ID: 922120093

View in Genome Browser
Species Human (GRCh38)
Location 1:222657295-222657317
Sequence GGACCCCTAGTAAAAGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922120093_922120102 30 Left 922120093 1:222657295-222657317 CCTAGGGCTTTTACTAGGGGTCC No data
Right 922120102 1:222657348-222657370 TTCTTGTTTCTCTCAACCCAGGG 0: 1
1: 0
2: 1
3: 29
4: 262
922120093_922120101 29 Left 922120093 1:222657295-222657317 CCTAGGGCTTTTACTAGGGGTCC No data
Right 922120101 1:222657347-222657369 CTTCTTGTTTCTCTCAACCCAGG 0: 1
1: 0
2: 0
3: 36
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922120093 Original CRISPR GGACCCCTAGTAAAAGCCCT AGG (reversed) Intronic