ID: 922122387

View in Genome Browser
Species Human (GRCh38)
Location 1:222685406-222685428
Sequence GGCTTGGACCAACAGATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922122387_922122391 13 Left 922122387 1:222685406-222685428 CCAGTTATCTGTTGGTCCAAGCC 0: 1
1: 0
2: 0
3: 1
4: 65
Right 922122391 1:222685442-222685464 CTCCAAATGACTACTGTTCAAGG 0: 1
1: 0
2: 1
3: 16
4: 139
922122387_922122393 30 Left 922122387 1:222685406-222685428 CCAGTTATCTGTTGGTCCAAGCC 0: 1
1: 0
2: 0
3: 1
4: 65
Right 922122393 1:222685459-222685481 TCAAGGAGTATTCAAAATACTGG 0: 1
1: 0
2: 0
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922122387 Original CRISPR GGCTTGGACCAACAGATAAC TGG (reversed) Intronic
904283305 1:29436656-29436678 GGCTTGGACAAACTGATTTCTGG + Intergenic
905958966 1:42027280-42027302 GGCTTGGACTAAAAGAGAATTGG - Intronic
906526166 1:46494471-46494493 GGCTCGGACCAAGGGATAATTGG + Intergenic
909321286 1:74289004-74289026 GGCTTGGAGCAACAAGTAAAAGG + Intronic
910186165 1:84542867-84542889 GTCTTGGAACGACAGATAAAGGG - Intergenic
910251222 1:85200997-85201019 GGCCTGGATCAGCAGATAATAGG + Exonic
910930438 1:92438069-92438091 GGTTTGAACCAACAAATAAAGGG + Intergenic
922122387 1:222685406-222685428 GGCTTGGACCAACAGATAACTGG - Intronic
923428603 1:233896949-233896971 GGCTTGGACCATGTGATACCAGG - Intergenic
1065210359 10:23396667-23396689 GCCTTGGGCCCACAAATAACAGG + Intergenic
1074307018 10:112288394-112288416 GGGCTGGACAGACAGATAACGGG + Intronic
1081536086 11:43997209-43997231 GGCGTGGACCAACATGTAGCAGG + Intergenic
1081721100 11:45288964-45288986 GGCTGGGACCCACAAATAATTGG + Intergenic
1083697621 11:64453319-64453341 GGCATGATCCAACACATAACAGG + Intergenic
1088037969 11:105341148-105341170 GGCTTGGACCAATAGGAAGCAGG - Intergenic
1092585391 12:9895697-9895719 TGATTGGACCAACTGATGACAGG + Exonic
1100892640 12:99142898-99142920 GTCTTAGGCTAACAGATAACTGG + Intronic
1101396676 12:104354918-104354940 GGCGTGGAAAAATAGATAACTGG - Intergenic
1108265901 13:48708400-48708422 GGATTGGAGCAAAAGAGAACTGG + Exonic
1109121137 13:58459314-58459336 AGATTGGAACAACAGATAATGGG + Intergenic
1119436272 14:74599836-74599858 GGGTTGGGCCCACAGATATCTGG + Intronic
1121627466 14:95396757-95396779 GGTTTGGAACAAGAGATCACTGG + Intergenic
1123794660 15:23759742-23759764 GGCTGGGATAAACAGAAAACAGG + Intergenic
1127697264 15:61462578-61462600 GGGTTGGATCAACAGATTAGAGG - Intergenic
1128218048 15:65947746-65947768 GACTTGGACAAAAAGAAAACCGG + Intronic
1131899464 15:97072079-97072101 GCCTTGAACAACCAGATAACAGG + Intergenic
1132361774 15:101222312-101222334 GGCTAGAACCAAGAGATAATTGG - Intronic
1134747938 16:16602348-16602370 GGCTTGGACCACCAGAGGTCTGG + Intergenic
1140195465 16:72851214-72851236 GGTGGGGACCAACAGATACCAGG + Intronic
1142688505 17:1591424-1591446 GGCTTTGACCACAAGATCACAGG - Exonic
1142905562 17:3039059-3039081 GACAGAGACCAACAGATAACAGG - Intergenic
1150070888 17:62148964-62148986 GGCTTGGAGCCACTGATACCTGG - Intergenic
1153069738 18:1091584-1091606 GGCTGAGAGCAAGAGATAACAGG - Intergenic
1160367656 18:78342103-78342125 CACTGGGACAAACAGATAACAGG - Intergenic
1164780434 19:30887206-30887228 GGCTTGGAGCAAGAGACAGCTGG + Intergenic
928175213 2:29028752-29028774 GGCTTCGGCCAACAGCCAACAGG + Intronic
929769357 2:44878993-44879015 GGCTTGGACTAACAGCTGAGTGG + Intergenic
941926914 2:170904943-170904965 GGCTTGGGCAAAAAGAAAACCGG + Intergenic
941942071 2:171050820-171050842 GGCTTGTTACAACAGATTACTGG + Intronic
943596254 2:189861095-189861117 AGCTAGGACAAACAGAAAACAGG - Intronic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1170982173 20:21224569-21224591 ACCTTGAACCAACAGAGAACTGG - Intronic
1172078516 20:32318622-32318644 AGCATGGATCAACAGATATCTGG + Intronic
1182047645 22:27288385-27288407 AGCTTGGACCAACTGTCAACTGG + Intergenic
1184318836 22:43723289-43723311 GCATGGGAACAACAGATAACAGG + Intronic
1184349609 22:43935077-43935099 GGCTTGGACCCACACCTGACTGG - Intronic
951197544 3:19840845-19840867 GGCTTTGAACAACAGATAAATGG + Intergenic
954415331 3:50390669-50390691 GACTTGGGCACACAGATAACAGG + Intronic
956995053 3:74817602-74817624 GGTTTAGATCAACAGAAAACTGG - Intergenic
966117830 3:176486089-176486111 GGTTTGGAAAAACAGATAAGTGG + Intergenic
970726333 4:19049502-19049524 TGCTTGGACCAAAGGATACCTGG + Intergenic
981422613 4:144568649-144568671 GCCTTGTACCAACAAATAAAAGG + Intergenic
994976514 5:106814594-106814616 AGCTTGGACCTTCAGATAAAAGG - Intergenic
996382933 5:122880421-122880443 GGCATTGACTAACAGATAAAGGG - Intronic
999388751 5:151174654-151174676 GGCTTGCACCAAGAGACATCAGG + Intergenic
1017027297 6:150192609-150192631 GGCATGCAACAACAGATACCTGG - Intronic
1032571954 7:133010103-133010125 GGCTTGGAGTAAAAGAGAACTGG + Intronic
1033675589 7:143538127-143538149 GGCTTGGAGAAACAGTAAACCGG + Intergenic
1033696246 7:143791317-143791339 GGCTTGGAGAAACAGTAAACCGG - Intergenic
1034837389 7:154365038-154365060 GGCTTATACCACCAAATAACTGG + Intronic
1044119628 8:88378745-88378767 TCCTTGGACCAACAGAAAAGGGG + Intergenic
1044338891 8:91024098-91024120 GGCCTGGCCCACCAGATAAATGG + Intronic
1045906721 8:107354827-107354849 GGCTTGGATGAACAGATAGGTGG - Intronic
1060671905 9:125477395-125477417 AGCTTGGACAAAGAGATAAGGGG + Intronic
1192244988 X:69364598-69364620 GGCTTGGACCAAAATGAAACTGG - Intergenic
1194387269 X:93271608-93271630 GGCTTAGACCAAAAAATAAGGGG + Intergenic
1199966072 X:152822126-152822148 GGCTTGGAAGACCAGATGACTGG + Intergenic