-67363774 ATGGAAAATAAAAAGCAGCTGGG + Intronic
1151116990 17:71747553-71747575 ATGAAAAAGAGAAAGGAAGAAGG + Intergenic
1151158549 17:72145077-72145099 ATGAAAAAGGAAAGGCAGAAGGG - Intergenic
1151228255 17:72662684-72662706 AAGAAAAAGAAAAGGAAGGAGGG + Intronic
1151231085 17:72685610-72685632 AAGCCAAAGAAAAAGTATGAGGG - Intronic
1151275419 17:73030456-73030478 AAGGAAAAAAGAAAGCAGGAAGG + Intronic
1151379845 17:73718137-73718159 GTGAAAAAGTAAAAGCAAGATGG - Intergenic
1151423080 17:74011403-74011425 ATGCAAAAGAAAACAGAGGCCGG + Intergenic
1151429840 17:74055060-74055082 ATCCAAAAAAAAAAGAAAGAGGG - Intergenic
1151651480 17:75472783-75472805 GTGCTAAAGTCAAAGCAGGAAGG - Intronic
1151764131 17:76123366-76123388 CTGAAAAAGAAAAAGAAGGAAGG - Intergenic
1151772424 17:76172988-76173010 ATAAAAAAGAAAAAGAAGGCTGG + Intronic
1151843501 17:76634559-76634581 TTGGAAAAGAAAAAGCAGAATGG - Intronic
1151918394 17:77135862-77135884 ATAGAAAAGAAAGAGAAGGAAGG - Intronic
1151927798 17:77211551-77211573 AAGCTAAAGAAAGAGCAGGCAGG - Intronic
1152008478 17:77696724-77696746 ATGGACAGGAAAAAGCAGGGGGG + Intergenic
1152025965 17:77809436-77809458 ATTCAAAAGAAAAAATAGGGGGG + Intergenic
1152239394 17:79153619-79153641 AGGAAAAAGAAAAAGCCGGATGG - Intronic
1153215029 18:2811543-2811565 ATGGAAAACAAAAAGTAAGATGG + Intergenic
1153444753 18:5158513-5158535 ATGCAAAGGGAAGAGGAGGAGGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153467151 18:5400567-5400589 GTGATAAAGAAAATGCAGGAAGG - Intronic
1154326119 18:13391749-13391771 TTGCAAAAGACAAAACTGGAAGG - Intronic
1154955087 18:21245649-21245671 CTGCAAAATCAAAAACAGGAAGG - Intronic
1155176549 18:23306219-23306241 ATGCAAAAAAAAAAAGAAGAAGG + Intronic
1155240997 18:23863449-23863471 AAACAAAACAAAAAGGAGGAGGG + Intronic
1155294490 18:24372563-24372585 GTGAAAAGGAGAAAGCAGGAAGG - Intronic
1155579750 18:27289793-27289815 ATGTAAAATATAATGCAGGACGG - Intergenic
1155707299 18:28832087-28832109 AAGCAAAAAAGAAAGGAGGAGGG + Intergenic
1155761730 18:29576430-29576452 GTGGAAAAGGAAAAGCAGAATGG - Intergenic
1155865227 18:30956546-30956568 AAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1156134265 18:34017771-34017793 ACGCAGAAGAAAAATCAGAAGGG - Intronic
1156177341 18:34562505-34562527 ATGGTAAAGAAAAAAAAGGAAGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156441674 18:37195741-37195763 GAGCAAAACAAAAAGCTGGAGGG - Intronic
1156477770 18:37417000-37417022 AAGGAAAGGAGAAAGCAGGAAGG + Intronic
1156493825 18:37512744-37512766 AAGAAAAAGAGAAAGCAGGAGGG - Intronic
1156753741 18:40494699-40494721 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1156996090 18:43468619-43468641 TTGCAAAAGAAAATCCAAGAGGG + Intergenic
1157466101 18:47946932-47946954 AAAAAAAAAAAAAAGCAGGAGGG + Intergenic
1157522337 18:48353895-48353917 CTGCAATGGAAAATGCAGGATGG - Intronic
1157791388 18:50534467-50534489 AGACAAAAAAAAAAGAAGGAAGG - Intergenic
1157829741 18:50846273-50846295 GAGAAAAAGAAAAAGAAGGAAGG - Intergenic
1158057512 18:53299289-53299311 ATGCAAAAGAGAGAGAAGGCTGG - Intronic
1158174553 18:54639765-54639787 CTGCAAAAGAAAGATTAGGAAGG + Intergenic
1158191766 18:54837435-54837457 ATACAAAAGGAAAGGCAGGTTGG + Intronic
1158377086 18:56883217-56883239 AAAAAAAAAAAAAAGCAGGAAGG + Intronic
1158490269 18:57903563-57903585 ATGCAAAATAAAAAGTCTGAAGG - Intergenic
1158638387 18:59181204-59181226 ATGCAAAAGAAGAAGAGCGAAGG + Intergenic
1158826061 18:61221033-61221055 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
1158866887 18:61646525-61646547 AGGCAGAAGAAACAGCAGGAGGG + Intergenic
1159034686 18:63265229-63265251 AAGCAAAAGAAAGAGAAGAAAGG + Intronic
1159039631 18:63311662-63311684 AGGCAAAACAAGAAGCAGAATGG + Intronic
1159128917 18:64257585-64257607 ATTAAAAAAAAAAAGCAGGCCGG - Intergenic
1159744220 18:72211211-72211233 AGGCAAGAGGAGAAGCAGGAAGG + Intergenic
1159847827 18:73486994-73487016 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1159854796 18:73572934-73572956 ATGCAAAAGGAAGAGCTCGAGGG + Intergenic
1160038927 18:75326745-75326767 ATGCAAAGCAAGCAGCAGGAAGG + Intergenic
1160239687 18:77114148-77114170 AGGCAGAAGAAAACGAAGGATGG - Intronic
1160602841 18:80027327-80027349 AAACAAAAAAACAAGCAGGAGGG + Intronic
1160674569 19:382881-382903 TTGCAAAAGAAAACGGAGGGAGG + Intergenic
1160896460 19:1404652-1404674 AAGAAAAAGAAAAAAAAGGAAGG - Intergenic
1161173716 19:2827070-2827092 ATACCCAACAAAAAGCAGGATGG - Intronic
1161277715 19:3428188-3428210 AAAGAAAAGAAAAAGAAGGAAGG + Intronic
1161295593 19:3518656-3518678 CTGCCAAAGTAAAAGCAAGATGG - Intronic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162088095 19:8260647-8260669 ATGATAAAGAACCAGCAGGAAGG + Intronic
1162204607 19:9046451-9046473 AAGAAAAAAAAAAAACAGGAAGG - Intergenic
1162251600 19:9448853-9448875 ATGCAAAACAAAAAAGAGCACGG + Intergenic
1162670519 19:12253672-12253694 AGGCAGAAAAAAAAACAGGAAGG + Intronic
1163137262 19:15321272-15321294 AAGAAAAAGAGAAAGAAGGAAGG + Intronic
1163170007 19:15524840-15524862 AAGAAAAAGAAAAAGAAAGAGGG + Intronic
1163374021 19:16919293-16919315 ATTCAAGAGAGAAAGCGGGAAGG - Intronic
1164624270 19:29715765-29715787 TTGCAAAAGGAGAAGCAGGTTGG + Intronic
1164802346 19:31088139-31088161 AAGAAAAAGAGAAAGAAGGAAGG + Intergenic
1164910488 19:32007220-32007242 ATGCAAAAGAAAATGAAAGCCGG - Intergenic
1165724107 19:38100692-38100714 CTGCAAAAGCAAAATCTGGAGGG - Intronic
1166306981 19:41940677-41940699 AAGGAAAAGAGAAAGCGGGAGGG + Intergenic
1166432690 19:42740585-42740607 AGACAAAAGGAAAAACAGGAGGG - Intronic
1166435798 19:42765782-42765804 AGACAAAAGGAAAAACAGGAGGG - Intronic
1166485096 19:43205737-43205759 AGACAAAAGGAAAAACAGGAGGG - Exonic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167049782 19:47071331-47071353 ATGCAAAAGGAAAAAAAGGCAGG + Intronic
1167431943 19:49460213-49460235 AAACAAAAGAAAAAGAATGAGGG - Intronic
1167774677 19:51547092-51547114 TAGCAGCAGAAAAAGCAGGAAGG - Intergenic
1167845913 19:52164018-52164040 AAGGAAAAGAAAAAGAAGGAAGG + Intronic
1168011159 19:53534286-53534308 ATCAAAAAAAAAAAGTAGGATGG - Intronic
1168240720 19:55087567-55087589 AAGCAAAAGAAGAAGGTGGAAGG + Exonic
925378645 2:3407810-3407832 AAGAAAAAGAAAATGGAGGAGGG + Intronic
925486833 2:4344191-4344213 GAGAAAAAGAAAAAGCATGAAGG - Intergenic
925847929 2:8050662-8050684 AGGGAAAAGAAAATGCAGGCAGG + Intergenic
926028205 2:9563069-9563091 ATGCAAGATAAAATGAAGGACGG - Intergenic
926279026 2:11429987-11430009 ATACAACAGAAAATGTAGGAAGG - Intergenic
926429307 2:12769595-12769617 AGGCAAGAAAAAAAGGAGGAAGG + Intergenic
926605399 2:14893321-14893343 AAGCAAAACAATAAGCAGAAAGG - Intergenic
926692547 2:15747664-15747686 AAGCCAAAGACAGAGCAGGAGGG - Intergenic
926737157 2:16082324-16082346 AGGCAAAGGAAAGAGCTGGAAGG + Intergenic
926828785 2:16937170-16937192 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927358390 2:22202576-22202598 CTGAAAAAAAAAAAGCAAGAAGG + Intergenic
927617260 2:24611738-24611760 ATGAAAAATAAAAAGGAGCAGGG - Intronic
927645051 2:24872304-24872326 AAACAAAACAAAGAGCAGGAAGG + Intronic
927804677 2:26136258-26136280 TTAAAAAAGGAAAAGCAGGAAGG + Exonic
928978747 2:37116913-37116935 ATTCAAAAGAAAAAGTGGGCAGG + Intronic
929336748 2:40756931-40756953 ATGCAAAAGAAAAATAATGCTGG - Intergenic
929341552 2:40825008-40825030 AAGGAAAAGAAACAGGAGGATGG + Intergenic
929792063 2:45030714-45030736 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
930099717 2:47593863-47593885 CTGCAAAAGAAAAACCAGCAAGG + Intergenic
930634061 2:53786008-53786030 AACCAAATCAAAAAGCAGGAAGG - Intronic
930907246 2:56586212-56586234 TTGCAAAAGAAAAAGGAAGTTGG + Intergenic
931080707 2:58766903-58766925 TTAGAAAAGAAAAAGAAGGAGGG - Intergenic
931156423 2:59636547-59636569 AAACAAAACAAAAAACAGGAAGG - Intergenic
931187402 2:59966822-59966844 ATGTAAAAGAAAAGACAGGGAGG + Intergenic
931255383 2:60567655-60567677 ATGCAAAAGGAAAAAGAGGAGGG + Intergenic
931360241 2:61571809-61571831 CTTCAAAAGACAAAGCAGGCCGG + Intergenic
931367209 2:61629277-61629299 AAGAAAAAGAAAAGGAAGGAGGG - Intergenic
932228875 2:70065847-70065869 AAGAAAAAGAAAAGGAAGGAAGG + Intergenic
932235399 2:70116715-70116737 ATGCAATTGAAATAGCAGTAAGG - Intergenic
932415900 2:71573795-71573817 AAGAAAAAGAAAAATCAGGAGGG - Intronic
932600081 2:73117879-73117901 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
932969398 2:76521629-76521651 ATCCAAATGAAATAGCAGGTGGG + Intergenic
933333880 2:80929410-80929432 AAGCTAAAGAAAAAGAAGGATGG + Intergenic
933405001 2:81846749-81846771 ATGAAAAGGAAAAAGGAGAATGG - Intergenic
933492595 2:83007333-83007355 ATAAAAAAGAAAAATCAGTAAGG - Intergenic
934176838 2:89584497-89584519 AGGCAAAAGCTAATGCAGGAAGG + Intergenic
934287145 2:91658857-91658879 AGGCAAAAGCTAATGCAGGAAGG + Intergenic
934537153 2:95144278-95144300 ATGCTAATGAGATAGCAGGATGG + Intronic
934911571 2:98261059-98261081 ATGCAAAACAAATAGCACAATGG - Intronic
935109312 2:100077320-100077342 AAGCAAAAGAAGGAGCAGGAAGG + Intronic
935469082 2:103435047-103435069 ATGCAACAGAGAAAGAAGGTAGG + Intergenic
935579421 2:104743911-104743933 AAGGAAAAGAAATTGCAGGAAGG + Intergenic
935634281 2:105237937-105237959 ATGAGAGAGAAAAAGAAGGAAGG + Intergenic
935750007 2:106223575-106223597 AAGCAAGAGAAAGAGGAGGAGGG + Intergenic
935977492 2:108593305-108593327 AAGCAAAAGAAAGAGAAGAATGG - Intronic
936122493 2:109758923-109758945 AGGGAAAAGAGCAAGCAGGAGGG + Intergenic
936222200 2:110612549-110612571 AGGGAAAAGAGCAAGCAGGAGGG - Intergenic
936368981 2:111886862-111886884 TTGCAAAAGCAAATGAAGGAGGG + Intergenic
936396112 2:112131961-112131983 AAGAAAAAGAAAAGGAAGGAAGG + Intergenic
936626586 2:114155478-114155500 AGGCAAAAGAAAGAGAAAGAAGG - Intergenic
936807983 2:116360185-116360207 ATGGAAAACAAAAAGAAGCAGGG + Intergenic
936846784 2:116844233-116844255 AAGAAAAAGAAAAAGAAAGAGGG - Intergenic
937447631 2:121972219-121972241 ATTAAAAAAAAAAAGCAGGCAGG + Intergenic
937787239 2:125916036-125916058 ATTCAAAAGAAAAAAAAGAAAGG - Intergenic
938780397 2:134579564-134579586 AGGAAAAAGAAAAAAAAGGATGG - Intronic
939097709 2:137853649-137853671 ATGCAGATGAAAGTGCAGGAAGG + Intergenic
939098008 2:137858009-137858031 ACGCAGATGAAAATGCAGGAGGG - Intergenic
939098289 2:137862875-137862897 ATGCAAAAGAAAGAGGAGGGAGG + Intergenic
939115655 2:138057366-138057388 AGGAAAAAGAAAGAGAAGGAAGG - Intergenic
939203890 2:139074785-139074807 ATGAAAAAGAAAAAGAAGCAGGG - Intergenic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939745692 2:145964105-145964127 AGGCAAAAAAAAAAGGAGGGGGG - Intergenic
940699003 2:157018220-157018242 ATGGAAAACAAACAGCAAGATGG - Intergenic
940761903 2:157748030-157748052 AAGAAAAAGAAAAAAAAGGAAGG - Intronic
940939241 2:159538820-159538842 ATACAAAAGAAAAGGGATGAGGG + Intronic
940951647 2:159682156-159682178 AAGCAAAGAAAACAGCAGGAGGG - Intergenic
941167728 2:162101366-162101388 AGGTAGAAGAAAAGGCAGGAAGG + Intergenic
941337338 2:164262103-164262125 CAGCAACAGAAAAAGCTGGATGG + Intergenic
941515318 2:166466680-166466702 GTGAAAAAGAAAAGGGAGGAGGG - Intronic
941698975 2:168583461-168583483 AAGCAAATGAAAAAGAAGCAAGG - Intronic
942964741 2:181877955-181877977 ATGCACAATAAAAGGAAGGATGG - Intergenic
943587106 2:189754140-189754162 ATGAAAAAGGAAAAAGAGGAAGG - Exonic
943662554 2:190574832-190574854 AAAGAAAAGAAAAAGAAGGAAGG - Intergenic
943916781 2:193644910-193644932 ATGGAAAACAAAAAGAGGGATGG + Intergenic
943994414 2:194741383-194741405 AAACAAAAGAAAAGGCGGGATGG + Intergenic
944617760 2:201480218-201480240 ATACAGAAGAAAAAGCAGCAAGG - Exonic
944678482 2:202054294-202054316 AGGGAAAAGAGAAAGAAGGAAGG + Intergenic
945053199 2:205845003-205845025 AAGCAGAAGAAAAAGAAAGAAGG + Intergenic
945194181 2:207223022-207223044 AAGCAAAAGACAAAGAGGGAGGG + Intergenic
945195249 2:207231504-207231526 AAGAAAAAGAAAAAAAAGGAGGG + Intergenic
945230859 2:207588197-207588219 ATACAAAAGTAAACTCAGGAGGG - Intronic
945925768 2:215802438-215802460 TTGAAAAAGACAAAGTAGGAGGG + Intergenic
945956288 2:216089125-216089147 GAGCAAAAGAAACAGAAGGAAGG + Intronic
946208169 2:218125880-218125902 ATTCAACAGAAACAGAAGGAGGG + Intronic
946456618 2:219831845-219831867 ATCCAAAAAGAAATGCAGGAGGG - Intergenic
946718453 2:222578541-222578563 ATGTAAAAGAAAAAGGAGGCCGG + Intronic
946756332 2:222951532-222951554 AAAGCAAAGAAAAAGCAGGAAGG - Intergenic
946860684 2:223997772-223997794 AGGCAGATGCAAAAGCAGGAAGG + Intronic
946953697 2:224905684-224905706 ATGCCAAAGAAGAATCAAGATGG - Intronic
947886030 2:233572481-233572503 AAGCAAGAGAAAAAGAAGGGAGG - Intergenic
947889913 2:233608290-233608312 AAGCAAGAGAAAAAGGAGGCAGG + Intergenic
947895342 2:233666145-233666167 AAGCAAGAGAAAAAGGAGGCAGG + Intronic
948356864 2:237384983-237385005 AGGCAGAAGGAAGAGCAGGAGGG - Intronic
948514227 2:238493447-238493469 AAGAAAAAGAAAAAGAAGAAGGG - Intergenic
1169040469 20:2490324-2490346 AGAGAAAAGAAAAAGAAGGAAGG + Intronic
1169419802 20:5450842-5450864 ATTAAAAAGAAAAAGAAGGCCGG + Intergenic
1169898326 20:10527889-10527911 TCCCAAATGAAAAAGCAGGATGG - Intronic
1170075013 20:12409929-12409951 ATACAGAAGAGAAAGCAGGAAGG - Intergenic
1170106897 20:12761249-12761271 ATGCAAAAGAGAAATCACAATGG - Intergenic
1170129644 20:13005342-13005364 ATGGATAAGTAAAACCAGGAAGG + Intergenic
1170582330 20:17708674-17708696 TTGCAAATGAAAAAGCCAGAGGG - Intronic
1170591047 20:17772092-17772114 AAGAAAGAGAAAAAGAAGGAAGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171103044 20:22404182-22404204 ATGCAGAAGAAAGCGCTGGAAGG - Intergenic
1171178743 20:23075575-23075597 ATGGAAAAGAAAAAGAAGGCCGG + Intergenic
1171770880 20:29321957-29321979 ATTCAAAAGCAAAAGTAGCAGGG - Intergenic
1171905659 20:30897610-30897632 ATTCAAAAGCAAAAGTAGCAGGG + Intergenic
1172042110 20:32052811-32052833 TTAAAAAAGAAAAAGAAGGAAGG + Intronic
1172410902 20:34722082-34722104 AAGCAAAAGAAAAAGCCGGCTGG + Intronic
1172542947 20:35736152-35736174 AATCAAAAGAAAACCCAGGAAGG - Intronic
1172858827 20:38031144-38031166 GTGCAAAGGTAGAAGCAGGAAGG - Intronic
1173018939 20:39251024-39251046 AGAAAAAAAAAAAAGCAGGATGG - Intergenic
1173097012 20:40043582-40043604 AAGCAAAAAAAAAATCAGAAAGG - Intergenic
1173178883 20:40786614-40786636 ATGCAGAAGAGGCAGCAGGATGG - Intergenic
1173446958 20:43127767-43127789 TTGCAAAAAGAAAAGTAGGAGGG + Intronic
1173728975 20:45315921-45315943 AAGAAAAAGAAAAGGAAGGAAGG + Intronic
1173847952 20:46199937-46199959 ACAAAAAAGAAAAAGAAGGAAGG - Intronic
1173931707 20:46826354-46826376 AAGCAGAAGAACAAACAGGAGGG + Intergenic
1174240593 20:49131544-49131566 TGGAAAAAGAAAAAGCAGGCTGG + Intronic
1174530930 20:51213436-51213458 AGGCAAAAGAAAAAGAAAAAAGG + Intergenic
1174581657 20:51576545-51576567 AGGAAAGAGAAAAAGAAGGAAGG - Intergenic
1174619200 20:51861291-51861313 ATGCAAAATAAACTTCAGGAAGG - Intergenic
1174696898 20:52568971-52568993 AGACAAAAGAAAAGGAAGGAAGG - Intergenic
1174755127 20:53150716-53150738 GAGGAAAAGAAAAAGAAGGAGGG + Intronic
1174887192 20:54348820-54348842 AAGTTGAAGAAAAAGCAGGAAGG + Intergenic
1175385917 20:58594994-58595016 AAGAAAAAGAAAAAAAAGGAAGG + Intergenic
1175463152 20:59170096-59170118 AAGAAAAAGAAAAAGAGGGAGGG - Intergenic
1176014054 20:62919545-62919567 AAGAAAAAAAAAAAGCAGCAAGG + Intronic
1176713226 21:10326472-10326494 TTGAAAAAGAAAAAACAGAATGG - Intergenic
1177236283 21:18393036-18393058 ATAAAAGAGAGAAAGCAGGATGG + Intronic
1177267887 21:18808215-18808237 AAGCAAAAAAAAGAGCAGGTAGG + Intergenic
1177778293 21:25594581-25594603 ATGTAAAATAACAAGCAGTAAGG - Intronic
1177948195 21:27500145-27500167 ATGCAAAAGAAAAACAAGTTTGG - Intergenic
1178181568 21:30167966-30167988 ATGTAAAAGAAAAAGGAAAAGGG - Intergenic
1178198328 21:30374355-30374377 AAGAAAAAGAAAAAGAAAGAGGG - Intronic
1178326422 21:31649219-31649241 ATGGAAAACAAATAGCAGGTTGG + Intergenic
1178385576 21:32146532-32146554 AGGCAAAAAAAAAAAAAGGAAGG + Intergenic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178548963 21:33519061-33519083 ATGGAAAAGAAACAGAAAGAAGG - Intronic
1178663603 21:34527194-34527216 TTACAAAAGAAAAAGGATGAAGG + Intronic
1178921300 21:36740529-36740551 GTGCAAAAGAAAATGCTGCACGG - Intronic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1180316269 22:11279776-11279798 ATTCAAAAGCAAAAGTAGCAGGG - Intergenic
1180660640 22:17463929-17463951 ATGGAAAAGAAATAGCAGTGCGG + Intronic
1180829610 22:18897055-18897077 TTAAAAAAGAAAAAGCAGAATGG - Intergenic
1180924302 22:19543297-19543319 CTGCAAAAGAAAAAGAAGTTTGG - Intergenic
1181389236 22:22567631-22567653 AAGAAAAAGAAAAAGAAGGTGGG - Intergenic
1181469662 22:23130157-23130179 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
1181525547 22:23483272-23483294 AAGGCAAAGAAAGAGCAGGAAGG + Intergenic
1181716985 22:24738158-24738180 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1181720228 22:24768582-24768604 AAGGAAAACAAGAAGCAGGAAGG + Intronic
1182186567 22:28409643-28409665 AAGAAAAAGAAAAAGCACAAAGG - Intronic
1182466783 22:30521859-30521881 AAGGAAAAGAAAAAGAAGGAAGG - Intergenic
1182637411 22:31739514-31739536 ATGCAGGATAAAAATCAGGAAGG - Intronic
1182715094 22:32351935-32351957 AAGCAGAAGAAAAACCAGGCTGG + Intergenic
1182834823 22:33333340-33333362 ATGAAAAAGACAAAACTGGAGGG - Intronic
1183504283 22:38200535-38200557 AAGAAAAAGAAAAAGAAGCAAGG + Intronic
1184441053 22:44515943-44515965 AGGCAGAAGAAAAAGAAGTAGGG - Intergenic
1184682283 22:46078809-46078831 ATGCCAGAGACAAAGCAGGTAGG - Intronic
1184837072 22:47030038-47030060 ATGCAAATGAGAAAGGAGGTGGG + Intronic
1184882106 22:47314100-47314122 ATACAAAACAAATAGCAGGGTGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185136674 22:49077381-49077403 ATGCCCAAGAAGCAGCAGGAAGG - Intergenic
1203279701 22_KI270734v1_random:122327-122349 TTAAAAAAGAAAAAGCAGAATGG - Intergenic
949090852 3:27199-27221 AAGCAAAAGAGAAAGAAGTACGG - Intergenic
949228897 3:1727241-1727263 AGAAAAAAGCAAAAGCAGGAAGG + Intergenic
949312006 3:2710326-2710348 AGGCAAAGGAAAAAGCAGTCAGG + Intronic
949716799 3:6941404-6941426 ATTCAAAACAATCAGCAGGAAGG + Intronic
949724503 3:7027781-7027803 AAGAAAAAGAAAAAGAACGATGG - Intronic
949748236 3:7320599-7320621 AGGAAACAGAAGAAGCAGGAAGG - Intronic
949855621 3:8458447-8458469 CTGCCAAAGAAAAACCAGGCAGG - Intergenic
950299660 3:11865803-11865825 ATGGAAAACAAAAAGAAGGAGGG - Intergenic
950568080 3:13783213-13783235 ATTCAACAGAAACAGCAGGCTGG - Intergenic
950796809 3:15516824-15516846 ATACTGAGGAAAAAGCAGGAGGG + Intronic
950956883 3:17063307-17063329 ATCCTAAAAAAAAAGAAGGAAGG - Intronic
951841209 3:27036108-27036130 AAAGAAAAGAAAAAGAAGGAAGG + Intergenic
951873875 3:27398363-27398385 AGGAGAAAGAAAAAGCAGAATGG + Intronic
952167127 3:30762699-30762721 ATCCAAAATAAAAAGAATGAAGG - Intronic
952177850 3:30886306-30886328 ATCCAAAAGAAGAAGCAATATGG + Intronic
952182485 3:30932811-30932833 ATGAAAAATAAAATGCAGAAAGG - Intergenic
952330156 3:32357308-32357330 AAGATAAAGAAAAAGAAGGAAGG - Intronic
952513793 3:34083534-34083556 ATGGAAAACAAAAAGAAGCAGGG - Intergenic
952515160 3:34096379-34096401 ATGGAAAACAAAAAGAAGCAGGG + Intergenic
952764162 3:36940815-36940837 TTGAAAAACAAAAAGCAAGAAGG + Intronic
953050675 3:39339853-39339875 ATAGAAAACAAAAAGCAAGATGG + Intergenic
953403542 3:42648110-42648132 AAGCATGAGAAAGAGCAGGAAGG - Exonic
953495830 3:43386324-43386346 AAGCAAAAGAGAAAGCAAGAAGG + Intronic
954488645 3:50879447-50879469 ATGGAAAACAAAAAAAAGGAAGG + Intronic
954821005 3:53327491-53327513 ATTAAAAAGAAAAAGCTGGCCGG + Intronic
954871491 3:53770748-53770770 AAACAGAAGAGAAAGCAGGAAGG + Intronic
955469901 3:59275442-59275464 TTGCAAAAGAAAATTCAGAATGG + Intergenic
955556515 3:60143472-60143494 ATGAAAAACACAAAGCAGTATGG + Intronic
955731873 3:61995763-61995785 AAGAAAAAGAAAAAGAAGGAGGG - Intronic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
956274634 3:67484740-67484762 ATGAAAAAGAAAAAGGAGATAGG + Intronic
956768155 3:72501967-72501989 ATGGACAAGAAAAAGCAGGCTGG + Intergenic
956774024 3:72550130-72550152 AAGCAAAAGTGAAAGCAGGAAGG - Intergenic
956923257 3:73953463-73953485 ATGGAAAAGTAAAAGCAGAAGGG + Intergenic
956960387 3:74392399-74392421 AAGAAAAAGAAGAAGCAGGGTGG - Intronic
957031177 3:75243411-75243433 AAGCAAAAGAGAAAGAAGTACGG - Intergenic
957357961 3:79116306-79116328 AAGAAAAAGAAAAGGAAGGAAGG - Intronic
957777668 3:84775110-84775132 ATACAAAAAAAAAATCAGCATGG + Intergenic
957879008 3:86185778-86185800 ATGGAAAACAAAAAAGAGGAGGG + Intergenic
957900485 3:86482532-86482554 ATGAAGAAGAGAAAGCATGAAGG - Intergenic
958689902 3:97451003-97451025 ATGGAACAGAAAAAGCATAAAGG + Intronic
958752194 3:98204566-98204588 ATGCAAAGAGAGAAGCAGGAAGG - Intergenic
958858596 3:99417856-99417878 ATACAAAAAAAATAGCATGAAGG + Intergenic
959391384 3:105779043-105779065 ATACAAAAGAAAAATCAAAATGG + Intronic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
959783560 3:110265917-110265939 ATGTAAAGGAAAAAACAGAATGG - Intergenic
959840440 3:110968815-110968837 TTGTAAATCAAAAAGCAGGAAGG - Intergenic
960145776 3:114200520-114200542 AAGAAAAAGAAAAAACATGAAGG - Intergenic
960195861 3:114767493-114767515 ATTGAAAAGAAAAAGGAAGAAGG + Intronic
960246784 3:115408522-115408544 ATGGAAAAAAGAAAGAAGGATGG + Intergenic
960360503 3:116705489-116705511 ATACAAAAGAAAACAGAGGAGGG + Intronic
960376072 3:116903151-116903173 ATGCAAGAGAAAAAGAAGAGAGG - Intronic
960493146 3:118342092-118342114 CTGCAAGAGACAAAGCAGGGTGG - Intergenic
960902352 3:122565110-122565132 ATTCATAAAAAAAGGCAGGAAGG - Intronic
961395885 3:126589790-126589812 ATGGAAAACAAAAAGAAGCAGGG - Intronic
961663887 3:128484693-128484715 ATGCAAAACAAACAGGAGAAAGG + Intronic
962180851 3:133205124-133205146 AAGAAAAAAAAAAAGCAGCAGGG - Intronic
962440776 3:135413968-135413990 AAGAAAGAGAAAAAGGAGGAGGG + Intergenic
962748618 3:138416691-138416713 AAGTGAAAGAAAAAGGAGGAGGG - Intergenic
962808638 3:138944464-138944486 TTGAAAAACAAAAAGCAGGGAGG + Exonic
962843309 3:139254435-139254457 ATGCAAAGGATAAACCAGGGTGG - Intronic
962994077 3:140607562-140607584 ATGGAAAACAAAAAACAGCAGGG + Intergenic
963135072 3:141895484-141895506 ATGCTAAAGAAAAAAGAGGCGGG - Intronic
963249523 3:143090290-143090312 ATGGAAAAGAGAAAGAAAGAGGG - Intergenic
963251761 3:143110314-143110336 ATGCAACAGAAAAGGCAGGGGGG + Intergenic
963278695 3:143359387-143359409 GTGAAAAAAATAAAGCAGGAAGG + Intronic
963431286 3:145207685-145207707 ATGAAAAAGAAAAAGAAGGAGGG + Intergenic
963762273 3:149295784-149295806 ATGCACAAGGAGCAGCAGGAAGG - Intergenic
963810481 3:149771928-149771950 ATGCAGGAGAAAAAGCAGGTTGG - Intronic
964162794 3:153665537-153665559 ATGCAAAAGGTAAAACAAGAAGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964330173 3:155593461-155593483 TAGAAAGAGAAAAAGCAGGAAGG + Intronic
964364585 3:155935677-155935699 ATGCAAAAGATATAGCATCAAGG - Intronic
964763551 3:160157017-160157039 ATGAAAAAAAAAAAAAAGGAAGG + Intergenic
965507606 3:169533679-169533701 AGGAAAAAGAAAATGCAGGCTGG + Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966104021 3:176313340-176313362 ATAAAAAAGGAAAAGCATGAAGG - Intergenic
966140321 3:176749645-176749667 ATTCAAAAAGACAAGCAGGAAGG - Intergenic
966625464 3:182011311-182011333 ATGGAAGAGAAAGAACAGGAAGG + Intergenic
966830106 3:184000607-184000629 ATGGAAAAGAAAATGCAATATGG + Intronic
966867159 3:184264868-184264890 ATGCCAAAGAAGAGGCATGAGGG + Intronic
966956858 3:184889791-184889813 ATGAAAAAGAAAAGCCAGTATGG - Intronic
967147036 3:186615138-186615160 AGGGAAAAGAAAACGGAGGAAGG + Intronic
967313429 3:188128042-188128064 AAGCAAAACAAAAAGAAAGATGG + Intergenic
967627126 3:191699735-191699757 AAGGAAGAGAAAAAGGAGGAGGG + Intergenic
968323178 3:197789721-197789743 GAGCAAAAGAAAAATAAGGATGG - Intergenic
968931776 4:3583879-3583901 ATGAAGAATAAAAAGCGGGAAGG - Intronic
969381269 4:6799986-6800008 ATGCAAAACAAAAGCCAGCAAGG - Intronic
969407283 4:7001952-7001974 AGGCCCAAGAAAGAGCAGGAAGG - Intronic
970027996 4:11644376-11644398 ATGAAAAAGAAGAAGAAAGAAGG - Intergenic
970161711 4:13195749-13195771 AGGCTAGAGAGAAAGCAGGAAGG - Intergenic
970740613 4:19233363-19233385 AAGAAAAAGAAAAAGAAAGAGGG + Intergenic
970743360 4:19264729-19264751 ATGAAAAAAAGAAAGAAGGAAGG - Intergenic
970954839 4:21798253-21798275 ATGAGAAATAAAATGCAGGATGG + Intronic
971052812 4:22880199-22880221 ATGGAATAGAAAAAGCAAAATGG - Intergenic
971145328 4:23969986-23970008 AAGCAAAAGAGACAGCAAGATGG + Intergenic
971661028 4:29415888-29415910 AGGCAAAACCAAAAGCATGAGGG + Intergenic
971663966 4:29458071-29458093 AAGAAAAAGAAAAAGAAAGAAGG - Intergenic
971665511 4:29478587-29478609 ATGGGAAAGAAAAGGAAGGAAGG + Intergenic
972185337 4:36521213-36521235 AAGCAAAAGAGAAATCAGGGAGG - Intergenic
972263224 4:37432836-37432858 AAGCAAATGAAAAAGGAAGAGGG + Intronic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
973632468 4:52832551-52832573 ATGCTAAAGAAAAAGCAAGGAGG - Intergenic
973778144 4:54262542-54262564 CTGAAAAAGAAAAGGCAGAAAGG - Intronic
973894493 4:55397669-55397691 ATGGAAAGGAAAAAGGAGAAAGG - Intronic
973897923 4:55434714-55434736 AAACAAAAGGAAAAACAGGATGG + Exonic
973908590 4:55555811-55555833 ATTCCAAAGAAAAAGCATTATGG + Intergenic
974061307 4:57038450-57038472 AGGCAAAACAAAAAGCGGGGCGG - Intronic
974144098 4:57924568-57924590 ATGAAAAAGAAAAACCCAGAAGG - Intergenic
974643588 4:64665613-64665635 AACCACAAGAGAAAGCAGGAAGG + Intergenic
974688303 4:65261896-65261918 ATGTAAAAGAAACTGCAGCAAGG + Intergenic
974885506 4:67811968-67811990 ATGCAAAGCAAAAAGAAGCAGGG + Intergenic
974924305 4:68278329-68278351 AGGGAAAAGAGCAAGCAGGAGGG - Intergenic
974935645 4:68406906-68406928 AAGCAAAAACAAAAGCATGAGGG - Intergenic
974946382 4:68534261-68534283 ATGGAAAGCAAAAAGCAGCAGGG - Intergenic
975198802 4:71560207-71560229 AAGAAAAAGAAAAAGAAGAAGGG + Exonic
975349937 4:73333882-73333904 AGGCAAAAAAAAAAGTAGCAAGG - Intergenic
975558533 4:75688161-75688183 ATTAAAAAAAAAAAGAAGGAAGG - Intronic
975766389 4:77672934-77672956 ATGGCAAAGAAACAGCTGGAAGG - Intergenic
975768944 4:77699951-77699973 AGGGAAAGGAAAAAGCAGAAAGG - Intergenic
975783332 4:77862550-77862572 AAGAAAAAGAATAAGAAGGAAGG + Exonic
975796182 4:78008866-78008888 ATGCAAAGGAGAAAGCATAAAGG - Intergenic
975826607 4:78326420-78326442 ATAGAAAAGAAATAGCAGGTAGG + Intronic
975983166 4:80182207-80182229 ATGCAAAATTTAAAACAGGAAGG + Intergenic
976364481 4:84217872-84217894 ATGAAAAGGAAAAAACAGAAAGG - Intergenic
976965074 4:91027984-91028006 ATGGAAAAGAAAAAAGAAGAGGG + Intronic
976981178 4:91231797-91231819 ATACAAACGAAAAAGAAGGCAGG + Intronic
977061373 4:92260989-92261011 ATACAAAGGAAAAAGAAAGAAGG - Intergenic
977145859 4:93439391-93439413 ATGCAGAAGGAAAAGCAGATTGG + Intronic
977189747 4:93984875-93984897 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
977269189 4:94894143-94894165 ATGGAAAAGAAAATGCAGACTGG - Intronic
977432449 4:96947703-96947725 ATGTAAAAGAAAAAAGAGAAAGG + Intergenic
977748768 4:100583115-100583137 ATGCAAAAGATAAACCAAGAAGG - Intronic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
978437534 4:108701639-108701661 ATACTAAAGAAAAAGGAGGAAGG - Intergenic
978446807 4:108787899-108787921 ATGTGCAAGAAAAAGCGGGAAGG + Intergenic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
978978769 4:114915562-114915584 GTGTTAAAGAAAAATCAGGAAGG - Intronic
979244353 4:118482364-118482386 ATACAAAATAAACTGCAGGAGGG - Intergenic
979277590 4:118830927-118830949 ATGGAAAGGAGAAAGCAGGTAGG + Intronic
979633515 4:122930530-122930552 ATGAACAATAAAAAGCAGAAGGG + Intronic
979670719 4:123357546-123357568 AGGAAGAAGGAAAAGCAGGAGGG - Intergenic
979933005 4:126655791-126655813 ATACAAAAGAAAAATCAGCTGGG - Intergenic
980020663 4:127705997-127706019 ATGCAAAAGAAAAGGAATAAGGG - Intronic
980287679 4:130801957-130801979 TTCCAAAAGATAAAGGAGGAAGG - Intergenic
980603332 4:135055564-135055586 AAGAAAAAGAAAAAGAAGAAAGG - Intergenic
980775258 4:137428917-137428939 ATGTAAAAAAGAAGGCAGGAAGG - Intergenic
980873819 4:138640641-138640663 AAAAAAAAGAAAAATCAGGAGGG - Intergenic
981769357 4:148289771-148289793 AAGGAAAAGAAAAGGGAGGAAGG - Intronic
981956890 4:150486258-150486280 CTGCAAAAGAAAAAAAAGGGTGG + Intronic
982587556 4:157261682-157261704 AAGCAAAAGAAACATCACGAAGG - Intronic
982738036 4:159026596-159026618 ATGAAAAAAAAGAAGCAGTATGG - Intronic
982756994 4:159232834-159232856 ATGCAAATGAGATACCAGGATGG - Intronic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
983020250 4:162667817-162667839 ATGCAAAAGTATAAGAAGGCTGG + Intergenic
983258718 4:165432062-165432084 ATGCCAGAGAAAAAGAAGGTCGG + Intronic
983418259 4:167485094-167485116 ATGCAGAATAAAAAGCAAAATGG - Intergenic
983484408 4:168317416-168317438 ATGGAAAAGAGAAAAAAGGAGGG + Intronic
983485509 4:168327783-168327805 ATGGAAAAGAAAAAGCAGTTTGG + Intergenic
983535124 4:168849428-168849450 CTGCAGAAGAAAAAGGAGAAAGG + Intronic
983547936 4:168982236-168982258 ATGGAAAACAAAAAGGAGCAGGG + Intronic
983609085 4:169622817-169622839 ATGCTAGAGAAAAACAAGGAGGG + Intronic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983810399 4:172053397-172053419 ATCCAAAAGAAAAATCATTAAGG + Intronic
984139454 4:175985040-175985062 CTGAAAAAGAAAAAGAAGGTGGG - Intronic
984303147 4:177950180-177950202 ATGTAAAAAAAAAAAAAGGAAGG - Intronic
985009667 4:185569484-185569506 ATGAAAAAGAAAATTCAGAATGG - Intergenic
985749198 5:1664470-1664492 ACACAAAAGTAACAGCAGGAGGG + Intergenic
986461917 5:7981555-7981577 ATGCAAAATTAAAAGCTGAAGGG + Intergenic
986684112 5:10260654-10260676 AAGCAAAGGAAAGAGAAGGAAGG - Intronic
986826362 5:11527045-11527067 AGACAAAAGAAAAAGAAGGTGGG + Intronic
987069785 5:14325442-14325464 AAGCAAGAGAAAAAGGAGGGAGG + Intronic
987108820 5:14665477-14665499 TTTCAAAAGGAAAAGCGGGAAGG - Intronic
988203283 5:28097823-28097845 ATACAAAATAGGAAGCAGGATGG + Intergenic
988491142 5:31706547-31706569 ATTTAAAAGCAAAAGCAGGCCGG + Intronic
988550249 5:32194356-32194378 AACCATAAGAAAAAGCAGCAGGG + Intergenic
988653841 5:33184830-33184852 ATGAAAAAGAGAAAGCAGGAAGG - Intergenic
988806727 5:34747132-34747154 ATTCAAAGGAAAATGAAGGAGGG - Intronic
988914656 5:35880402-35880424 AAGAACAAGAAAAAGTAGGAAGG - Intergenic
989127940 5:38075045-38075067 ATGTGCAAGGAAAAGCAGGAAGG + Intergenic
989377675 5:40781809-40781831 ATGTATAAGAGAAAGAAGGAAGG + Intronic
989533923 5:42541628-42541650 ATTCAAAAGCAAAAGCAGGTAGG + Intronic
989566058 5:42902605-42902627 AAAGAAAAGAAAAAGAAGGAAGG + Intergenic
989706106 5:44332834-44332856 AAGAAAAAGAAACAGAAGGAGGG + Intronic
990330754 5:54723195-54723217 ATGCAAAAGGAAAGGAAGGAAGG + Intergenic
990589810 5:57250416-57250438 ATGCAAAATTAAAAGCATGAAGG - Intronic
990766988 5:59195015-59195037 ATGCAAAAGAGAAAACATGAGGG - Intronic
991074683 5:62521725-62521747 GAGGAAAAAAAAAAGCAGGAAGG - Intronic
991158588 5:63467938-63467960 ATGCAAATGCAAAAGCATTAAGG - Intergenic
991520306 5:67489945-67489967 GTAGAAAAGAAAAAGCAAGATGG + Intergenic
991550413 5:67829667-67829689 ATGTCAAAGAAAATTCAGGACGG - Intergenic
991726917 5:69545011-69545033 CTGCAAAGGGAAGAGCAGGAAGG + Exonic
991868040 5:71082863-71082885 CTGCAAAGGGAAGAGCAGGAAGG - Intergenic
992093925 5:73342886-73342908 CTCCAAAAAAAAAAACAGGAAGG + Intergenic
992376891 5:76197109-76197131 TTACAAAAGAAAAAGCAGGCAGG - Intronic
992540585 5:77760379-77760401 AAGGAAAGGAAAAAGGAGGAAGG - Intronic
992625493 5:78632924-78632946 AGGCAAAAGGAACAGCAAGACGG + Intronic
993199800 5:84800755-84800777 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
993547748 5:89233337-89233359 TTGCAAAAGAATAAACACGAAGG - Intergenic
993579799 5:89646158-89646180 ATGCAAAATAAAGTGAAGGAGGG - Intergenic
993782098 5:92079228-92079250 ATTAAAAATAAAAAGCAGAAAGG + Intergenic
993844389 5:92922460-92922482 ATGTTAAAGAAACAGTAGGAAGG + Intergenic
993914226 5:93722451-93722473 CTGCAAAATAAAAAGCTGAAAGG + Intronic
994232669 5:97325840-97325862 CTCCAGAAGAAAAAACAGGAGGG - Intergenic
994591242 5:101775351-101775373 AAGGAAAAGAAAAAATAGGAAGG - Intergenic
995075986 5:107983492-107983514 ATGCAAAAGACAAAGAATGCTGG - Intronic
995148425 5:108812645-108812667 ATCCAAAAGAAACAGGAGAAAGG - Intronic
995363719 5:111329546-111329568 ATGCAAAAATAAAACCATGAGGG - Intronic
995458716 5:112379601-112379623 TTGCAGATGAGAAAGCAGGAGGG - Intronic
995529382 5:113076975-113076997 ATGGAAAACAAAAAGAAGCAGGG + Intronic
996156309 5:120107084-120107106 AAAAAAAAGAAAAAGAAGGAAGG - Intergenic
996289832 5:121839689-121839711 ATGGAAAAGAAGAAGCAGCATGG + Intergenic
996446716 5:123561795-123561817 ATCCAGAAGATCAAGCAGGAAGG - Intronic
996522067 5:124438300-124438322 ATAAACAAGAAAAAGCAGGAAGG + Intergenic
996932129 5:128902568-128902590 ATGCAAAAAAAAAAAAAGGCCGG + Intronic
996936957 5:128960530-128960552 ATGGAAAACAAAAAAAAGGAGGG - Intronic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997137963 5:131346321-131346343 ATGGAAAACAAAAAAAAGGAGGG + Intronic
997318720 5:132960074-132960096 AACCAAAGGAAAAAGCAGCAAGG + Intronic
997529722 5:134574461-134574483 ATGCAGCAGAAATAGCTGGATGG + Intronic
998346978 5:141473000-141473022 AAGAAAAAGAAAAAGAAAGAAGG + Intronic
998754428 5:145360343-145360365 AGGCAAAAGCATAAGCAGTAAGG + Intergenic
998866824 5:146513723-146513745 ATACAAAATAAAAAGCATAAGGG - Exonic
998901484 5:146860138-146860160 CTATAAAAGGAAAAGCAGGATGG - Intronic
998964349 5:147522941-147522963 ATGGAAAAGAAAAAAAAGAAAGG - Intergenic
999014448 5:148084687-148084709 AGCATAAAGAAAAAGCAGGATGG - Intronic
999015312 5:148097060-148097082 AAGAAAAAGAAAAAGGAGAAAGG - Intronic
999074963 5:148786788-148786810 CTGGAATAGAAAAAGCAGTAGGG + Intergenic
999690016 5:154138667-154138689 AAGAAAAAGAAAAAGCATGGGGG + Intronic
999824091 5:155257772-155257794 AGGAAAATGGAAAAGCAGGAAGG - Intergenic
999837261 5:155387920-155387942 ATGCAAAAGATTAAGTAAGATGG + Intergenic
1000297252 5:159922678-159922700 AACCAAAAGAAAAAGTGGGAGGG + Intronic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000978834 5:167794699-167794721 GTGGAAAAGAAAAAGCTGCAAGG + Intronic
1001334488 5:170785988-170786010 ATGCAAAAGAGCAGGGAGGATGG - Intronic
1001720448 5:173852695-173852717 AAGAAAAAGAAAAAGAGGGAAGG + Intergenic
1001750992 5:174131309-174131331 ATTCATAAGAATCAGCAGGAAGG + Intronic
1001773578 5:174312707-174312729 ATGGAAAAGAGAAAGAAGGGTGG - Intergenic
1001950186 5:175811040-175811062 ATGTGAAAGAAAAACCAGTAAGG - Intronic
1002041168 5:176515376-176515398 AAAAAAAAGAAAAAGCAGGCCGG - Intergenic
1002149404 5:177215031-177215053 ATGGAAAAGAAAAAGTATGTTGG - Intronic
1002502915 5:179658691-179658713 ATGCTGAAGAAAATGCACGATGG - Intergenic
1002829172 6:803455-803477 AAGTAGAAGAAAAAGAAGGACGG - Intergenic
1002945460 6:1756981-1757003 CTGCAAAAGGACACGCAGGATGG + Intronic
1003088058 6:3077262-3077284 ATGAAAAGGAAACAGGAGGATGG + Intronic
1003310644 6:4966963-4966985 AAGAAAAAATAAAAGCAGGAAGG + Intergenic
1003383261 6:5644371-5644393 ATGCAAAAGAAAAAATAGCCAGG - Intronic
1003514172 6:6804541-6804563 ATGCAAAAGAAGAAGGGAGAGGG - Intergenic
1003522359 6:6868912-6868934 CTCCCAAAGAAAGAGCAGGAAGG + Intergenic
1003714461 6:8630869-8630891 ATTCAAAAGAAACATCAGGCTGG + Intergenic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1004385829 6:15171918-15171940 TTGCAAATGAAAAGGCGGGAGGG + Intergenic
1004482655 6:16035651-16035673 AAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1004577029 6:16906831-16906853 GAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1004636225 6:17470593-17470615 TTGGAAAAGAGAATGCAGGAAGG + Intronic
1005060536 6:21773176-21773198 ATGCATTGGAAAAAGCAGAAAGG + Intergenic
1005076598 6:21914190-21914212 AAGCAAAACAAAAGGCAGCACGG - Intergenic
1005409662 6:25530352-25530374 ATACAAAAGAAAAAGTAGCCAGG + Intronic
1005414089 6:25582995-25583017 AGGAAATAGCAAAAGCAGGAAGG + Intronic
1005414289 6:25584830-25584852 AGGAAATAGCAAAAGCAGGAAGG - Intronic
1006216643 6:32449331-32449353 AAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1006284098 6:33080189-33080211 ATGGAAAAGAGAAAGAAGGAAGG + Intronic
1006723209 6:36174131-36174153 ATGCAAAAGAAAGAAAAGAAAGG + Intergenic
1006755264 6:36409986-36410008 AAGAAAAAGAAAAGGAAGGAAGG + Intronic
1006906147 6:37535193-37535215 AGGCAAAAAGAAAAGCTGGAGGG + Intergenic
1007244350 6:40449599-40449621 ATGCAAAACAATAAGATGGAAGG + Intronic
1007310963 6:40945784-40945806 ACGCAATAGAAAAGGCTGGAGGG + Intergenic
1007328848 6:41087692-41087714 GTGCAAAAGAGAAAGCAGTGAGG - Intronic
1007551135 6:42730361-42730383 ATGAAAAAGAAAAAGCTGGCTGG - Intergenic
1007875659 6:45098126-45098148 AGCCAAAGAAAAAAGCAGGAAGG + Intronic
1008015088 6:46509546-46509568 ATGGAAAAGCACAAGCAGGCTGG - Intergenic
1008323319 6:50145262-50145284 AAGAAAAAGAAAAAGAAGAAAGG + Intergenic
1008493023 6:52105724-52105746 ATTCAAAAGAATAAACAGCATGG - Intergenic
1008935231 6:56984771-56984793 ATACAAAACAAAAAGCTTGAAGG + Intronic
1009419827 6:63453581-63453603 AAACAAAAAAAAAAGCAGGGTGG - Intergenic
1009463614 6:63944196-63944218 AAGCAATAGAAAAAGCTGAAAGG + Intronic
1009527730 6:64767487-64767509 ATGCAAAATAAAAATCATAAAGG - Intronic
1009803984 6:68578702-68578724 AGGAAAAAGAAAAAGAAGGAAGG + Intergenic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010282021 6:74033498-74033520 ATGGAAAAAAAAAAACAGCAGGG - Intergenic
1010393522 6:75363836-75363858 ATACTAAAGAAAAAGCTGGTTGG + Intronic
1010728842 6:79366719-79366741 ATGCAAAAGAAAAAAAGGTAGGG - Intergenic
1010820465 6:80409746-80409768 ATGGAAAGCAAAAAGCAGCAGGG - Intergenic
1011390915 6:86852357-86852379 ATTCAAAAGGAAAAGGAGAATGG + Intergenic
1011415887 6:87119880-87119902 AAGAAAAAGAAAAAAAAGGATGG - Intergenic
1011734988 6:90301584-90301606 ATGCATAGGAAAAATCTGGAAGG + Intergenic
1012107644 6:95184483-95184505 ATGCAAAAGAGAATGTAAGATGG - Intergenic
1012269045 6:97184762-97184784 AGGCAAGGGGAAAAGCAGGAAGG - Intronic
1012334962 6:98044182-98044204 ATGAAAAAGAGAAAGGGGGAGGG + Intergenic
1012455639 6:99401437-99401459 AAGAAAAAGAAAAACAAGGAAGG - Exonic
1012538110 6:100324372-100324394 ATGGAAAACAAAAAGGAGCAGGG - Intergenic
1012612479 6:101232744-101232766 ATGCATAAAAAAGAGCTGGAAGG - Intergenic
1012996502 6:105980929-105980951 ATGAAAAAAAAAAAGAAAGAAGG - Intergenic
1013647555 6:112160493-112160515 AAGCAAGAGAAAAAGCTAGAAGG - Intronic
1013833743 6:114307351-114307373 ATGGAAAAAAAAAAACAGTAAGG - Intronic
1014356053 6:120411634-120411656 ATGAAAAAGAAAGAACAGGAAGG + Intergenic
1014635350 6:123839625-123839647 TTGCAAAAGAAAAAGTAGGTGGG - Intronic
1014684747 6:124482781-124482803 ATGTAAAATAAATAGCATGAAGG - Intronic
1014842680 6:126239034-126239056 ATGGAAAACAAAAAAAAGGAAGG - Intergenic
1014888783 6:126816210-126816232 AAGAAAAAGAAAAGGAAGGAAGG - Intergenic
1015008210 6:128310566-128310588 ATGGCAATGAAAAAGCAGAAAGG + Intronic
1015051119 6:128841682-128841704 ATGAGAAAGAAACACCAGGAAGG - Intergenic
1015193638 6:130500844-130500866 ATGCAAAATGAAACACAGGAGGG + Intergenic
1015208403 6:130667826-130667848 ATACACAAAAAAAAGAAGGAAGG + Intergenic
1015234903 6:130959446-130959468 AGGCAGAAGAAAAGGCATGAGGG + Intronic
1015357562 6:132297010-132297032 ATGGAAAGGAAAAAGGAGGGAGG + Exonic
1015457568 6:133444974-133444996 ATGGAAAATACAAAGCAAGATGG - Intronic
1015580214 6:134715876-134715898 ATGCAGGAGAAAAAGCAGCAGGG - Intergenic
1015993401 6:138972125-138972147 ATACAAAAGGATAGGCAGGAGGG + Intronic
1016048724 6:139507156-139507178 ATGAAAAAGAAAAAGGAGAATGG - Intergenic
1016402327 6:143694068-143694090 ATCTTAAAGAAAAAGAAGGAAGG + Intronic
1016521891 6:144955085-144955107 ATTAAAAAAAAAAAGAAGGAGGG - Intergenic
1017260953 6:152386545-152386567 ATGCCAAAGAATAATCATGAAGG + Intronic
1017284516 6:152658695-152658717 ATGGAAAAAAAAAAAAAGGATGG + Intergenic
1017334085 6:153234559-153234581 AGGGAAAAGAAAAGGAAGGAAGG + Intergenic
1017479678 6:154839607-154839629 AAGAAAAAGAAAAAGAAGAAAGG - Intronic
1017531577 6:155297652-155297674 ATGTAAAAGGAAAAACAGGAGGG + Intronic
1017578389 6:155832396-155832418 AAGCAAAGAAAAAAGGAGGAAGG - Intergenic
1017663495 6:156696186-156696208 AAGAAAAAGAAAAAGAAGTAGGG - Intergenic
1017681199 6:156865814-156865836 AAGAAAAGGAAAAAGGAGGAAGG - Intronic
1017965402 6:159260319-159260341 AAGCAAAAGAAAAAGAATGGTGG - Intronic
1018315366 6:162551532-162551554 ATCCAAAAGAAAAAGGAAAAGGG - Intronic
1018555576 6:165046858-165046880 TTCCAAAAGATCAAGCAGGAGGG + Intergenic
1018775882 6:167015380-167015402 ATGCACAAGGCAAAGCAGAAAGG - Intronic
1019815301 7:3195588-3195610 ACTCAAAAAAAAAAGAAGGAAGG + Intergenic
1020611629 7:10404478-10404500 AAGGAAAAGAAAAAGAAAGAAGG + Intergenic
1020744947 7:12068874-12068896 ATGCAACAGAAAAAGGATAAAGG + Intergenic
1020769090 7:12365097-12365119 GTGCAAAAGATAAAGAAAGATGG + Intronic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1020920228 7:14254081-14254103 GTACAAAAGAAGAAGTAGGAGGG + Intronic
1021162509 7:17293416-17293438 ATGCATAAGAACAAGCAAAAAGG + Intergenic
1021226961 7:18039188-18039210 CTGCAAAATCGAAAGCAGGACGG + Intergenic
1021265929 7:18522565-18522587 CTGAAAAAAAAAAAGCAGGGTGG + Intronic
1021672933 7:23050676-23050698 ATAGAAAAGAAAAAGCAGCCTGG - Intergenic
1021839600 7:24712118-24712140 ATGGAAAAGAAAAAGAAGAATGG + Intronic
1021929792 7:25568890-25568912 AAGTAGAAGAAAAGGCAGGAAGG - Intergenic
1022229840 7:28404174-28404196 ATGGAAAAGAAAAAGAACTATGG + Intronic
1022495835 7:30852574-30852596 ATGCTAAAGAAAGAGGAAGAAGG - Intronic
1022764045 7:33390093-33390115 AAGGAAAAGGAAAAGAAGGAAGG - Intronic
1022925252 7:35050320-35050342 AAGCAAAAAAAAAAGGATGAAGG - Intergenic
1022947571 7:35302757-35302779 AAAGAAAAGAAAAAGCAAGAGGG - Intergenic
1023119526 7:36895179-36895201 ATGCAAGAGAAAATGGAAGATGG - Intronic
1023418907 7:39958218-39958240 ATGCAAACAGAAAAGCAGGGAGG - Intronic
1023656562 7:42428527-42428549 AAGAAAAAGAAAATCCAGGAAGG - Intergenic
1023791485 7:43757260-43757282 TTGCATAAGAAATAGCAGGGAGG + Intergenic
1024133487 7:46382261-46382283 TTGCAAAAGAAAAAGTTGAAGGG + Intergenic
1024525288 7:50343236-50343258 AAGGGAAAGAAAAAGGAGGAAGG - Intronic
1024802672 7:53099114-53099136 ATGCAAAACAGAAATTAGGAAGG + Intergenic
1024922279 7:54571780-54571802 ATGCAAATGAAAACACATGAGGG + Intergenic
1024923316 7:54584958-54584980 AGGTAAAAGAGAAAGGAGGAAGG - Intergenic
1025016455 7:55442818-55442840 TTGGAAAATAAAAAGCAGGCCGG + Intronic
1025526649 7:61821535-61821557 ATCCAAGAAAAAAAACAGGAAGG + Intergenic
1025550016 7:62234091-62234113 ATCCAAGAAAAAAAACAGGAAGG + Intergenic
1025915838 7:65865259-65865281 AAACAAAAAAAAAAGAAGGAAGG - Intergenic
1026078683 7:67197764-67197786 AAACAAAAGAAAAAGAAAGAAGG - Intronic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026506676 7:70990441-70990463 AAGGAAAAGAAAAGGCAGGCAGG - Intergenic
1026698137 7:72614190-72614212 AAACAAAAGAAAAAGAAAGAAGG + Intronic
1026763608 7:73145067-73145089 AGAAGAAAGAAAAAGCAGGAAGG - Intergenic
1026789772 7:73324142-73324164 CTGCAAATAAAAAAACAGGAAGG + Intronic
1026961797 7:74413196-74413218 ATGCAAAAAAAGTAGCATGATGG + Intergenic
1027040077 7:74954838-74954860 AGAAGAAAGAAAAAGCAGGAAGG - Intergenic
1027083561 7:75247523-75247545 AGAAGAAAGAAAAAGCAGGAAGG + Intergenic
1027234565 7:76290476-76290498 AAGAAAAGAAAAAAGCAGGAGGG - Intergenic
1027476431 7:78637181-78637203 ATGCACCAGAAAATGAAGGATGG - Intronic
1027508332 7:79046689-79046711 ATGCAGTAGAAAAAGCAAGTTGG - Intronic
1027607310 7:80316362-80316384 AGGAAAAGGAAAAACCAGGAAGG + Intergenic
1027745100 7:82062900-82062922 ATACAAAAGAAAAACCAGCTGGG - Intronic
1027883944 7:83878707-83878729 AAGCAAAAGAAACAGTATGATGG + Intergenic
1028025536 7:85833529-85833551 AAGCAAAAAAGAAAGAAGGAAGG - Intergenic
1028179805 7:87705915-87705937 AAGAAAATGAAAAAGCAAGAAGG - Intronic
1028522893 7:91752221-91752243 CAGAAATAGAAAAAGCAGGAAGG + Intronic
1028623276 7:92847699-92847721 ATGCCATAGAGAAAGCAAGAGGG - Intergenic
1028640254 7:93034458-93034480 ATCCTAAGGAAAAAGCAGGAGGG + Intergenic
1028777920 7:94701533-94701555 ACACAAAGGAAAGAGCAGGAGGG + Intergenic
1028930119 7:96403726-96403748 AAACAAAAACAAAAGCAGGAAGG + Intergenic
1029015591 7:97312571-97312593 AAGGAAAAGAAAAGGAAGGAAGG - Intergenic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029380494 7:100211243-100211265 ATGAAACAGAAACAGCAAGATGG - Intronic
1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG + Intergenic
1029621380 7:101691907-101691929 AAGGAAAAGAGAAAGAAGGAAGG - Intergenic
1029731493 7:102441243-102441265 ATTTAAAAGAAAAAGCTGGCTGG + Intronic
1029749475 7:102534964-102534986 AAACAAAAGAAAGAACAGGAAGG + Intergenic
1029767421 7:102634067-102634089 AAACAAAAGAAAGAACAGGAAGG + Intronic
1029837082 7:103323597-103323619 AAGAAAAAGAAAAAGCAGAATGG - Exonic
1029887369 7:103887544-103887566 ATTCAAAAGAAAAATGAGGTGGG + Intronic
1030018279 7:105246040-105246062 CTGCAAAAAGAAAAGCTGGAAGG + Intronic
1030421508 7:109311832-109311854 AAGGAAAAGAAAAAACAGCAGGG + Intergenic
1030759084 7:113328572-113328594 ATGAAAAAGAGCAAGCAGGAGGG + Intergenic
1030965789 7:115991544-115991566 ATGGAAAACAAAAAAAAGGAGGG + Intronic
1031066540 7:117111642-117111664 AAGCAAGGGAAAAAGCTGGATGG - Intronic
1031653955 7:124328361-124328383 ATCCCAAAGAAAAAGCTGCAGGG + Intergenic
1031682881 7:124695853-124695875 AAGGGAAAGAAAAAGAAGGAAGG + Intergenic
1031892826 7:127314868-127314890 AAGAAAAAGAAAAAGATGGAAGG - Intergenic
1032656791 7:133939100-133939122 AAGCAAAAGAAACAGCAGGAAGG + Intronic
1032785101 7:135194425-135194447 AAGTAAAAGAAAAAACAGCAAGG + Intronic
1032955373 7:136964593-136964615 GTGCAAAGGAAAAAGGAGGAAGG - Intronic
1032974495 7:137206772-137206794 AGAGAAAAGAAAAAGAAGGAAGG - Intergenic
1033018938 7:137701864-137701886 ATAAAAAAGAAAAAGTTGGAGGG + Intronic
1033021636 7:137731049-137731071 AAGTAAAAGGAATAGCAGGAGGG - Intronic
1033062047 7:138118839-138118861 AGGGGAAAGAAAAAGAAGGAGGG + Intergenic
1033115155 7:138618756-138618778 AGAAAAAAGAAAAAGAAGGAAGG + Intronic
1033400270 7:141016177-141016199 GTGAAAAGGAAAAAACAGGAAGG - Intergenic
1033478215 7:141711458-141711480 ATGCAGAAGACAAAGCTGCATGG + Intronic
1033593864 7:142839795-142839817 ATGAAAAAGAAAAAGAATAAGGG + Intergenic
1033605347 7:142923642-142923664 ATGCCAAGGAACAAGAAGGAAGG + Intronic
1033832587 7:145271469-145271491 AGGAAGAAGAAAAAGAAGGAAGG + Intergenic
1033883714 7:145918205-145918227 AAGAAAAAGAAAAGGAAGGAAGG + Intergenic
1033994624 7:147330315-147330337 ATGCATAGGAAAAGGCATGATGG - Intronic
1034362437 7:150512490-150512512 ATACAGAAGAAAAAGCAGCAAGG + Intergenic
1034786871 7:153934332-153934354 ATGGAAAAAAAAAAGGAGAAGGG - Intronic
1035304227 7:157920497-157920519 GTTCAAAAGAAGAAGCAGGCAGG - Intronic
1035715765 8:1753588-1753610 AAGAAAAAGAAAAAACAGGCTGG + Intergenic
1035729685 8:1845304-1845326 ATGCCAAAAAGAAAGCAGGGAGG - Intronic
1037054872 8:14427374-14427396 AAGAAAAAGAAAAAGCGTGAAGG + Intronic
1037076375 8:14724238-14724260 ATGCTAAAGAGAAAGCAAGGTGG + Intronic
1037154317 8:15681210-15681232 ATTCCAAAAAAAAAGGAGGACGG - Intronic
1037184437 8:16045537-16045559 ATTCTAAAGAAAAAGGAGTAAGG - Intergenic
1037187582 8:16082345-16082367 ATGCAGGAGCAAAAGCAGCACGG + Intergenic
1037514114 8:19612511-19612533 AGGCCCAAGAAAAAGGAGGAGGG + Intronic
1037687211 8:21151333-21151355 ATGCAAAAGTAAAGTCAAGATGG + Intergenic
1037704324 8:21305943-21305965 TTGCAAAAGAAAAAGAACAATGG + Intergenic
1037704548 8:21308193-21308215 ATTGACAGGAAAAAGCAGGAAGG + Intergenic
1037869952 8:22484752-22484774 TTGCAAAGGAAAGAGCATGAAGG + Intronic
1038061517 8:23919033-23919055 ATGCATAGGAAAAAGGAGTAAGG - Intergenic
1038270297 8:26069460-26069482 ATGCAAAAGACAGAAAAGGAAGG + Intergenic
1038432141 8:27508938-27508960 AAAAAAAAAAAAAAGCAGGATGG - Intronic
1038537491 8:28364021-28364043 AAGCAGAAGAGAAAGAAGGAAGG + Intronic
1038644698 8:29351876-29351898 ATGCAAAAGAGAAATGGGGATGG - Intergenic
1038820376 8:30946439-30946461 ATGTCAAAAAAAAAGAAGGAAGG + Intergenic
1038907290 8:31919355-31919377 ATACAATAAAAAAAGCAAGAAGG + Intronic
1038995476 8:32918328-32918350 AAGCAATAGAAAATGCAGCAGGG - Intergenic
1039016500 8:33155197-33155219 ATGAAAAAGCAAAAGCTGGCTGG - Intergenic
1039246738 8:35616934-35616956 ATGCAGAAGTAAAAGCAGTCTGG + Intronic
1039252215 8:35679288-35679310 ATTAGGAAGAAAAAGCAGGAAGG + Intronic
1039269354 8:35863820-35863842 ATACAAAGGAATAAGCAGGATGG - Intergenic
1039684012 8:39776604-39776626 ATGACAAAGAAAAAGCTGAATGG + Intronic
1039977622 8:42380794-42380816 AAGAAAAAGAAAAGGAAGGAAGG + Intergenic
1040013775 8:42683614-42683636 ATCAAAAAAAAAAAGAAGGAAGG + Intergenic
1040013883 8:42684790-42684812 GCCCACAAGAAAAAGCAGGAAGG + Intergenic
1040752180 8:50723785-50723807 ATGGAAAAAAAAAAGGAGAAAGG + Intronic
1040844216 8:51819746-51819768 ATTCAAAAGCAAAAGTAGCAGGG + Exonic
1041150811 8:54931742-54931764 AAGTAAAAGAGAAAGAAGGAAGG - Intergenic
1041163031 8:55064131-55064153 ATGTAAAATAAAAAGCTGAACGG - Intergenic
1041854922 8:62440675-62440697 AAGAAGAAGAAAAAGAAGGAAGG - Intronic
1041980381 8:63851379-63851401 ATGTGAAAAAAAAAGCAAGAGGG - Intergenic
1042006778 8:64189458-64189480 AGACAAAGGAAAAAGAAGGAAGG + Intergenic
1042512713 8:69628075-69628097 AAGCAAAATAGAAAGAAGGAAGG - Intronic
1043186210 8:77153475-77153497 AGGCAGAAGAAAATGCAGAAAGG - Intergenic
1043546126 8:81317719-81317741 ATGAAAAAAAAAAAACAGGTTGG - Intergenic
1043764238 8:84109399-84109421 ATGAAAAAGAAAAATAAGGAAGG - Intergenic
1043766246 8:84135753-84135775 AAAGAAAAGAAAAAGAAGGAAGG + Intergenic
1043787087 8:84416896-84416918 ATACAAAACAAAAAGTAAGAAGG - Intronic
1044245450 8:89939206-89939228 ATGAAAAAGAAAAATAGGGAGGG + Intronic
1044528145 8:93275635-93275657 AAGGAAAAGAAAAAACAAGATGG + Intergenic
1044570738 8:93715487-93715509 ATGCATAGGAAAAATCTGGAAGG - Intronic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1044860819 8:96521902-96521924 AACCAAGAGAAAAATCAGGATGG + Intronic
1044896173 8:96894012-96894034 ATGCAAGAGAAAGAGCAAGGAGG - Intronic
1045205225 8:100032335-100032357 ATGGAAAACAAAAAAAAGGAGGG + Intronic
1045316665 8:101049308-101049330 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1045807413 8:106180671-106180693 ATGCAAAAATAAAAACAGAAAGG + Intergenic
1045955214 8:107898058-107898080 GTCCAATAGGAAAAGCAGGAAGG + Intergenic
1046047511 8:108981774-108981796 ATGCAAAAGTTAATGCAAGATGG - Intergenic
1046078579 8:109342159-109342181 ATGCAAAAAAAAAAAAAGGGGGG - Intronic
1046221252 8:111218429-111218451 AGGGAAAGGAAAAAGAAGGAAGG - Intergenic
1046236837 8:111435205-111435227 AAGGAAAAGAAAAGGAAGGAAGG + Intergenic
1046339049 8:112827426-112827448 ATGGACAAGAAAAGGCAGGCTGG - Intronic
1046488900 8:114921453-114921475 ATGGTAAGGAAAAAGCAGAATGG - Intergenic
1046560773 8:115834506-115834528 ATGAAAAAAAAAAAGAAGAAGGG - Intergenic
1046586311 8:116152785-116152807 ACCAAGAAGAAAAAGCAGGAGGG - Intergenic
1046617482 8:116493334-116493356 AGAAAAAAGAAAAGGCAGGAAGG + Intergenic
1046897396 8:119487699-119487721 AGGTAGAAGAAAAACCAGGAGGG - Intergenic
1046939088 8:119913936-119913958 ATTTAGAAGGAAAAGCAGGAGGG - Intronic
1046945873 8:119973767-119973789 AAACAAAAGAAAAAGAAAGAGGG - Intronic
1047077908 8:121424763-121424785 ACCCAAAAGAAACAGAAGGAAGG + Intergenic
1047127082 8:121974513-121974535 AGGAAAAAGAAGAAGAAGGAAGG - Intergenic
1047198511 8:122743504-122743526 GTGCAAAAAAAAAAAAAGGAGGG + Intergenic
1047464616 8:125100317-125100339 AGGCAAAGGAAAAGGCAGGTAGG - Intronic
1048080693 8:131123166-131123188 AAAAAAAAGAAAAAGAAGGAAGG - Intergenic
1048520671 8:135151437-135151459 GAGCAAAAGAAAAAGAGGGAAGG + Intergenic
1048590914 8:135820140-135820162 AGGGAAAAGAAAAAGAAGCAAGG - Intergenic
1048611996 8:136033232-136033254 ATGAAAAAGTTAAAGCAGGGAGG + Intergenic
1048780976 8:138000700-138000722 AAGCAAAAAACAAAGCTGGAAGG - Intergenic
1050009025 9:1166258-1166280 ATCCAAAAAAAAAAACAAGATGG - Intergenic
1050124032 9:2337851-2337873 ATGGCACAGAAAAGGCAGGAGGG + Intergenic
1050541064 9:6670702-6670724 GTACAGAAGAAAAAGCATGAAGG - Intergenic
1050595085 9:7197055-7197077 AAGCAAGAGGAAAAGCAGGAGGG - Intergenic
1050648352 9:7746771-7746793 AAGCCAAAGAAAAAAAAGGAAGG + Intergenic
1050782573 9:9356149-9356171 CTGCAAAAGAAAAAGAACCAAGG + Intronic
1050845498 9:10212236-10212258 AAGCAAAAGAAAGAGTAGGATGG + Intronic
1050994071 9:12191440-12191462 ATGTAAAAAAAAAAAAAGGAAGG - Intergenic
1051011602 9:12421710-12421732 AAAAAAAAGAAAAACCAGGATGG + Intergenic
1051014828 9:12462012-12462034 AAGGAAAAGAGCAAGCAGGAGGG - Intergenic
1051053182 9:12954626-12954648 ATGCAAGAGAGAGAGCAGGGAGG + Intergenic
1051075414 9:13227912-13227934 ACTCATAAGAAAAAGCAGAAAGG + Intronic
1051111644 9:13645150-13645172 ATGCAACAGGAGAAGCAGAAAGG - Intergenic
1051182767 9:14428491-14428513 CTGCAAAAGAGAAAGAGGGAAGG + Intergenic
1051352420 9:16210260-16210282 AAGCAAGGGAAAAAGGAGGAAGG + Intronic
1051400778 9:16679726-16679748 ATGGAGAGGAAAAGGCAGGAAGG + Intronic
1051434026 9:17011685-17011707 ATGAAAAAAAAAAATCAGAATGG - Intergenic
1051714614 9:19969252-19969274 ATGAAAAAGGAAAAGAATGAAGG - Intergenic
1052003190 9:23313091-23313113 ATTCAAAATAAATAGCTGGATGG + Intergenic
1052902787 9:33808577-33808599 GTGGAAAAGACAAAGCTGGAAGG + Intergenic
1053050255 9:34955763-34955785 TAGCAAAAGAAAAAGCAAGGTGG - Intergenic
1053065630 9:35066911-35066933 GTGAAAAAGAAAAGGCAGGATGG + Intronic
1053248587 9:36555683-36555705 AAGGAAAAGAAAAAGCTGAAAGG - Intergenic
1053486893 9:38465354-38465376 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1053487793 9:38473315-38473337 GTGGAAAAGACAAAGCTGGAAGG - Intergenic
1053527301 9:38843076-38843098 ATACAAAGGGAAAAGCATGATGG + Intergenic
1054199524 9:62067507-62067529 ATACAAAGGGAAAAGCATGATGG + Intergenic
1054638831 9:67520850-67520872 ATACAAAGGGAAAAGCATGATGG - Intergenic
1054706954 9:68472354-68472376 ATCCAAAAGAATAACCAGGAGGG - Intronic
1054791203 9:69258604-69258626 ATTTAAAATAAAAAGCAGGATGG - Intergenic
1054792043 9:69265536-69265558 AGGGAAAAGGACAAGCAGGAGGG + Intergenic
1055773762 9:79745642-79745664 TTGCAATAGAAAAAACAGAAGGG + Intergenic
1055995194 9:82149767-82149789 AGACAGAAAAAAAAGCAGGAGGG - Intergenic
1056427614 9:86492779-86492801 ATGCAAAAGCAAGAGCCAGAGGG - Intergenic
1056974434 9:91238300-91238322 CTGCAAACCAAATAGCAGGAAGG + Intronic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057364209 9:94403655-94403677 ATTCAAAAGAAACAACAGCAGGG - Intronic
1057659127 9:96984416-96984438 ATTCAAAAGAAACAACAGCAGGG + Intronic
1057959984 9:99445882-99445904 ATGTAAAAGACAAAACTGGAAGG - Intergenic
1058206210 9:102111674-102111696 CTGCAAAATAATAAGCAAGATGG - Intergenic
1058245682 9:102622086-102622108 ATTAAAAAGGAAAACCAGGATGG - Intergenic
1058300112 9:103361003-103361025 ATGCAACAGAAAAAAGAGCATGG + Intergenic
1058435984 9:104963796-104963818 ATCAAAAAGAAAAAAAAGGAAGG - Intergenic
1058547942 9:106081099-106081121 AGGCAAGAAACAAAGCAGGAAGG - Intergenic
1058561845 9:106238369-106238391 ATCCAAACTAAAAAGCAGGGAGG - Intergenic
1058696595 9:107564275-107564297 ATGAAAAAGGAAAAGAGGGAAGG + Intergenic
1059060490 9:111030876-111030898 AAGCAAAAGAAAATGGAGGCAGG + Intronic
1059483421 9:114609717-114609739 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1059623997 9:116041188-116041210 ATGGAAAAGAAAAAGGAGACGGG + Intergenic
1059736482 9:117105087-117105109 TTGCAAAAGATAAGGCAGGATGG - Intronic
1059802320 9:117762985-117763007 ATGCCAAAGCAAAAGAAAGAAGG + Intergenic
1059924586 9:119195649-119195671 CTGCAGAAGTAACAGCAGGAAGG - Intronic
1060834959 9:126748843-126748865 AAGAAAAAGAAAAGGAAGGAAGG - Intergenic
1061114690 9:128602182-128602204 AAACAAAAAAAAAAACAGGAGGG - Intronic
1061278886 9:129585762-129585784 AACGAAAAAAAAAAGCAGGAGGG - Intergenic
1061368274 9:130183770-130183792 AGGGAAAAGAAAAGGAAGGAAGG - Intronic
1062527317 9:136983214-136983236 ATGCAACTGAAAAGGTAGGATGG - Exonic
1203364571 Un_KI270442v1:245722-245744 ATTCAAAAGCAAAAGTAGCAGGG - Intergenic
1185574782 X:1162840-1162862 AAGGAAAAGAAAAGGAAGGAAGG + Intergenic
1185578543 X:1192811-1192833 AAGAAAAAAAAAAAGAAGGAAGG - Intronic
1185680049 X:1881111-1881133 AAGGAAAAGAAAAGGAAGGAAGG + Intergenic
1185680062 X:1881193-1881215 AAGGAAAAGAAAAAGAGGGAAGG + Intergenic
1185684553 X:1917642-1917664 AGGCAAAAGAAAAAGAAGGGGGG + Intergenic
1185750130 X:2604307-2604329 ATGCTAAAGAAGAACCATGAGGG - Intergenic
1186059244 X:5685984-5686006 GTGCAAAAGTAAAAGAAGCATGG - Intergenic
1186069112 X:5798743-5798765 AATGAAAAGAAAAAGCATGAAGG + Intergenic
1186860835 X:13670862-13670884 ATCCAAAGGTATAAGCAGGAAGG - Intronic
1186869500 X:13756507-13756529 CTGCAAAAGTAAAAGCTGGCAGG - Intronic
1186917604 X:14240303-14240325 AGGCAATATGAAAAGCAGGAGGG - Intergenic
1187114308 X:16333369-16333391 AGGCAAAGAAGAAAGCAGGAGGG - Intergenic
1187386817 X:18856629-18856651 AAGGAAATGAAAAAGCAGAAGGG - Intergenic
1187521258 X:20016206-20016228 GAGGAAAAGAAAAAACAGGAAGG - Exonic
1187637905 X:21252983-21253005 TTGGAAAAGAAACAGCAGGATGG - Intergenic
1188433357 X:30132333-30132355 AAGCAAAAGAAACAGCGGGGAGG - Intergenic
1188741190 X:33784667-33784689 AAGGAAAAGAAAAAGAAAGAAGG - Intergenic
1188819582 X:34757979-34758001 ATGCATAAAAAAGAGCAGTAAGG - Intergenic
1188869278 X:35353864-35353886 ATGCAAAAGAAATATCATAAAGG + Intergenic
1189406816 X:40732784-40732806 ATAAAAAAGAAACATCAGGAAGG + Intronic
1189457904 X:41210955-41210977 AAGGAAAAGAAAAAGGAGAAAGG - Intronic
1189577786 X:42373755-42373777 AAGAAAAAAAAAAAGCAGGATGG + Intergenic
1189850826 X:45174498-45174520 ATACAGAAGAGAAAGCAGTAGGG + Intronic
1189865899 X:45326723-45326745 AAAGAAAAGAAAAAGCAGCATGG + Intergenic
1190241948 X:48663786-48663808 AAGAAAAAAAAAAAGAAGGAAGG - Intergenic
1190431766 X:50384850-50384872 AAGCAAAAAAGAAAGGAGGAAGG + Intronic
1191006659 X:55717411-55717433 ATTAACAATAAAAAGCAGGAAGG + Intergenic
1192094206 X:68193299-68193321 ATTCAATTGAAAAAGGAGGAAGG + Intronic
1192121137 X:68457099-68457121 AAGTAAAAAAAGAAGCAGGATGG + Intergenic
1192390848 X:70726824-70726846 ATGAAAAAAAAAAAGCAGCCAGG - Intronic
1192397979 X:70803419-70803441 TAGCAAAAGAAAAGGCAGGAGGG + Intronic
1192536497 X:71932930-71932952 ATGGAAAAGAAAAAGCACAAGGG - Intergenic
1192635320 X:72810227-72810249 TTGGAAAAGAACAAGCATGAAGG - Intronic
1192646394 X:72910576-72910598 TTGGAAAAGAACAAGCATGAAGG + Intronic
1192672594 X:73161513-73161535 ATGGAAAGGAAAAAGAAGAATGG - Intergenic
1192701952 X:73483430-73483452 ATGCAAAGGAAAAAAAAGCAGGG + Intergenic
1192749132 X:73969979-73970001 ATGGAAAAGAATAAGCAGTCCGG - Intergenic
1192907279 X:75565097-75565119 ATGAAAAACAAAAAGAAGCAGGG - Intergenic
1193326766 X:80187195-80187217 ATGCAAAAAAAAAAAAAGAATGG - Intergenic
1193421467 X:81287927-81287949 ATAAAAAAGAAAAAGAAAGAAGG + Intronic
1193550071 X:82881037-82881059 ATGCAAAGGAAAAACCAAAAAGG + Intergenic
1193776798 X:85652211-85652233 ATACAAAAGAAAAAGAAAGCAGG - Intergenic
1193823696 X:86196394-86196416 ATGAAAAGGAACAAGCAGGCTGG + Intronic
1193923961 X:87463502-87463524 ATACAAAAGTAAAAGCAGGCAGG + Intergenic
1193981186 X:88184025-88184047 CTGAAGAAGAAAAAGCTGGAAGG - Intergenic
1194001068 X:88428931-88428953 ATGCAAAAGAGAGGGCAAGATGG - Intergenic
1194082392 X:89485468-89485490 ATGCAATTGAAAATGCATGATGG - Intergenic
1194152344 X:90341354-90341376 ATGCAAAAAATAAATCATGATGG - Intergenic
1195521110 X:105830496-105830518 ATAAAAAAGAATAAGCAGTATGG - Intronic
1195905095 X:109836650-109836672 AAGAAAAAGAAAAAGAAAGATGG + Intergenic
1196264623 X:113627653-113627675 ATGCAAAGAAAAATGCAGGTAGG - Intergenic
1196313858 X:114199645-114199667 AGGAAAAAGAAAAAGAAGGAGGG + Intergenic
1196471713 X:116036072-116036094 CTGGAAAAGAAAAATCTGGAGGG - Intergenic
1196544811 X:116949278-116949300 ATGCAAAAGCAAATGAAAGAGGG - Intergenic
1196670561 X:118362515-118362537 ATGCTCAGCAAAAAGCAGGAAGG - Intronic
1197023715 X:121721186-121721208 ATACAAAACAAATAGCAAGATGG - Intergenic
1197094960 X:122582972-122582994 ATGAAAAAAAAAAAGTGGGAGGG + Intergenic
1197672201 X:129290251-129290273 ATGGAAAACAAAAAAAAGGAGGG + Intergenic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1198174236 X:134139605-134139627 ATGAAAAGGAAAAGGTAGGATGG + Intergenic
1198551400 X:137749238-137749260 ATGCAAAAAAAAATGTATGAAGG - Intergenic
1198725608 X:139674139-139674161 AAGCAAAAGAAAAAAAAGCAGGG - Intronic
1199219762 X:145304696-145304718 ATGCAAAAGAAAAATCTTAAAGG - Intergenic
1199316576 X:146385545-146385567 ATGAAAAAGAAAAAGGAGAGTGG + Intergenic
1199451856 X:147986475-147986497 ATGCAAAAGTAAACTCAAGATGG - Intronic
1199603591 X:149558723-149558745 AAGAAAAAGAAAAACCAGCAAGG - Intergenic
1199646796 X:149920751-149920773 AAGAAAAAGAAAAACCAGCAAGG + Intergenic
1200421289 Y:2971490-2971512 ATGCAAAGGATACAGCAGGTAGG - Intronic
1200435042 Y:3141349-3141371 ATGCAATTGAAAATGCATGATGG - Intergenic
1200498690 Y:3918111-3918133 ATGCAAAAAATAAATCATGATGG - Intergenic
1200856120 Y:7940389-7940411 GTGAAAAATAAAAAACAGGAAGG + Intergenic
1200910507 Y:8527546-8527568 ATCCAAAAGAATCAGAAGGATGG + Intergenic
1200927272 Y:8665823-8665845 ATGCAAAAAAAAAAAAATGAAGG + Intergenic
1201074076 Y:10173539-10173561 ATTCAAAAGCAAAAGTAGAAGGG + Intergenic
1201588548 Y:15588811-15588833 ATGTAAAACAAAAAACAGCAGGG - Intergenic
1201789619 Y:17825110-17825132 CTGCAAAAGTAAAAGCTGGCAGG - Intergenic
1201811934 Y:18080878-18080900 CTGCAAAAGTAAAAGCTGGCAGG + Intergenic
1202097539 Y:21267434-21267456 ATGCAAGAAACAAAGCAGGCTGG - Intergenic
1202351272 Y:23994862-23994884 CTGCAAAAGTAAAAGCTGGCAGG - Intergenic
1202519507 Y:25675257-25675279 CTGCAAAAGTAAAAGCTGGCAGG + Intergenic