ID: 922122791

View in Genome Browser
Species Human (GRCh38)
Location 1:222689733-222689755
Sequence GTTAATTTATTATTAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1466
Summary {0: 1, 1: 2, 2: 22, 3: 121, 4: 1320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922122791 Original CRISPR GTTAATTTATTATTAAAGAC AGG Intronic
900232656 1:1568861-1568883 ATTTATTTATTTTTACAGACAGG - Intronic
900276743 1:1834839-1834861 TTTAAATTTTTATTAGAGACGGG + Intronic
900359196 1:2279718-2279740 TTTTATTTTTTATTAGAGACAGG + Intronic
901107749 1:6770454-6770476 TTAAATTTATTTTTAGAGACAGG - Intergenic
901333857 1:8431701-8431723 GTTAATTTATTATTGAAGAAAGG - Intronic
901423808 1:9168385-9168407 TTTATTTTATTTTTAGAGACAGG - Intergenic
901503972 1:9672432-9672454 ATTTATTTATTTTTAGAGACAGG + Intronic
901583404 1:10265240-10265262 ATTTATTTATTTTTAGAGACAGG + Intronic
902062986 1:13660846-13660868 TTTAATTTTTTAGTAGAGACGGG - Intergenic
902438994 1:16416974-16416996 GTGAGTTTATTACTAAAGATGGG - Intronic
902544263 1:17177439-17177461 GTCATTTTATTATTAACCACAGG - Intergenic
902928499 1:19713691-19713713 GTTGATATATTTTTAGAGACAGG - Intronic
902984177 1:20145616-20145638 ATTAATTAATTAATTAAGACAGG + Intronic
903114935 1:21170972-21170994 TTTAATTTATTTTTTTAGACAGG - Intronic
903202078 1:21749606-21749628 ATTATTTTATTTTTACAGACAGG + Intronic
903533344 1:24049095-24049117 GTTTATTTATTTTTTGAGACTGG - Intergenic
903582557 1:24382878-24382900 GTTAATTTAATGTTAGAGTCTGG + Intronic
904073348 1:27819102-27819124 GCTAATTTTTTGGTAAAGACAGG - Intronic
904218421 1:28943479-28943501 TTTAATTTTTTAGTAGAGACAGG - Intronic
904258128 1:29270177-29270199 GTTTATTAATTACTATAGACTGG + Intronic
904491593 1:30863677-30863699 ATTTATTTATTTTTAGAGACAGG + Intergenic
904653433 1:32024313-32024335 ATTAATTTTTTTTTAGAGACAGG + Intronic
904660536 1:32081022-32081044 ATTTATTTATTTTTAGAGACAGG - Intronic
905229114 1:36502037-36502059 GCTAATTTTTTTTTAGAGACAGG - Intergenic
905640537 1:39586631-39586653 ATTTATTTATTTTTAGAGACAGG - Intergenic
906119375 1:43378371-43378393 GCTAATTTTTTAGTAGAGACAGG + Intergenic
906347185 1:45024361-45024383 TTTAAATTTTTATTAGAGACAGG + Intronic
906485544 1:46232020-46232042 GTCATTTTATTTTTTAAGACAGG + Intergenic
906858542 1:49333718-49333740 ATAAATTTAAAATTAAAGACTGG + Intronic
907031477 1:51176633-51176655 CTTATTTTATTTTTACAGACAGG - Intergenic
907037745 1:51231056-51231078 ATTTATTTATTTTTAGAGACAGG - Intergenic
907322160 1:53611088-53611110 GTTATTTTATTTTTTGAGACAGG + Intronic
907352027 1:53839898-53839920 GTTCAATTATTATGAAAGAAGGG - Intergenic
907458256 1:54589791-54589813 GTTATTTTGTTATTCAAGTCAGG + Intronic
907771912 1:57473878-57473900 GTCTATTCATTCTTAAAGACAGG + Intronic
908066477 1:60411102-60411124 GTTAATTTAGAACTAAATACAGG - Intergenic
908183480 1:61629064-61629086 GAGAATTTATTATAAAAGAGAGG - Intergenic
908208234 1:61873176-61873198 ATTTATTTATTTATAAAGACAGG + Intronic
908948984 1:69536430-69536452 ATTAATTTATTTTTTGAGACAGG - Intergenic
909013363 1:70357988-70358010 ATTTATTTATTTTTAAAGACAGG - Intronic
909201952 1:72700886-72700908 ATTTATTTATTTTTAGAGACAGG - Intergenic
909572068 1:77125451-77125473 TTTAATTGATTATGAAACACTGG - Intronic
909625002 1:77705497-77705519 TTTTATTTATTTTTAAAGACAGG + Intronic
909665622 1:78128997-78129019 ATTTATTTATTTTTAGAGACAGG - Intronic
909707217 1:78600764-78600786 ATAAAATTATTATTAAAGAAAGG - Intergenic
909984844 1:82148369-82148391 TTTAATTTTTTTGTAAAGACAGG + Intergenic
910245621 1:85135238-85135260 GTTTGTTTGTTTTTAAAGACAGG + Intergenic
910930342 1:92437081-92437103 ATTAATTTTTTTTTAGAGACAGG + Intergenic
910967702 1:92824302-92824324 ATTAATTTATTTTTTAAGACAGG + Intergenic
911146444 1:94556912-94556934 TTTAATTTATTTTTTAAGACAGG + Intergenic
911367875 1:96961361-96961383 ATTAATTTTTTATTAGAGACAGG - Intergenic
911481624 1:98449503-98449525 GTTAATTTATTATTCATGATAGG + Intergenic
911784276 1:101925522-101925544 ATTAATTTATTCTTACAGACAGG + Intronic
911817805 1:102375863-102375885 GTTTATTTTTTAGTAGAGACGGG + Intergenic
911866117 1:103024301-103024323 ATTGATTTATTTGTAAAGACAGG + Intronic
912039244 1:105365620-105365642 ATTCATTTATTATTAACTACGGG + Intergenic
912099040 1:106183617-106183639 GTTATGTTATCATTAAAGTCTGG + Intergenic
912136331 1:106663682-106663704 GGTAATTTATTTTTAAAAAGAGG - Intergenic
912320741 1:108710624-108710646 ATTTATTTATTATTTGAGACAGG + Intergenic
912353732 1:109038671-109038693 GTTTATTTATTTTTTGAGACAGG - Intronic
912934579 1:113992134-113992156 TTTTATTTTTTATTTAAGACTGG + Intergenic
912998689 1:114557530-114557552 ATTAATTTTTTTTTAAAGACAGG + Intergenic
913051872 1:115123834-115123856 TTTAATTTTTTATTTAAAACTGG - Intergenic
913057748 1:115177965-115177987 GCTAATTTTTTTTTAAAGGCAGG - Intergenic
913262895 1:117016848-117016870 ATTTATTTATTTCTAAAGACTGG - Intronic
913298410 1:117344562-117344584 TTTATTTTTTTATTTAAGACAGG - Intergenic
913396639 1:118378686-118378708 GGTAATTTATTTATAAAGAAGGG - Intergenic
914743030 1:150481034-150481056 TTTATTTTATTTTTAGAGACGGG + Intergenic
914770940 1:150684351-150684373 TTTTATTTATTTTTAGAGACAGG + Intronic
914860361 1:151380977-151380999 GTTATTTTATTATTACAGTTTGG - Intergenic
915155473 1:153871942-153871964 ATTAATTTATTTTTTGAGACAGG - Intronic
915269096 1:154740286-154740308 GTTATTGTATTTTTAGAGACAGG + Intronic
915315610 1:155027036-155027058 TTTAATTTATTTTTTGAGACAGG + Intronic
915379295 1:155426068-155426090 ATTTATTTATTTTTTAAGACAGG + Intronic
915388238 1:155516751-155516773 TTTAATTTTTTTTTAGAGACAGG - Intronic
915427388 1:155837965-155837987 TTCAAATTATTAATAAAGACTGG + Intronic
915909268 1:159902245-159902267 TTTATTTTATTTTTCAAGACAGG - Intergenic
916161032 1:161914995-161915017 GTGAATTTACTAGTAATGACTGG - Intronic
916237252 1:162602761-162602783 GCTAATTTTTTAGTAGAGACGGG + Intergenic
916294270 1:163199810-163199832 ATTAATTGATTTTTAGAGACAGG + Intronic
916430987 1:164728150-164728172 GCTAATTTTTTAATTAAGACAGG - Intronic
917302303 1:173589070-173589092 CTTATTTTATTTTTAGAGACAGG - Intronic
917530738 1:175832810-175832832 TTTATATTTTTATTAAAGACAGG - Intergenic
917867363 1:179210033-179210055 TTAATTTTATTTTTAAAGACAGG + Intronic
918273765 1:182930613-182930635 ATATATTTTTTATTAAAGACAGG + Intronic
918273770 1:182930741-182930763 TTTTTTTTTTTATTAAAGACAGG + Intronic
918296645 1:183163182-183163204 GTTGAGATATTATTAAAGTCTGG + Intergenic
918317918 1:183338723-183338745 GGCAATTTATTATTAAACCCGGG + Intronic
918505562 1:185250130-185250152 TTTTATTTATTTTTAAAGACTGG + Intronic
918642479 1:186860177-186860199 ATTAATTTATTATGACAAACAGG + Intronic
918655161 1:187016684-187016706 GTTCATTTCTTGGTAAAGACAGG + Intergenic
918681240 1:187357056-187357078 TTTATTTTATTATAAAAAACTGG - Intergenic
918981308 1:191563175-191563197 CTTCATATATTATTAAGGACAGG - Intergenic
919055354 1:192563723-192563745 TTTATTTTATTTTTAGAGACAGG - Intergenic
919075301 1:192806316-192806338 GTTAATGTCTTTTAAAAGACAGG - Intergenic
919119743 1:193324338-193324360 TTTATTTTTTTAGTAAAGACGGG + Intergenic
919276238 1:195420332-195420354 TTTAATTTTTTAGTAGAGACAGG - Intergenic
919295998 1:195700853-195700875 ATTAATTTATTATAAAACATAGG - Intergenic
919706105 1:200677435-200677457 TTTAATTTATTTTTTGAGACAGG + Intergenic
919908439 1:202094535-202094557 GCTAATTTTTTAGTAGAGACAGG - Intergenic
919964209 1:202505020-202505042 ATTAATTTATCCTTAAAGAATGG + Intronic
920684364 1:208097873-208097895 TTTAAATTTTTAGTAAAGACAGG + Intronic
920717185 1:208351223-208351245 GTTAATTTATTATTAAAAGCAGG + Intergenic
921145337 1:212350825-212350847 GGTGATTTATTTTTAAAGAATGG + Intronic
921350422 1:214228980-214229002 GTTATTTTATAATTCAAGAAAGG - Intergenic
921378802 1:214502528-214502550 ATTTATTTATTTTTAGAGACAGG + Intronic
921434525 1:215102513-215102535 GTTAATCTGTTATTGAAGAAAGG + Intronic
921544652 1:216460233-216460255 ACTAATTTATTGTTATAGACAGG - Intergenic
922122791 1:222689733-222689755 GTTAATTTATTATTAAAGACAGG + Intronic
922125353 1:222715534-222715556 GTTATTTTTTTAGTAGAGACGGG - Intronic
922281924 1:224133680-224133702 GCTAATTTTTTAGTAGAGACGGG + Intronic
922303513 1:224324433-224324455 TTTATTTTATTTTTAGAGACAGG + Intronic
922394429 1:225182013-225182035 TTTTATTTTTTAGTAAAGACAGG - Intronic
922436599 1:225613720-225613742 CATATTTTATTATTAAAGATGGG + Intronic
922525592 1:226300543-226300565 GTTTATTTATTTTTTGAGACAGG - Intronic
922530920 1:226344411-226344433 ATTATTTTATTTTTTAAGACTGG - Intergenic
922825448 1:228514337-228514359 ATTAATATGTTGTTAAAGACAGG + Intergenic
922947061 1:229525665-229525687 GCTAATTTTTTAGTAGAGACAGG - Intronic
923002225 1:230016829-230016851 ATTCATTTATTATTTGAGACAGG + Intergenic
923095014 1:230768226-230768248 GTTATTTATTTATTAGAGACAGG - Intronic
923140439 1:231157979-231158001 CCTAATATATTATTAAAGGCTGG - Intergenic
924022367 1:239797874-239797896 GTTAATTTTTTTGTAGAGACAGG - Intronic
924370019 1:243337924-243337946 ATTTAATTATTATTAGAGACAGG + Intronic
924528231 1:244870928-244870950 ATTTATTTATTTTTAGAGACAGG - Intergenic
924588884 1:245384427-245384449 GTTAATTAATTCATCAAGACAGG + Intronic
924665454 1:246066923-246066945 GTGATTTTATAATTAAAGTCTGG + Intronic
924757774 1:246957207-246957229 TTGTATTTATTAGTAAAGACGGG - Intronic
1063244870 10:4207270-4207292 GTTCATTTATTATTAAACTAAGG + Intergenic
1063399170 10:5725224-5725246 GATAATTTTTTAGTACAGACAGG - Intronic
1063630400 10:7728385-7728407 TTTTATTTATTTTTGAAGACAGG + Intronic
1064186559 10:13167121-13167143 ATTTATTTATTTTTCAAGACAGG - Intronic
1064270937 10:13865454-13865476 TTTTATTTATTTTTATAGACAGG + Intronic
1064596986 10:16955198-16955220 GTGTATTTTTTATTAGAGACGGG - Intronic
1064652898 10:17527197-17527219 ATTAATTTATTTTTAGACACGGG - Intergenic
1064741786 10:18441640-18441662 TTTAAATTTTTTTTAAAGACAGG + Intronic
1064894773 10:20222814-20222836 TTTAATTTTTTTTTAAGGACAGG - Intronic
1065078179 10:22101792-22101814 TTAAATTTATTTTTAGAGACAGG + Intergenic
1065305115 10:24361189-24361211 GTTATTTTATTTTTTGAGACAGG + Intronic
1065353332 10:24815275-24815297 GTTTATTTTTTTGTAAAGACAGG - Intergenic
1065506206 10:26432520-26432542 TTTATTTTATTTTTAGAGACAGG - Intergenic
1065532981 10:26691164-26691186 ATTAATTTATTTTTTGAGACAGG + Intergenic
1065548613 10:26847448-26847470 GTTATTTTTTTGTTAAGGACAGG - Intronic
1065640979 10:27782450-27782472 TTTAAATTATTAGTAAAGATGGG - Intergenic
1065670268 10:28108649-28108671 TTTATTTTATTATTTGAGACAGG - Intronic
1065787850 10:29232720-29232742 TTTAATTTATTTTTAGAGTCAGG - Intergenic
1065888650 10:30101537-30101559 ATTAATTTTTTGTTAGAGACAGG + Intronic
1065929748 10:30469215-30469237 GTTAATTTTTTTGTAAAGACAGG + Intergenic
1066102010 10:32125981-32126003 TTTATTTTATTTTTAGAGACAGG - Intergenic
1066375338 10:34853185-34853207 GCTAATTTTTTGTTAGAGACAGG + Intergenic
1067114842 10:43427102-43427124 TTTAAATTTTTATTAGAGACAGG - Intergenic
1067250795 10:44585264-44585286 GTTAATTTACTATTGAACAAAGG - Intergenic
1067971567 10:50976576-50976598 TTTAATTTATTTTAAAAGTCAGG + Intergenic
1067998174 10:51299814-51299836 TTTAATTTACAATTAAAGTCAGG + Intronic
1068000141 10:51323944-51323966 TTTATTTTATTTTTAGAGACAGG - Intronic
1068437195 10:57008124-57008146 GTTGATTTATTTTTAAACCCAGG - Intergenic
1069010034 10:63362483-63362505 ATTTATTTATTTTTTAAGACAGG + Intronic
1069125727 10:64630030-64630052 GTTAATTTATTATTAAAAAAAGG + Intergenic
1069159197 10:65071314-65071336 ATTAATTTTTTATTGAAGACTGG + Intergenic
1069362397 10:67657672-67657694 TTTAAATTTTTATTAGAGACAGG - Intronic
1069505588 10:68995022-68995044 TTTATTTTATTTTTGAAGACGGG + Intronic
1069510746 10:69040690-69040712 TTTATTTTGTTTTTAAAGACAGG + Intergenic
1069516042 10:69078065-69078087 ATTTATTTCTGATTAAAGACAGG + Intergenic
1069644773 10:69986185-69986207 ATTAATTTATTAATAAAAAAAGG + Intergenic
1069935668 10:71914236-71914258 ATTTATTTATTAATAGAGACAGG + Intergenic
1070068480 10:73061758-73061780 TTTAATTTTTTTTTAGAGACAGG - Intronic
1070121712 10:73583741-73583763 TTTTTTTTATTTTTAAAGACAGG - Intronic
1070292490 10:75127955-75127977 TTTAATTTGTCAGTAAAGACCGG - Intronic
1070755593 10:78990780-78990802 TGTATTTTATTATTAGAGACGGG - Intergenic
1071023491 10:81084827-81084849 GTTAATTGATTACTACAGTCTGG + Intergenic
1071513213 10:86280187-86280209 TTGAATTTATTTTTAGAGACAGG - Intronic
1071552715 10:86579463-86579485 ATTTATTTATTTTTAAAGACAGG + Intergenic
1071772138 10:88741205-88741227 ATTTATTTATTTTTTAAGACAGG + Intronic
1071809272 10:89160912-89160934 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1072097811 10:92199517-92199539 GCTAATTTTTTAGTATAGACGGG - Intronic
1072126394 10:92449077-92449099 GTTATTTTTTTAGTAGAGACAGG + Intergenic
1072289933 10:93954753-93954775 GTTAATTTATTATTGAAGAAAGG + Intronic
1072363552 10:94685040-94685062 ATTAATTAATTAATAGAGACAGG + Intronic
1072829921 10:98646926-98646948 GTTTATTTACTATGAAAAACTGG - Intronic
1073202180 10:101744662-101744684 TTTATTTTATTTTTAGAGACAGG + Intergenic
1073394062 10:103203684-103203706 GTTAATTCACCATTAGAGACTGG + Intergenic
1073551472 10:104405930-104405952 GTTAATTTTTTTGTGAAGACAGG - Intronic
1074355552 10:112780263-112780285 ATTTATTTATTTTTAGAGACAGG - Intronic
1074498294 10:113999155-113999177 ATTTATTTATTATTTGAGACAGG - Intergenic
1074832945 10:117262673-117262695 GTTTATTTATTTTTAGAGACAGG + Intronic
1075046256 10:119148890-119148912 ATTTATTTATTTTTAGAGACAGG + Intronic
1075055193 10:119213138-119213160 ATTTATTTATTTTTAGAGACAGG - Intronic
1075350476 10:121720244-121720266 GGTAATTTATAAATAAAAACAGG + Intergenic
1075427678 10:122354418-122354440 GGTAATTTATTTTTAAAAAGAGG - Intergenic
1076001192 10:126914406-126914428 ATTTATTTATTTTTATAGACAGG + Intronic
1076553226 10:131301196-131301218 GTTCATTTAGTCTTCAAGACTGG + Intronic
1077097946 11:807312-807334 GCTAATTTTTTAGTAGAGACAGG - Intronic
1077637040 11:3849897-3849919 ATTTATTTATTTTTAGAGACAGG - Intergenic
1077920232 11:6636509-6636531 CTTTATTTATTTTTTAAGACAGG + Intronic
1078052450 11:7978609-7978631 TTTTATTTATTTTTCAAGACAGG + Intronic
1078655249 11:13232773-13232795 GATAATTTATTATTAAGGTACGG + Intergenic
1078776682 11:14400391-14400413 ATTTATTTATTTTTAAAGACAGG - Intergenic
1078805630 11:14698357-14698379 TTTAATTTCTTTTTAAAGATGGG + Intronic
1078904882 11:15674662-15674684 GTTAACTTATTAGTCAAGACAGG + Intergenic
1078955791 11:16193364-16193386 TTTATTTTTTTTTTAAAGACAGG - Intronic
1079061118 11:17249679-17249701 TTTAATTTATTTTTTGAGACAGG + Intronic
1079728778 11:23913887-23913909 GGTAATTTATTTTTAAAAAGAGG + Intergenic
1079841950 11:25414516-25414538 TTGAATTTATTAGTAGAGACGGG - Intergenic
1079878016 11:25885299-25885321 ATTTAATTATTATAAAAGACAGG + Intergenic
1080037811 11:27727698-27727720 ATTTATTTATTTTTAGAGACAGG + Intergenic
1080133096 11:28819440-28819462 GGTAATTTATTTTTAAAAAGAGG + Intergenic
1080369920 11:31624624-31624646 GTGAATTTCTTATTGAAGAAAGG - Intronic
1080410233 11:32016575-32016597 TTTAATTAATAATGAAAGACTGG + Intronic
1080436078 11:32246009-32246031 ATTTATTTATTTTTACAGACAGG + Intergenic
1080531093 11:33177365-33177387 TTAATTTTATTTTTAAAGACAGG - Intergenic
1080812372 11:35717386-35717408 GTTACTTTTTTTTTAAAGTCTGG + Intronic
1081232396 11:40601791-40601813 TTTAATTTATTGTTAAAGTAAGG - Intronic
1081278123 11:41176212-41176234 GTTAATTTATTTTTAAAACCTGG + Intronic
1081346574 11:41994770-41994792 GGTAATTTATTTTTAAAAAGAGG + Intergenic
1081975430 11:47231527-47231549 TTTATTTTATTTTTAGAGACAGG + Intronic
1082054780 11:47804963-47804985 ATTTATTTATTTTTAGAGACAGG - Intronic
1082946310 11:58764302-58764324 GGTAATTTATTTTTAAAAAGAGG - Intergenic
1083347253 11:62002250-62002272 GTTCATTTATTTTTTGAGACAGG + Intergenic
1083514115 11:63240475-63240497 GTTAATTTATTATTGAAGAAAGG - Intronic
1084133990 11:67160932-67160954 ATTTATTTATTTTTAGAGACAGG - Intronic
1084159485 11:67338327-67338349 ATTAATTTATTTTTTGAGACAGG - Intronic
1084793290 11:71488652-71488674 TTTGCTTTATTATTAGAGACAGG + Intronic
1085059593 11:73432738-73432760 GTTATTTTTTTAGTAGAGACGGG - Intronic
1085124320 11:73988320-73988342 GTTATTTTATTTTTAGAGATAGG + Intergenic
1085255678 11:75171427-75171449 TTTAATTTATTTGTAGAGACAGG + Intronic
1085381765 11:76126112-76126134 GCTAATTTTTTAGTAGAGACGGG + Intronic
1085383007 11:76137725-76137747 TTTAATTTTTTTTTAGAGACAGG - Intronic
1085580881 11:77649423-77649445 TTTATTTTAATTTTAAAGACAGG + Intergenic
1086208630 11:84291689-84291711 GTCAATTTGTTATTAAATATTGG + Intronic
1086320856 11:85646363-85646385 GCTTATTTTTTAGTAAAGACAGG - Intergenic
1086376069 11:86202110-86202132 GTAACTGTATTAGTAAAGACAGG + Intergenic
1086409776 11:86532886-86532908 GCTAATTTTTTAGTAGAGACGGG - Intronic
1086483267 11:87268285-87268307 ATTTATTTATTTGTAAAGACGGG + Intronic
1086846003 11:91750429-91750451 TTTATTTTATTTTTAGAGACAGG - Intergenic
1086874921 11:92084087-92084109 GGTAATTTATTTTTAAAAATTGG - Intergenic
1086930538 11:92688191-92688213 ATTAATTAATATTTAAAGACAGG - Intronic
1087193800 11:95284511-95284533 ATTACATTTTTATTAAAGACAGG - Intergenic
1087320537 11:96652607-96652629 GATAGTTTATTTTTATAGACAGG + Intergenic
1087635465 11:100696669-100696691 TTTATTTTATTTTTAGAGACAGG + Intronic
1088089018 11:106015867-106015889 TTTATTTTATTTTTAGAGACAGG + Intronic
1088127806 11:106449558-106449580 GCTAATTTTTTAGTAGAGACGGG + Intergenic
1088143806 11:106650205-106650227 GGTAATTTATTAATAAAAAGGGG + Intergenic
1088294877 11:108281969-108281991 ATTTATTTATTTTGAAAGACAGG + Intronic
1088324771 11:108590654-108590676 TTTATTTTATTTTTAAAGACAGG + Intronic
1088646115 11:111917831-111917853 TTTCTTTTATTTTTAAAGACAGG - Intronic
1088865074 11:113839715-113839737 GCTAATTTTTTAGTAGAGACAGG - Intronic
1089085953 11:115816802-115816824 ATTTATTTATTTTTAGAGACAGG - Intergenic
1089368283 11:117934506-117934528 TTTATTTTATTTTTAGAGACAGG - Intergenic
1089814138 11:121157589-121157611 ATTAATTTATTTTTAGAGACAGG - Intronic
1090036536 11:123254339-123254361 ATTTATTTATTTTTAGAGACAGG + Intergenic
1090347222 11:126081267-126081289 TTTATTTTATTTTTAGAGACTGG + Intergenic
1090652343 11:128818290-128818312 GTTAATTTATTATTGAAGAAAGG - Intergenic
1090936384 11:131346578-131346600 GTTAATATATTATTTAGGACAGG + Intergenic
1091490793 12:930963-930985 TTTTTTTTATTTTTAAAGACAGG - Intronic
1091695565 12:2625950-2625972 TTTATTTTATTTTTAGAGACAGG - Intronic
1091749396 12:3012956-3012978 ATTTATTTATTTTTAGAGACAGG + Intronic
1091762034 12:3093866-3093888 ATTTATTTATTTTTAAAGACAGG + Intronic
1091882941 12:3994269-3994291 GCTAATTTTTTAGTAGAGACAGG + Intergenic
1092001880 12:5039475-5039497 ATTTATTTATTTTTAAAGAAAGG + Intergenic
1092225945 12:6748466-6748488 GTTAATTTAATATTAAATTGGGG + Exonic
1092235182 12:6802905-6802927 TTTATTTTTTTATTAGAGACAGG + Intronic
1092343281 12:7694391-7694413 TTTAATTTTTTAGTAGAGACAGG - Intronic
1092346863 12:7722595-7722617 TTTAATTTATTTTTAGAGAAGGG - Intergenic
1092722014 12:11450699-11450721 GTAAATTTAATCTGAAAGACTGG - Intronic
1092809390 12:12258126-12258148 ATTTATTTATTTTGAAAGACAGG + Intronic
1093008303 12:14076570-14076592 GTTAATTTATTATTAAAGAAAGG + Intergenic
1093053262 12:14529187-14529209 ATTTATTTATTTTTAAAGACAGG - Intronic
1093430216 12:19076587-19076609 GTTTATTTATTTTTTGAGACAGG - Intergenic
1093750618 12:22794693-22794715 ATTTATTTATTTTTAGAGACAGG - Intergenic
1094105856 12:26810835-26810857 ATTTATTTATTTTTATAGACAGG + Intronic
1094138482 12:27154266-27154288 TTTAATTTATTTTTTGAGACAGG - Intergenic
1094525875 12:31230376-31230398 ATTAATTTATTTTTTGAGACAGG - Intergenic
1094549751 12:31439756-31439778 TTTATTTTTTTATTAGAGACAGG - Intronic
1094552286 12:31464136-31464158 GTTATTTTAATATTTAAGACAGG + Intronic
1095050664 12:37551456-37551478 GCTAATTTTTTTTTTAAGACAGG - Intergenic
1095054513 12:37583210-37583232 GTTTAAATATTAATAAAGACAGG - Intergenic
1095157240 12:38872241-38872263 TTTAATTTATTCTTAAAACCTGG - Intronic
1095833040 12:46608004-46608026 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1096065208 12:48734280-48734302 GCTAATTTTTTTGTAAAGACGGG + Intergenic
1096198483 12:49664397-49664419 GTTTATTTGTTTTTTAAGACAGG - Intronic
1096277709 12:50224733-50224755 TTTAATTTTTTTTTAGAGACGGG + Intronic
1096387193 12:51202500-51202522 TTTATTTTTTTAGTAAAGACGGG + Intronic
1097512152 12:60557184-60557206 TTTAATCTTTTATTAAATACTGG - Intergenic
1097764399 12:63508517-63508539 GTTATTTTATTTTTTGAGACAGG - Intergenic
1097765776 12:63525145-63525167 GCTAATTTTTTAGTAGAGACAGG - Intergenic
1097830589 12:64220937-64220959 GCTAATTTATTAGCAAAAACTGG - Intronic
1097846778 12:64374713-64374735 TTTAAATTTTTATTAGAGACAGG + Intronic
1098142085 12:67460156-67460178 CCTAATTTAGTAATAAAGACAGG - Intergenic
1098458085 12:70699450-70699472 ATTAATTTATTTTTAGAGATGGG + Intronic
1098619302 12:72573240-72573262 GTTATTTTAATTTTAAAGAATGG + Intronic
1099121750 12:78698326-78698348 ATTATTTTATTATTAAAGAAAGG - Intergenic
1099457245 12:82878864-82878886 ATTTATTTATTTTTAGAGACAGG - Intronic
1099462970 12:82946913-82946935 GTGTATTTTTTAGTAAAGACGGG + Intronic
1099615932 12:84935776-84935798 GTAAAAATATTATTATAGACAGG + Intergenic
1099667014 12:85644331-85644353 GTCAATTTTTTTTTAAATACTGG + Intergenic
1099679597 12:85808071-85808093 GTTAAATTATTATAGAAGGCAGG - Intronic
1099817108 12:87664048-87664070 GTTAATTTACTACTCCAGACAGG + Intergenic
1100020404 12:90062500-90062522 GCTAATTTATTAGTAGAGACAGG - Intergenic
1100465499 12:94840890-94840912 ATTTATTTATTTTTAAAGACGGG - Intergenic
1100480532 12:94973877-94973899 GTTATTTTATTATTAAATAAGGG + Intronic
1100583628 12:95959412-95959434 GTTAATTTTTTTTTAGAGACAGG + Intronic
1100805240 12:98276565-98276587 GTTAATTTTTTTTTTGAGACAGG - Intergenic
1100957411 12:99924294-99924316 ATTAATTTATTATTCAACACTGG + Intronic
1100977042 12:100133274-100133296 GGTAATTTATTTTAAAAGACAGG - Intronic
1101133325 12:101712026-101712048 TTTATTTTATTTTTCAAGACAGG + Intronic
1101620156 12:106378517-106378539 TTCAATTTATTATGAAAGTCTGG + Intronic
1101683066 12:106987723-106987745 GTTAATTTCTCCTTAAAGCCAGG + Intergenic
1101820663 12:108181612-108181634 GTTTATTTGTTTTTAGAGACAGG + Intronic
1101936353 12:109061152-109061174 GTTACATTAGGATTAAAGACAGG + Intronic
1102272391 12:111548892-111548914 TTTACTTTTTTAGTAAAGACGGG + Intronic
1102386930 12:112517648-112517670 ATTGATTTATTCTTAGAGACGGG + Intergenic
1102588358 12:113939298-113939320 ATTTATTTATTTTGAAAGACAGG - Intronic
1102691550 12:114765370-114765392 ATTAATTAATTTTTAAAGGCAGG - Intergenic
1102801220 12:115736063-115736085 GTTAATTTATTATTTAAGAAAGG - Intergenic
1102883682 12:116505996-116506018 TTTAATTTTTTAGTAGAGACGGG - Intergenic
1103329824 12:120146354-120146376 ATTAATTTACTTTTTAAGACAGG + Intronic
1103389047 12:120556977-120556999 GCTAATTTTTTAGTAGAGACGGG - Intronic
1103427285 12:120847296-120847318 ATTTATTTATTTTTTAAGACAGG + Intronic
1103514545 12:121498980-121499002 TTTAATTTTTTAGTAGAGACAGG + Intronic
1103598312 12:122037773-122037795 GTAAATTTTTTAGTAGAGACAGG - Intronic
1103705699 12:122870718-122870740 ATTTATTTATTTTTAGAGACAGG - Intronic
1103778048 12:123381049-123381071 TTTTATTTATTTTTTAAGACAGG - Intergenic
1103785381 12:123429159-123429181 TTTAATTTCTTTTTAGAGACAGG + Intronic
1103799035 12:123525221-123525243 ATTTATTTATTTTTAGAGACAGG + Intronic
1103982182 12:124743708-124743730 GCTAATTTTTTTTTAAACACTGG + Intergenic
1104098902 12:125587744-125587766 GCTTATTTATTTTTAGAGACTGG - Intronic
1104333815 12:127873435-127873457 GTTAAACTACTATTAAATACAGG - Intergenic
1104737811 12:131149539-131149561 ATTAATTAATTTTTAGAGACAGG + Intergenic
1105285606 13:19001010-19001032 TGTAATTTTTTATTAGAGACAGG + Intergenic
1105362127 13:19729552-19729574 GTTACTAAAATATTAAAGACAGG + Intronic
1105493146 13:20906659-20906681 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1105524611 13:21165414-21165436 ATTTATTTATTTTTAGAGACAGG - Intronic
1105621178 13:22067985-22068007 TTTCATTTTTTTTTAAAGACAGG - Intergenic
1105887972 13:24658809-24658831 ATTTATTTATTTTTTAAGACAGG - Intergenic
1106237421 13:27875366-27875388 ATTTATTTATTTTAAAAGACAGG + Intergenic
1106257326 13:28033288-28033310 GTTGTTTTATTTTTAGAGACAGG - Intronic
1106328127 13:28714436-28714458 TTAAATTTATTTTTAGAGACAGG - Intronic
1106722604 13:32451545-32451567 ATTAATTTATTTTTGGAGACAGG + Intronic
1106754956 13:32813454-32813476 GTGGATTTATTAGTAAAGCCAGG - Intergenic
1106758477 13:32845253-32845275 TTTTTTTTATTTTTAAAGACAGG - Intergenic
1106941722 13:34787458-34787480 GCTAATTTTTTAGTAGAGACAGG - Intergenic
1107080837 13:36373208-36373230 GTTTCTTTATTTTTTAAGACAGG + Intergenic
1107132251 13:36909557-36909579 GTTATTTTATTATTTAAGTTTGG + Intronic
1107172934 13:37364675-37364697 TTAAATTTATCATTAAAGAATGG - Intergenic
1107206573 13:37797171-37797193 ATTAATTTATTTTTTAAGACAGG - Intronic
1107625184 13:42274510-42274532 TTTTATTTTTTAGTAAAGACAGG - Intronic
1107757870 13:43645324-43645346 GTTAATTTTTTTTTTAAGAGAGG + Intronic
1107858658 13:44640032-44640054 ATTTATTTATTTTTAAAGACAGG + Intergenic
1107870600 13:44743175-44743197 TTTTATTAATTAATAAAGACAGG + Intergenic
1107921327 13:45211438-45211460 ATTTATTTATTTTTAGAGACAGG + Intronic
1108047937 13:46400829-46400851 GCTAATTTTTTAGTACAGACGGG - Intronic
1108201468 13:48048357-48048379 TTTAAATTATTCATAAAGACAGG - Intergenic
1108357205 13:49638884-49638906 ATTTATTTATTTTTAGAGACGGG + Intergenic
1108371246 13:49771458-49771480 GTTATTTTGTTTTTTAAGACGGG + Intronic
1108737481 13:53299521-53299543 ATTTATTTATTTTTAGAGACAGG + Intergenic
1108758675 13:53535119-53535141 GTCAATTTATCATAAAAGACAGG - Intergenic
1108973985 13:56413147-56413169 ATTAATTAATTATTAATTACTGG - Intergenic
1109160651 13:58969536-58969558 GGTAATTTATAAATAAAGAGAGG - Intergenic
1109183212 13:59239339-59239361 GTTAATGTATTATAAAACTCAGG + Intergenic
1109261485 13:60150025-60150047 GTTTATTTATTTTTTGAGACAGG + Intronic
1109511676 13:63384534-63384556 ATTTATTTATTTTTAGAGACAGG + Intergenic
1109644146 13:65230866-65230888 GATAATTTATGAGTACAGACTGG - Intergenic
1109646638 13:65266136-65266158 ATTTATTTATTTTTAGAGACAGG - Intergenic
1109825157 13:67709476-67709498 GTTAATTTACTTTGAAAGTCAGG - Intergenic
1110164737 13:72426839-72426861 TTTAATTTCTTTTTAAAGATAGG - Intergenic
1110216887 13:73033583-73033605 TTTAATTTTTTAATAGAGACAGG - Intergenic
1110240031 13:73256727-73256749 GCTAATTTTTTAGTAGAGACAGG + Intergenic
1110266497 13:73543403-73543425 TTTAATTTATTTTTAGAGATGGG + Intergenic
1110344006 13:74425037-74425059 TTTATTTTATTTTTTAAGACAGG + Intergenic
1110669876 13:78165276-78165298 ATTTATTTATTATTTGAGACAGG + Intergenic
1110693339 13:78457780-78457802 ATTAATTTTTTTTTAGAGACAGG + Intergenic
1110850841 13:80242791-80242813 GTTAATTTATTATTGAAGAAAGG + Intergenic
1111406137 13:87810324-87810346 CTTATTTTATAATTAAAGTCTGG + Intergenic
1112089098 13:96063717-96063739 GTTAATTTATTCTTTAAAATTGG + Intergenic
1112323798 13:98430068-98430090 ATTTATTTATTTTTAGAGACAGG - Intronic
1112503956 13:99963183-99963205 GTTTATTTATTATGAAACAAAGG - Exonic
1112558087 13:100487728-100487750 ATTAATTTATTTTTTGAGACAGG + Intronic
1112672047 13:101652099-101652121 ATTTATTTATTTTTAGAGACAGG + Intronic
1112683693 13:101797277-101797299 GTTTATTTATCTTTATAGACAGG + Intronic
1113112868 13:106842772-106842794 ATTTATATATTATTATAGACAGG + Intergenic
1113154096 13:107298174-107298196 GTGTATTTTTTATTAGAGACGGG - Intronic
1113477168 13:110592288-110592310 ATTTATTTATTTTTAAAAACAGG + Intergenic
1113542168 13:111116976-111116998 GTGAAATTATGATTTAAGACAGG + Intronic
1113722186 13:112567596-112567618 GTGCATGTATTATTTAAGACGGG - Intronic
1113729706 13:112632260-112632282 TTTGAATTTTTATTAAAGACAGG - Intergenic
1113827922 13:113271059-113271081 ATTAATTTATTTTTTGAGACAGG - Intergenic
1114457996 14:22869438-22869460 ATTAATTTATTTTTTGAGACAGG - Intergenic
1114878160 14:26749655-26749677 GTTTGTTTATTTTTAAATACAGG - Intergenic
1114942492 14:27631475-27631497 GTTAATTTATTATTAAAATGTGG - Intergenic
1115001328 14:28423100-28423122 ATTTATTTATTTTTAGAGACAGG - Intergenic
1115187784 14:30711182-30711204 GTTAATTCATTTTTAAAGGAGGG - Intronic
1115317973 14:32046166-32046188 TTTAATTTATTTGTAGAGACAGG - Intergenic
1115605933 14:35002346-35002368 GTTTGTTTTTTTTTAAAGACAGG - Intronic
1115735826 14:36328721-36328743 ATTTATTTATTTTTAGAGACAGG + Intergenic
1115773797 14:36693637-36693659 ATTTATTTATTTTTTAAGACAGG + Intronic
1115896855 14:38098795-38098817 ATTTATTTATTTTTAGAGACAGG - Intergenic
1116421795 14:44741801-44741823 GTTTATCTATTATGAAAGATTGG + Intergenic
1116482135 14:45404018-45404040 TTTTATCTATGATTAAAGACTGG - Intergenic
1116627407 14:47282941-47282963 TTTATTTATTTATTAAAGACAGG - Intronic
1116822983 14:49643757-49643779 GTTAATTGATTTTTAAAAACAGG + Intronic
1116885360 14:50215530-50215552 GTTAATCTACTGTTAAAGACTGG - Intronic
1117046059 14:51814744-51814766 ATTGATTTATTCTTAGAGACAGG + Intergenic
1117428915 14:55631842-55631864 TTTAGTTTATTATTACATACTGG + Intronic
1117563655 14:56971057-56971079 ATTTATTTATTTTTCAAGACAGG + Intergenic
1117929195 14:60822431-60822453 TTAAATTTATTTTTAGAGACAGG + Intronic
1118173630 14:63414287-63414309 TTTATTTTATTTTTAGAGACAGG + Intronic
1118211726 14:63771724-63771746 GTTATTTTTTTAGTAGAGACAGG - Intergenic
1118225173 14:63891907-63891929 ATTAATTTATTATTACAAATGGG - Intronic
1118391349 14:65298442-65298464 ATTTATTTATTTTTAGAGACAGG + Intergenic
1118417170 14:65553114-65553136 TTTAATTTATTTATAGAGACAGG + Intronic
1118470838 14:66074062-66074084 TTTAAATTTTTAGTAAAGACGGG - Intergenic
1119036906 14:71237965-71237987 GTTAGTTTTTTATTTAATACTGG - Intergenic
1119199281 14:72741030-72741052 ATTTATTTATTTTTAGAGACGGG - Intronic
1119355632 14:74004097-74004119 ATTAATTTATTTTTTGAGACAGG - Intronic
1119441738 14:74632963-74632985 ATTAATTTATTTTTTGAGACAGG - Intergenic
1119540220 14:75433028-75433050 GCTAATTTTTTAGTAGAGACGGG - Intronic
1119581890 14:75791912-75791934 TTTATTTTATTTTTAGAGACAGG + Intronic
1119710212 14:76816619-76816641 GTGAATTTATGATTTCAGACGGG - Intronic
1119796193 14:77399442-77399464 GTTATTTTATTTTTTGAGACAGG - Intronic
1120191837 14:81446738-81446760 TTTAATTTATTTGTAGAGACAGG + Intergenic
1120793970 14:88610755-88610777 ATTATTTTATTATTTGAGACAGG - Intronic
1120810613 14:88799554-88799576 GATAATTTTTTTTTAAAGACAGG - Intergenic
1120908973 14:89647967-89647989 GTTAATTTATTCTTTGAGTCTGG + Intergenic
1121095098 14:91212694-91212716 CTTCATTTTTTAATAAAGACAGG - Intronic
1121095161 14:91213128-91213150 TTTCATTTTTTAATAAAGACAGG - Intronic
1121207814 14:92184036-92184058 TTTAATTTTTTAGTAGAGACGGG + Intergenic
1121474952 14:94190434-94190456 GCTAATTTTTTAGTAAAGACAGG - Intronic
1121657068 14:95604956-95604978 GTTTTTTTCTTTTTAAAGACAGG + Intergenic
1122569161 14:102683114-102683136 GTTAATTGATTTTTAAACAGTGG + Intronic
1122754130 14:103964235-103964257 GTTTATTTATTTTTAGACACAGG - Intronic
1123156997 14:106236538-106236560 ATTTATTTATTATAAATGACGGG + Intergenic
1123188081 14:106539306-106539328 ATTAATTTATTATAAATGACGGG + Intergenic
1123680500 15:22759672-22759694 TTTAATTTATTAACAAATACTGG - Intergenic
1123744127 15:23305281-23305303 TTTAATTTATTAACAAATACTGG - Intergenic
1124073259 15:26415245-26415267 GCTAATTTTTTAGTAGAGACAGG - Intergenic
1124268217 15:28256434-28256456 GTTTATGTATTTTTAAAAACTGG + Intronic
1124332718 15:28834132-28834154 TTTAATTTATTAACAAATACTGG - Intergenic
1124418431 15:29493608-29493630 ATTTATTTATTTTTAGAGACAGG - Intronic
1125495639 15:40190606-40190628 TTTATTTTATTTTTAGAGACAGG - Intronic
1125496023 15:40194833-40194855 GTTAATTTCTTTTTATATACTGG + Intronic
1125539735 15:40463297-40463319 ATTTATTTATTTTTAGAGACAGG - Intronic
1125651698 15:41322265-41322287 ATTTATTTATTTTTTAAGACGGG - Intronic
1125695758 15:41636142-41636164 TTTAATTTTTTTTTATAGACAGG + Intronic
1125824439 15:42664214-42664236 ATTATTTTATTTTTAGAGACAGG + Intronic
1125959749 15:43819702-43819724 GTGTATTTTTTAGTAAAGACAGG + Intronic
1125988752 15:44083946-44083968 CTTAATGTATTATTAATGAAAGG - Intronic
1126019047 15:44381821-44381843 ATTTATTTATTTTTAGAGACGGG + Intronic
1126023593 15:44425631-44425653 ATTTATTTATTTTTAGAGACAGG - Intergenic
1126512829 15:49500197-49500219 GTTAGTTCGTTTTTAAAGACAGG - Intronic
1126749071 15:51858056-51858078 ATTTATTTATTTTTAGAGACAGG + Intronic
1126824535 15:52536135-52536157 TTTAATATATTATTAATCACAGG + Intergenic
1127053345 15:55107386-55107408 ATTTATTTATTTTTAGAGACAGG - Intergenic
1127058821 15:55161370-55161392 ATTAATTTTTTATAAAAGAAAGG + Intergenic
1127124768 15:55801256-55801278 GCTAATTTTTTAGTAGAGACGGG + Intergenic
1127208570 15:56747031-56747053 GTTAATTTCTTATTATAGAATGG + Intronic
1127422424 15:58819516-58819538 TTTATTTTATTTTTAGAGACAGG + Intronic
1127539445 15:59922415-59922437 ATTTATTTATTTTTAGAGACAGG + Intergenic
1127571631 15:60249356-60249378 GTTAATTTATACATTAAGACAGG - Intergenic
1127853123 15:62932892-62932914 TTTATTTTATTTTTAGAGACAGG + Intergenic
1127938146 15:63663628-63663650 TTTAATTTTTTTGTAAAGACAGG + Intronic
1127984114 15:64055373-64055395 TTTAAATCTTTATTAAAGACAGG - Intronic
1128294568 15:66506802-66506824 ATTTATTTATTTTTAGAGACGGG - Intronic
1128486013 15:68089883-68089905 TTTATTTTATTATTTGAGACAGG + Intronic
1128490969 15:68143881-68143903 GTTAATTTTTGCTTAAAGACAGG + Intronic
1128575442 15:68771348-68771370 CTTAATTAATTTTTAGAGACAGG - Intergenic
1128831580 15:70774243-70774265 GTTATATCAATATTAAAGACTGG + Intergenic
1128969443 15:72094514-72094536 ATTTATTTATTTTTAGAGACAGG + Intronic
1128973958 15:72134571-72134593 TTTATTTTTATATTAAAGACAGG - Intronic
1129610218 15:77047824-77047846 GTTATTTGATTTTAAAAGACAGG + Intronic
1129781795 15:78277187-78277209 GTTCATTTATTTTTTGAGACAGG + Intronic
1130046936 15:80452941-80452963 TTTATTTTATTTTTAGAGACAGG + Intronic
1130128943 15:81119882-81119904 TTTAATTTTTTTTTAAAGACAGG - Intronic
1130319111 15:82825117-82825139 TTTATTTTTTTATTAGAGACAGG - Intronic
1130343645 15:83021580-83021602 GTTATATTTTTAGTAAAGACAGG - Intronic
1130422963 15:83766724-83766746 GTTATTTTCTTCTTAAAGAAGGG - Intronic
1130461643 15:84163641-84163663 GTTAAATTATTATTATAGGCTGG - Intergenic
1131110783 15:89763563-89763585 ATTTATTTATTTTTTAAGACTGG - Intronic
1131242593 15:90759776-90759798 TTTATATTATTAGTAAAGACGGG + Intronic
1131540669 15:93272434-93272456 GTTTATTTATTATTTGAGACAGG + Intergenic
1131634142 15:94212091-94212113 TTTAATTTGTTATTAATGAGAGG - Intergenic
1131875311 15:96799539-96799561 AGTAATTTAATATTAAAGCCTGG - Intergenic
1132489940 16:222464-222486 GTTAATTTTTTCATAGAGACAGG - Intronic
1132595052 16:745301-745323 TTTATATTTTTATTAAAGACGGG + Intronic
1132979390 16:2728388-2728410 TTTAATTTATTTTTTGAGACAGG + Intergenic
1133067820 16:3221818-3221840 GTTAATTTTTTCTTTGAGACTGG - Intergenic
1133100212 16:3474950-3474972 ATTTATTTATTTTTAGAGACAGG + Intronic
1133122887 16:3622047-3622069 GTTATATTTTTAGTAAAGACGGG - Intronic
1133652085 16:7821950-7821972 GTTTATTTATTTTTCAAGACAGG - Intergenic
1133662642 16:7933840-7933862 TTTATTTTTTTATTAGAGACGGG + Intergenic
1134113003 16:11527574-11527596 TTTCATTTATTTTAAAAGACAGG + Intergenic
1134162823 16:11905661-11905683 TTTAATTTTTTAGTAGAGACGGG - Intronic
1134184915 16:12077099-12077121 GTTGTTTTATTTGTAAAGACAGG - Intronic
1134276950 16:12785253-12785275 TTTAATTTATTTTTACAGATGGG + Intronic
1134535806 16:15025954-15025976 ATTTAATTATTATTAAAGACAGG - Intronic
1134665773 16:16017595-16017617 ATTAATTAATAATTAAAGATGGG + Intronic
1134745316 16:16583452-16583474 TTTAATTTTTTTTTAGAGACAGG + Intergenic
1134788061 16:16962900-16962922 TTTAAATTTTTATTAGAGACTGG - Intergenic
1134816027 16:17206728-17206750 ATTTATTTATTTTTAGAGACAGG - Intronic
1135000156 16:18770313-18770335 TTTAATTTTTTTTTAGAGACAGG - Intergenic
1135090102 16:19507131-19507153 ATTTATTTATTTTAAAAGACGGG - Intronic
1135162586 16:20110488-20110510 TTAAAATTATTTTTAAAGACAGG + Intergenic
1135487712 16:22880432-22880454 GTTAAATTAAAATTAAAAACTGG + Intronic
1135517455 16:23147923-23147945 TTTATTTTATTTTTAGAGACAGG - Intronic
1135525533 16:23211030-23211052 CTTTTTTTATTTTTAAAGACAGG - Intronic
1135667273 16:24346570-24346592 CTTTATTTTTTATTAGAGACAGG - Intronic
1135748046 16:25034045-25034067 ATTAATTTATTTTTTGAGACAGG + Intergenic
1135802667 16:25512607-25512629 AGGAATTTGTTATTAAAGACTGG - Intergenic
1135874005 16:26180451-26180473 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1135908691 16:26539596-26539618 GTTATTTTTTTAGTAGAGACGGG + Intergenic
1135980181 16:27141260-27141282 ATTTATTTATTTTTAGAGACAGG + Intergenic
1136052697 16:27663981-27664003 TTTAATTTTTTCTTAGAGACAGG + Intronic
1136058473 16:27708192-27708214 TTTAATTTTTTTGTAAAGACAGG + Intronic
1136184760 16:28580852-28580874 TTTAATTTTTTTGTAAAGACGGG + Intronic
1136332390 16:29588856-29588878 GCTAATTTTTTATTAGAGACCGG - Intergenic
1136513702 16:30755232-30755254 ATTTATTTATTTTTAGAGACAGG - Intronic
1136634508 16:31511164-31511186 TTTAATTTTTTTTAAAAGACAGG + Intergenic
1136715273 16:32276157-32276179 ATTTATTTATTTTTAGAGACAGG + Intergenic
1136752642 16:32653571-32653593 ATTTATTTATTTTTAGAGACAGG - Intergenic
1136821949 16:33326871-33326893 ATTTATTTATTTTTAGAGACAGG + Intergenic
1136828512 16:33383410-33383432 ATTTATTTATTTTTAGAGACAGG + Intergenic
1136833578 16:33482183-33482205 ATTTATTTATTTTTAGAGACAGG + Intergenic
1137242861 16:46673140-46673162 TTTTATTTTTTATTAGAGACGGG + Intronic
1137260800 16:46828099-46828121 GCTAATTTTTTAGTAGAGACAGG + Intronic
1137289310 16:47041086-47041108 TTTACTTTATTTTTAGAGACAGG - Intergenic
1137417836 16:48301344-48301366 ATTTATTTATTTTTTAAGACAGG + Intronic
1137608010 16:49799793-49799815 TTTATTTTATTTTTTAAGACAGG + Intronic
1137728517 16:50673127-50673149 TTTAATTTTTTAGTAGAGACAGG - Exonic
1137728716 16:50674253-50674275 ATTTATTTATTTTTAGAGACAGG + Intronic
1137889313 16:52141810-52141832 ATTTATTTATTTTTAAAGAGTGG - Intergenic
1138871883 16:60900035-60900057 ATTAATTTTTTGTTAAAAACTGG + Intergenic
1139164091 16:64545708-64545730 GTTCATTTATTTTTAGAGACAGG - Intergenic
1139204179 16:65010141-65010163 GCTAATTTATAGTTAGAGACAGG + Intronic
1139273429 16:65704669-65704691 TTTAATTTTTTAGTAAAGATAGG - Intergenic
1139333857 16:66216854-66216876 CTTTATTTATTTTTAGAGACAGG + Intergenic
1139394103 16:66626296-66626318 GCTAATTTTTTAGTAGAGACGGG - Intronic
1139404278 16:66706053-66706075 TTTAATTTATTTTTTGAGACAGG - Intergenic
1139598671 16:67972902-67972924 TTTCATTTTTTTTTAAAGACAGG + Intergenic
1139618781 16:68119680-68119702 GTTAATTTAATAGGAAAGTCTGG - Intronic
1139674876 16:68516742-68516764 ATTAATTTATTTTTTGAGACAGG - Intergenic
1139746002 16:69075011-69075033 GCTAATTTTTTAGTAGAGACGGG + Intronic
1139795985 16:69483294-69483316 TTTAATTTTTTAGTAGAGACGGG - Intergenic
1139835646 16:69836614-69836636 ATTAATTTATTTTTTGAGACAGG + Intronic
1139860247 16:70014836-70014858 ATTTAATTATTATTAAAGACAGG + Intergenic
1139873627 16:70127614-70127636 CTTAATTTCTTAGTAGAGACGGG - Intronic
1139878628 16:70166029-70166051 GTTAATTTATTTTTTGAGACAGG - Intergenic
1140286950 16:73612500-73612522 GTTTATTTATTATTTGAAACTGG - Intergenic
1140358929 16:74328784-74328806 GTTAATTTATTTTTTGAGACAGG + Intergenic
1140362151 16:74353528-74353550 CTTAATTTCTTAGTAGAGACGGG + Intergenic
1140373882 16:74429463-74429485 GTTAATTTATTTTTTGAGACAGG + Intergenic
1140441079 16:74988294-74988316 TTTAATTTTTTTTTAGAGACAGG - Intronic
1140739405 16:77927702-77927724 GCTAATTTTTTAGTAGAGACGGG - Intronic
1140777294 16:78261397-78261419 ATTTATTTATTTTTAGAGACAGG - Intronic
1140927320 16:79596676-79596698 TTTCATTTCTTTTTAAAGACAGG + Intronic
1141155131 16:81592173-81592195 CTTAATTTTTTATAAAAGAAAGG + Intronic
1141404482 16:83779850-83779872 GTTATTTTATTTTTTGAGACAGG - Intronic
1141413647 16:83853724-83853746 TTTATATTATTAGTAAAGACGGG + Intergenic
1141585565 16:85031307-85031329 GTTTATTTTTTGGTAAAGACGGG - Intronic
1142163034 16:88569227-88569249 GTTAATTTTTTTGTAGAGACAGG + Intergenic
1142416470 16:89946075-89946097 ATTTATTTATTTTTAGAGACAGG + Intergenic
1202994050 16_KI270728v1_random:39766-39788 ATTTATTTATTTTTAGAGACAGG + Intergenic
1203011338 16_KI270728v1_random:242339-242361 ATTTATTTATTTTTAGAGACAGG - Intergenic
1203054781 16_KI270728v1_random:913612-913634 ATTTATTTATTTTTAGAGACAGG - Intergenic
1203139381 16_KI270728v1_random:1750424-1750446 TTTAATTTAATTTTAGAGACAGG + Intergenic
1142501817 17:337270-337292 TTTAATTTTTTGGTAAAGACAGG + Intronic
1142561004 17:808846-808868 TTTAATTTTTTAGTAGAGACGGG + Intronic
1143170119 17:4924289-4924311 ATTAATTAATTTTTAGAGACAGG + Intergenic
1143300531 17:5906794-5906816 GTTAATTTATTACTAAGAAAAGG - Intronic
1143533220 17:7518473-7518495 GCTAATTTTTTAGTAGAGACTGG + Intergenic
1143612593 17:8028171-8028193 GTTTGTTTGTTTTTAAAGACAGG + Intergenic
1143859660 17:9879489-9879511 GTTAATTTTTTTTAAGAGACAGG - Intronic
1144067474 17:11637589-11637611 TTTATTTTATTTTTAGAGACAGG - Intronic
1144318317 17:14086363-14086385 GTTAATGATTTATTAAAAACTGG - Intronic
1144338122 17:14290076-14290098 ATTTATTTATTATTTGAGACAGG - Intergenic
1144368655 17:14569398-14569420 GATAATTTATTTTTAAAAAGAGG + Intergenic
1144637518 17:16919790-16919812 GCTAATTTTTTAGTAAAAACAGG + Intergenic
1144692245 17:17275257-17275279 GTTTTTTTATTAGTAGAGACAGG + Intronic
1144741592 17:17585907-17585929 TTTAATTTTTTAGTAGAGACGGG - Intronic
1144997177 17:19278145-19278167 ATTTATTTATTTTTAGAGACGGG + Intronic
1145036904 17:19547456-19547478 CTTCATTTATTTTTAGAGACTGG - Intronic
1145275681 17:21428493-21428515 CTTAATTTTTTTTTAGAGACAGG + Intergenic
1145284130 17:21491210-21491232 ATTTATTTATTTTTAGAGACAGG - Intergenic
1145393318 17:22474309-22474331 ATTTATTTATTTTTAGAGACAGG + Intergenic
1145820875 17:27834096-27834118 GTTAATTTATTATTGAAGAAAGG - Intronic
1146357155 17:32143533-32143555 GTTAACTTATTAATAACCACAGG + Intronic
1146392373 17:32434459-32434481 ATTAATTTATTTTTAAAAAGTGG - Intergenic
1146644213 17:34566121-34566143 ATTAATTTCTTATTAGAGAAAGG + Intergenic
1146734062 17:35222254-35222276 ATTTATTTATTAGTAGAGACAGG - Intergenic
1146781854 17:35681403-35681425 GTTTTTGTATTTTTAAAGACAGG + Intronic
1146985853 17:37217088-37217110 TTTGATTTTTTAGTAAAGACGGG - Intronic
1147125684 17:38366498-38366520 GTTTATTTATTTTTAGAGACAGG + Intronic
1147273820 17:39298118-39298140 ATTTATTTATTTTTAGAGACAGG + Intronic
1147357752 17:39910995-39911017 TTTAATTTATTAATAAAAAAGGG + Intronic
1147477462 17:40726007-40726029 GGTAATTTATTTTTAAAAAGAGG - Intergenic
1147716416 17:42511796-42511818 GCTAATTTTTTAGTAAAGATGGG - Intronic
1147764202 17:42822706-42822728 ATTAATTTATTTTTTGAGACAGG + Intronic
1147948679 17:44094965-44094987 TTTAATTTTTTAGTAGAGACAGG + Intronic
1147997822 17:44370712-44370734 TTTAATTTTTTTTTAGAGACAGG + Intergenic
1147998193 17:44372936-44372958 TTTATTTTATTTTTAGAGACAGG + Intronic
1148014177 17:44509428-44509450 TTTATTTTATTTTTATAGACAGG - Intergenic
1148387816 17:47247784-47247806 ATTCATTTATTTTTAGAGACAGG + Intergenic
1148713838 17:49701335-49701357 TTTATTTTATTAAAAAAGACTGG + Exonic
1148880718 17:50724346-50724368 TTTTATTTTTTATTAGAGACAGG - Intronic
1149306467 17:55351697-55351719 CATAATTTTTTATTGAAGACTGG - Intergenic
1149706585 17:58700446-58700468 ATTAATTTATTTTTTAAGATGGG + Intronic
1150011006 17:61503548-61503570 GTTAATTTATTATTAAAGCTGGG - Intergenic
1150016147 17:61559395-61559417 TTTACTTTTTTAGTAAAGACAGG + Intergenic
1150052807 17:61981191-61981213 TTTAAATTTTTAGTAAAGACGGG + Intronic
1150172414 17:63012655-63012677 TTTATTTTATTTTTAGAGACAGG + Intronic
1150439299 17:65178507-65178529 ATTCATTTATTATTTGAGACAGG + Intronic
1151004477 17:70417973-70417995 TTTGATTTATTATTAGAGAGAGG + Intergenic
1151098215 17:71523745-71523767 TTTTATTTATTATTTGAGACAGG + Intergenic
1151779630 17:76236001-76236023 AATAATTTATTTTTAGAGACAGG - Intronic
1151864826 17:76794310-76794332 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1151893959 17:76967811-76967833 GGTACTTTATTTTTAGAGACAGG + Intergenic
1151950810 17:77352668-77352690 TTTAATTTATTTTTAGGGACAGG + Intronic
1153242123 18:3040766-3040788 TTTAATTTTTTTGTAAAGACAGG - Intergenic
1153640226 18:7150393-7150415 TTTAATTTATTTTTTGAGACAGG + Intergenic
1153694492 18:7626696-7626718 ATTTATTTATTTTTAGAGACAGG + Intronic
1153751025 18:8230933-8230955 GTTTATTTTTTATTAAAGAAGGG - Intronic
1153802173 18:8681137-8681159 TTTAATTTTTTTGTAAAGACAGG + Intergenic
1154137967 18:11797101-11797123 GTAATTTTTTTAGTAAAGACGGG + Intronic
1154226929 18:12513846-12513868 ATTTATTTATTTTTAGAGACAGG + Intronic
1154313632 18:13286376-13286398 ATTTATTTATTTTTAGAGACAGG + Intronic
1154983406 18:21523552-21523574 GATAAGATATTCTTAAAGACTGG - Exonic
1155275797 18:24186060-24186082 TTTATTTTATTTTTTAAGACAGG - Intronic
1155281609 18:24246205-24246227 ATTTATTTATTTTTCAAGACGGG - Intronic
1155296046 18:24385383-24385405 ATTTATTTATTTTTAGAGACAGG - Intronic
1155492377 18:26412208-26412230 TTTAATTTTTTAGTAGAGACGGG - Intergenic
1155603662 18:27577801-27577823 GTTAAATTATTTTTACAGAGAGG - Intergenic
1155861018 18:30899675-30899697 CTTAGTTTATTATTGATGACTGG - Intergenic
1155917957 18:31574264-31574286 TTTAAATTATTATTTGAGACAGG - Intergenic
1155998066 18:32352969-32352991 GTCAATTTTTTATTAATGAGAGG + Intronic
1156021996 18:32610083-32610105 GTTTATTTCTTTTTAAATACTGG - Intergenic
1156325299 18:36069268-36069290 TTTAAATTTTTAGTAAAGACAGG - Intergenic
1156914675 18:42451668-42451690 GGTAATTTATTATAATATACAGG - Intergenic
1157010501 18:43642918-43642940 TTGAATTAATTATTCAAGACAGG + Intergenic
1157251931 18:46102938-46102960 TTTATTTTATTTTTAGAGACAGG - Intronic
1157537406 18:48470137-48470159 GTTGCTTTATTTTTAAAGATTGG - Intergenic
1157625424 18:49046886-49046908 GTTTAATTATTTTTAGAGACAGG - Intronic
1157670770 18:49526690-49526712 ATTAATTTATTTTTTGAGACAGG + Intergenic
1157818240 18:50746676-50746698 GCTAATTTTTTAGTAGAGACAGG + Intergenic
1157987104 18:52450503-52450525 CTTAATTTATTGTTCAAAACAGG - Intronic
1158089893 18:53698471-53698493 ATTCATTTATTTTTTAAGACAGG - Intergenic
1158255749 18:55546331-55546353 TTTTATTTAGTTTTAAAGACAGG - Intronic
1158479179 18:57805149-57805171 GTTTATTTATTTATAGAGACAGG + Intergenic
1158969596 18:62654243-62654265 TTTATTTTATTTTTAGAGACAGG - Intergenic
1159710324 18:71750033-71750055 ATTAATTTATTTTTTGAGACAGG - Intronic
1159710913 18:71758498-71758520 CTTTCTTTATTTTTAAAGACAGG + Intronic
1160146125 18:76366453-76366475 GTTAATTATTCATTAAAGAGAGG - Intronic
1161132830 19:2601740-2601762 GCTAATTTTTTTATAAAGACAGG - Intronic
1161232519 19:3181524-3181546 TTTAATTTTTTTTTAGAGACAGG - Intergenic
1161611439 19:5245292-5245314 TTTTATTTATTTTTAAAGACAGG + Intronic
1161700905 19:5794624-5794646 ATTTATTTATTTTTAGAGACAGG - Intergenic
1161863185 19:6814052-6814074 ATTGATTTATTTTTAGAGACAGG - Intronic
1161905258 19:7151796-7151818 TTTAATTTTTTTTTAGAGACAGG + Intronic
1161928509 19:7319797-7319819 ATTAATTTATTTTTTGAGACAGG + Intergenic
1162014152 19:7835129-7835151 TTTATTTTATTTTTAGAGACAGG - Intronic
1162068076 19:8137632-8137654 ATTTATTTATTTTTAGAGACAGG + Intronic
1162129829 19:8519568-8519590 TTTATTTTAGTATTAGAGACAGG + Intergenic
1162318024 19:9952940-9952962 TTTAAATTTTTATTAGAGACGGG - Intergenic
1162519631 19:11172146-11172168 TTTAATTTTTTAGTAAAGGCAGG + Intronic
1162580591 19:11527684-11527706 ATTTATTTATTTTTAGAGACAGG - Intronic
1162586338 19:11561187-11561209 TTTATTTTATTTTTAGAGACAGG - Intronic
1162758906 19:12876622-12876644 GCTAATTTTTTAATAAAGAGGGG + Intronic
1162871737 19:13591554-13591576 TTTATTTTATTTTTAGAGACAGG - Intronic
1162927955 19:13939567-13939589 TTAAATTTATTTTTAGAGACAGG - Intronic
1162976761 19:14210899-14210921 CTTTATTTATTTTTAGAGACAGG + Intergenic
1163028303 19:14527030-14527052 GTTAATTTTTTAGTAGAGATGGG - Intronic
1163064274 19:14781652-14781674 GCTAATTTTTTAGTAGAGACGGG + Intergenic
1163399851 19:17085650-17085672 TTTTTTTTTTTATTAAAGACGGG - Intronic
1163456776 19:17411358-17411380 TTTATTTATTTATTAAAGACAGG + Intronic
1163573422 19:18096972-18096994 TTTATTTTATTTTTAGAGACGGG - Intronic
1163585792 19:18162710-18162732 TTTAATTTTTTAGTAGAGACGGG - Intronic
1163613710 19:18313982-18314004 GCTAATTTTTTAGTAGAGACGGG + Intronic
1163922025 19:20298833-20298855 GTTTATTTATTAGTTTAGACAGG + Intergenic
1164004548 19:21136484-21136506 GTTAATTTTTTAGTAGAGGCGGG - Intergenic
1164135851 19:22415778-22415800 TTTATTTTATTTTTGAAGACAGG - Intronic
1164162548 19:22637294-22637316 TTTATTTTATTTTTGAAGACAGG + Intronic
1164237488 19:23349810-23349832 TTTAAATTATTATTACATACAGG - Intronic
1164571099 19:29375104-29375126 TTTTATTTTTTTTTAAAGACAGG + Intergenic
1164659918 19:29955135-29955157 TTTAATTTTTTAGTAGAGACGGG + Intronic
1164882980 19:31751472-31751494 TTTAATTTTTTTTTAGAGACAGG - Intergenic
1164965760 19:32481418-32481440 ATTTATTTATTTTTAGAGACAGG + Intronic
1165027256 19:32971013-32971035 TTTAATTTAGTTTTAGAGACAGG - Intronic
1165302962 19:34983722-34983744 GTTAATTTTTTAATAGAGATAGG + Intergenic
1166681012 19:44766974-44766996 TTTATTATATTTTTAAAGACAGG - Intergenic
1166693259 19:44837151-44837173 GTTATTTTATTTTTTGAGACAGG - Intergenic
1166751921 19:45168308-45168330 TTTTATTTATTTTTTAAGACAGG - Intronic
1166845500 19:45725407-45725429 GTTCATTTATTTTTTGAGACAGG - Intronic
1167047567 19:47059505-47059527 TTTAATTAATTTTTTAAGACAGG + Intergenic
1167317260 19:48771826-48771848 ATTTATTTATTTTTAGAGACAGG - Intergenic
1167317680 19:48775051-48775073 TTTAAATTATTAGTAGAGACTGG - Intergenic
1167386096 19:49164913-49164935 ATTTATTTATTTTTAGAGACAGG + Intronic
1167409696 19:49337601-49337623 ATTAATTTATTTTTTGAGACAGG - Intronic
1167838140 19:52091976-52091998 GCTAATTTTTTAGTAGAGACAGG - Intronic
1167953618 19:53046992-53047014 GCTAATTTTTTAGTAGAGACAGG - Intronic
1168493520 19:56831290-56831312 CTTAATTTATAATAAAGGACTGG + Intronic
1168512598 19:56985148-56985170 GTTAATTTTTTTGTAGAGACAGG - Intergenic
925584911 2:5455914-5455936 CTTCATTTATTTTTAGAGACAGG + Intergenic
925779263 2:7365720-7365742 ATTTATTTATTCTTAGAGACAGG - Intergenic
925942081 2:8830422-8830444 GTTTATTTATTTTTTGAGACAGG + Intronic
925959302 2:9000814-9000836 GTTAATTTATTATTGAAGAAAGG - Intronic
926025708 2:9542366-9542388 ATTTATTTATTTTTAAAAACAGG - Intronic
926157998 2:10468563-10468585 ATTAATTTTTTGTTTAAGACAGG + Intergenic
926853686 2:17228835-17228857 GATAATTTTTTAATAGAGACGGG + Intergenic
927101105 2:19788502-19788524 TTAAATTTATTTTTAGAGACAGG - Intergenic
927594220 2:24382675-24382697 GTTGTTTTACTATTAAAGTCAGG + Intergenic
928021603 2:27709409-27709431 TTTATTTTATTTTTAGAGACAGG + Intronic
928327399 2:30330382-30330404 TTTAATTTGTTTTTAGAGACAGG - Intergenic
928519998 2:32079344-32079366 GTTAATTTTTTTCTAAAGACAGG - Intronic
928525282 2:32134040-32134062 ATTGATTTATTTTTTAAGACAGG + Intronic
928599931 2:32894572-32894594 TTTAATTTTTTTGTAAAGACAGG - Intergenic
928871119 2:35981256-35981278 GTCAATTAATTACTAAAGATGGG - Intergenic
928999072 2:37327883-37327905 TTTTATTTATTAGTAGAGACAGG + Intergenic
929069797 2:38018728-38018750 CTTTATTTATTATTAAAAACTGG - Intronic
929087546 2:38183405-38183427 TTTATTTTATTTTTAGAGACAGG + Intergenic
929353110 2:40984511-40984533 ATTTATTTATTTTTAAAGAAGGG - Intergenic
929525371 2:42696731-42696753 TTTTATTTATTTTTAGAGACAGG - Intronic
930115844 2:47717621-47717643 CTTTATTTATTTTTAGAGACAGG + Intronic
930213635 2:48670220-48670242 TTTGTTTTATTAGTAAAGACAGG - Intronic
930388902 2:50735615-50735637 GGATATTTATTTTTAAAGACAGG - Intronic
930791798 2:55339992-55340014 TTTTATTTTTTAGTAAAGACTGG + Intronic
930828890 2:55722171-55722193 ATTTATTTATTAATAAAGACCGG + Intergenic
931131137 2:59337476-59337498 GCTACTTTATTTTTGAAGACAGG - Intergenic
931736382 2:65198600-65198622 CTTAATGTAATATTAAAGCCAGG - Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932334097 2:70919843-70919865 GTTTATTTATTTTTTGAGACAGG - Intronic
932375355 2:71230702-71230724 TTTCATTTATTTTTCAAGACAGG + Intergenic
932525013 2:72456389-72456411 GTTACTTTATTATTCAAAACAGG + Intronic
932691456 2:73917178-73917200 ATTTATTTATTTTTAGAGACAGG - Intronic
932741090 2:74291638-74291660 ATTATTTTATTTTTAGAGACAGG + Intronic
932778833 2:74547017-74547039 GTTAATTTATTTTTTGAGACAGG + Intronic
933021347 2:77196733-77196755 TTTAATTTATTATTTGAGAAAGG - Intronic
933365325 2:81346445-81346467 GTTAATTTATTTCTAAAGGGTGG - Intergenic
933755117 2:85632412-85632434 GCTTATTGATTTTTAAAGACAGG - Intronic
933831115 2:86209495-86209517 AAGAATTTATTTTTAAAGACAGG - Intronic
934032891 2:88064448-88064470 GTTATTATATTATTAAAGGGTGG - Intergenic
934071310 2:88386280-88386302 TTTAATTTATTTTTTGAGACAGG - Intergenic
934592820 2:95572129-95572151 TTTACTTTTTTCTTAAAGACAGG - Intergenic
934797764 2:97115421-97115443 GTTAATTTTTTCTTATAAACTGG - Intronic
934835652 2:97588018-97588040 GTTAATTTTTTCTTATAAACTGG + Intronic
935591141 2:104846121-104846143 GTTAATTTAGTATTAAATCAGGG - Intergenic
935611904 2:105034517-105034539 GTGAATTTCTTATTGAAGAAAGG - Intergenic
935769915 2:106408676-106408698 CTTAATTTTTTTTTAAAGATGGG + Intronic
935878679 2:107539009-107539031 GTGAAGTTATTCTTGAAGACAGG - Intergenic
935899889 2:107780084-107780106 ATTAATTTATTTTTAGAGACAGG - Intergenic
935968297 2:108504114-108504136 CTTAATTTTTTTTTAAAGATGGG - Intronic
936471759 2:112805150-112805172 CTTATTTTTTTTTTAAAGACAGG - Intergenic
936585073 2:113749491-113749513 ATTAATTTATTTTTAGAGACAGG - Intronic
936975402 2:118215785-118215807 TTTATTTTATTAGTAGAGACAGG - Intergenic
937301934 2:120847963-120847985 GTTTATCTTTTATTAAAGGCAGG + Intronic
937557907 2:123181897-123181919 GTGACTATATTATTAAACACCGG + Intergenic
937679877 2:124632753-124632775 GGTAATTTATTTTTAAAAAGAGG + Intronic
937724439 2:125145102-125145124 GTTTATTTATTTTTAAAAAATGG + Intergenic
938015248 2:127861544-127861566 GTTGTTTTATTTTTGAAGACAGG - Intergenic
938123399 2:128650803-128650825 GTTAACTTATTATTAAGGAAAGG + Intergenic
938267015 2:129934900-129934922 TTTAATTCATTATTAATGAGGGG + Intergenic
938598959 2:132817951-132817973 ATTTATTTATTTTTTAAGACAGG + Intronic
938696706 2:133841478-133841500 GCTAATTTATTTTAAGAGACAGG + Intergenic
938861364 2:135372907-135372929 TTTAATTTTTTTTTAGAGACAGG - Intronic
938916494 2:135946422-135946444 GTTAATTTATACATAAACACTGG - Intronic
939075785 2:137601154-137601176 GTAAATTTATTATTGAAGAATGG + Intronic
939169143 2:138673988-138674010 ATTTATTTATTTTTAGAGACAGG + Intronic
939171050 2:138696006-138696028 ATTTATTTATTTTTAGAGACAGG - Intronic
939409303 2:141803412-141803434 GTCTTTTTATTATTAAAGAAGGG + Intronic
940194679 2:151080529-151080551 GGTAATTTATTTTTAAAAAGAGG + Intergenic
940272695 2:151908958-151908980 TTTAATTTTTTTTTAAAGAAAGG + Intronic
940289174 2:152061304-152061326 ATTAATTTTTTTTTAGAGACAGG - Intronic
940366751 2:152856946-152856968 ATTATTTTATTTTTAAAGACAGG + Intergenic
940504242 2:154532611-154532633 ATTAATTTATTATTCATTACTGG - Intergenic
940539607 2:154994958-154994980 ATTTATTTATTTTTAGAGACAGG - Intergenic
940741239 2:157510596-157510618 AGTAATTTATTATTAGACACTGG - Intergenic
940943676 2:159592319-159592341 ATTTATTTATTTTTAGAGACAGG + Intronic
941052727 2:160752844-160752866 TTTTATTTTTTACTAAAGACTGG - Intergenic
941193641 2:162419147-162419169 GGTAAGTTTTTCTTAAAGACAGG - Intronic
941472627 2:165907776-165907798 GTTCATTTACTATGAAAGAATGG + Exonic
941492878 2:166164088-166164110 GTGAATGTTTTATTTAAGACTGG + Intergenic
941524768 2:166593159-166593181 GTTAATTTATTAATGAAAAGAGG - Intergenic
941605771 2:167594739-167594761 GCTAATTTTTTAATAGAGACGGG - Intergenic
941669088 2:168271829-168271851 TTTAAATTTTTAGTAAAGACAGG - Intergenic
941788621 2:169525887-169525909 TTTAATTTATTATTAGAAAATGG - Exonic
941799572 2:169642903-169642925 ATTTATTTTTTATTAGAGACTGG - Intergenic
941982084 2:171469809-171469831 GTTAGTTTGTTTTTCAAGACAGG + Intronic
942053816 2:172164244-172164266 ATTAATTTTTTAGTAGAGACAGG + Intergenic
942541889 2:177023248-177023270 ATTAAGCTATTGTTAAAGACAGG + Intergenic
942765223 2:179447554-179447576 GTTCATTTGCTATTCAAGACAGG + Intronic
942970575 2:181953257-181953279 TTTAATTTTTTTGTAAAGACGGG - Intergenic
943063346 2:183061374-183061396 GTTGTATTATTAGTAAAGACAGG - Intergenic
943091487 2:183380913-183380935 GTTAGTTAATTATTTGAGACAGG + Intergenic
943322152 2:186457789-186457811 GTTAATTCATCATTAGAGAGGGG - Intergenic
943483799 2:188455124-188455146 TTTATTTTATTTTTGAAGACAGG - Intronic
943636797 2:190316148-190316170 ATTTATTTATTTTTAGAGACAGG + Intronic
943856352 2:192798163-192798185 GTTAATAAAATATTAAAAACTGG - Intergenic
943942267 2:194013693-194013715 TTTAATTTATTTTTAAAGATGGG + Intergenic
944651864 2:201838410-201838432 CTTAATTTACTTTTAGAGACAGG + Intronic
945122555 2:206472436-206472458 GTTTTTTTTTTAGTAAAGACAGG - Intronic
945596557 2:211802575-211802597 GATGATTTATTAATAAATACCGG + Intronic
945629502 2:212255763-212255785 GTTAATATATTTTTAAATTCAGG - Intronic
946744274 2:222830131-222830153 ATTTATTTATTTTTTAAGACAGG - Intergenic
947416150 2:229898696-229898718 TTAAATTTTTTTTTAAAGACAGG + Intronic
947694288 2:232170644-232170666 GTGATTTTATTATTATAAACAGG + Intronic
949004142 2:241636218-241636240 GTTATTTAAGTTTTAAAGACGGG - Intronic
1168754633 20:307859-307881 TTTATTTTATTTTTAGAGACAGG - Intergenic
1169171318 20:3468117-3468139 GTTTATTTGTTTTTAGAGACAGG + Intergenic
1169375386 20:5062755-5062777 ATTTATTTATTATTTATGACAGG - Intergenic
1169382259 20:5118524-5118546 GTTTGTTTATTTTTACAGACAGG - Intronic
1169450741 20:5708832-5708854 TTAAATCTATTTTTAAAGACAGG + Intergenic
1169659161 20:7959026-7959048 ACTCATTTATTTTTAAAGACAGG + Intergenic
1169661717 20:7985720-7985742 GTTATTTTCTTATTAAGGAAGGG + Intronic
1169713880 20:8594052-8594074 TTTAATTTTTTGTTATAGACAGG + Intronic
1169824961 20:9757486-9757508 TTTAAAATCTTATTAAAGACTGG - Intronic
1169826545 20:9774768-9774790 TTTAATTTGTTAGTAGAGACGGG - Intronic
1170504750 20:17013571-17013593 GGTCATTTATTGCTAAAGACTGG + Intergenic
1170607245 20:17883456-17883478 ATTCATTTATTTTTAGAGACAGG - Intergenic
1170862020 20:20114262-20114284 TTTAATTTAATTTTAGAGACAGG - Intronic
1170906588 20:20520696-20520718 GTTTTTGTATTATTGAAGACAGG - Intronic
1171235944 20:23524702-23524724 TTTACTGTATTATTAAACACCGG - Intergenic
1171527735 20:25829112-25829134 GTTTAAATATTAATAAAGACAGG + Intronic
1171549091 20:26026772-26026794 GTTTAAATATTAATAAAGACAGG - Intergenic
1172364346 20:34337479-34337501 GTTTATTTATTTTTTGAGACAGG - Intergenic
1172403052 20:34666534-34666556 ATTTATTTATTTTTAGAGACAGG + Intronic
1172660158 20:36562523-36562545 TTTATTTATTTATTAAAGACAGG - Intergenic
1172700290 20:36849438-36849460 CTTATTTTATTCTTTAAGACAGG + Intronic
1172706323 20:36884754-36884776 ATTTATTTATTTTTAGAGACAGG - Intronic
1172739846 20:37157547-37157569 GTTTATTTATTTTCAGAGACAGG - Intronic
1172745972 20:37209328-37209350 ATTAATTTTTTAGTAGAGACGGG + Intronic
1172844921 20:37924246-37924268 GTTTATTTATTTTTTGAGACAGG - Intronic
1172878758 20:38183499-38183521 TTTATTTTATTTTTAGAGACAGG + Intergenic
1172925477 20:38530425-38530447 TTTTATTTATTTTTAGAGACAGG + Intronic
1173899749 20:46578668-46578690 ATTTATTTATTTTTTAAGACAGG - Intronic
1173942785 20:46926262-46926284 GTTGATTTATTATAAAGGATTGG + Intronic
1174623789 20:51897655-51897677 ATTAATTTATTTTTAGAGACAGG + Intergenic
1174627152 20:51925363-51925385 ATTTATTTATTTTTAGAGACAGG - Intergenic
1174836493 20:53860646-53860668 TTTAATTTAATTTTAGAGACAGG + Intergenic
1174984764 20:55438440-55438462 GTTTATTTATTTATAGAGACAGG + Intergenic
1175087511 20:56472213-56472235 ATTAATTTATTTTTTGAGACAGG - Intronic
1175539603 20:59740311-59740333 TTTAATTTTTTTTTAGAGACAGG + Intronic
1175938917 20:62528649-62528671 ATTATTTTACTTTTAAAGACTGG + Intergenic
1176291646 21:5048610-5048632 GTTTATTTATTTTTTGAGACAGG + Intergenic
1177234088 21:18363454-18363476 GTTCACTTCTTAATAAAGACAGG - Intronic
1177268722 21:18817997-18818019 GTTAAATTTTTTTTAAAGTCAGG + Intergenic
1177329528 21:19640106-19640128 ATTTATTTATTTTTAGAGACAGG + Intergenic
1177340268 21:19789518-19789540 GTTATTTTATTATTAAGAAGTGG + Intergenic
1177561675 21:22762524-22762546 AATATTTTATTATTAAAGAAAGG - Intergenic
1177664365 21:24134544-24134566 GTTAATTTATTATTAAAGAAAGG - Intergenic
1177963869 21:27702899-27702921 TTTAATTTTTTTTTTAAGACAGG - Intergenic
1178472444 21:32905468-32905490 GGTAATTTATTTTTAAAAAGAGG + Intergenic
1178799826 21:35782873-35782895 ATTTATTTATTTTTAGAGACTGG - Intronic
1179865609 21:44215031-44215053 GTTTATTTATTTTTTGAGACAGG - Intergenic
1180221461 21:46361211-46361233 TTTTATTTTTTAGTAAAGACAGG - Intronic
1180888401 22:19265876-19265898 ATTTATTTATTTTTACAGACAGG + Intronic
1180978238 22:19863167-19863189 GCTAATTTTTTAGTAAAGACGGG + Intergenic
1181122293 22:20679442-20679464 ATTGATTGATTTTTAAAGACAGG + Intergenic
1181122864 22:20683852-20683874 ATTGATTGATTTTTAAAGACAGG + Intergenic
1181310275 22:21940902-21940924 ATTTATTTATTTTTAGAGACAGG + Intronic
1181641251 22:24200595-24200617 GTTTATTTATTTTTAGAGATGGG + Intergenic
1181912904 22:26254610-26254632 ATTTATTTATTTTTAAAGACAGG - Intronic
1182118286 22:27770662-27770684 TTTATTTTATTTTTAGAGACAGG + Intronic
1182209341 22:28661423-28661445 ATTCATTTATTTTTAGAGACTGG + Intronic
1182247005 22:28966787-28966809 GTTAATTTATTATTGAAGAAAGG + Intronic
1182247689 22:28972989-28973011 ATTTATTTATTCTTAGAGACAGG + Intronic
1182449581 22:30411089-30411111 TTTTATTTTTTAGTAAAGACAGG - Intronic
1182509936 22:30811860-30811882 TTTTTTTTATTTTTAAAGACAGG + Intronic
1182587825 22:31355616-31355638 TTTTATTTTTTGTTAAAGACAGG + Intergenic
1182835738 22:33340007-33340029 CTTAATTTATTATTAATATCTGG + Intronic
1182865510 22:33600891-33600913 TTTATATTTTTATTAAAGACGGG - Intronic
1183107365 22:35624047-35624069 TTTAATTTATTTTTAGAGACAGG - Intronic
1183155787 22:36074317-36074339 ATTAATTTATTTTTTGAGACAGG - Intergenic
1183547434 22:38462036-38462058 GTTATTTTTTTCTAAAAGACAGG - Intergenic
1183819410 22:40333170-40333192 GCTAATTTTTTAGTAGAGACGGG - Exonic
1183936812 22:41267331-41267353 TTTTATTTTTTTTTAAAGACAGG - Intronic
1183939420 22:41284848-41284870 GTTAATTTATTTTTTGAAACAGG - Intronic
1183994550 22:41623101-41623123 TTTAATTTTTTAATAGAGACAGG + Intronic
1184143027 22:42590353-42590375 GCTAATTTATTTTTTGAGACAGG + Intronic
1184223876 22:43118002-43118024 GTTAATTTATTTTTAGAGAGGGG + Intronic
1184486279 22:44781838-44781860 TTTATTTTATTTTTAGAGACAGG + Intronic
1184534110 22:45074898-45074920 TTTAAATTATTTTTAAAGACGGG + Intergenic
1184773506 22:46611681-46611703 ATTAATTTATTTTTAGAGACAGG + Intronic
1185378822 22:50496901-50496923 TTTATTTTTTTAATAAAGACGGG - Intergenic
949362992 3:3251715-3251737 ATTATTTTATTATTAATGACAGG + Intergenic
949525690 3:4901162-4901184 TTTATTTTATTATTTGAGACTGG + Intergenic
949698971 3:6733752-6733774 ATTAATTAATTTTTAGAGACAGG - Intergenic
950875356 3:16266430-16266452 GTGTATTTTTTAGTAAAGACGGG - Intronic
951206401 3:19930610-19930632 TTTACTTTATTTTTAGAGACAGG + Intronic
951500051 3:23375659-23375681 GTTAATTTATTATCCAATAATGG - Intronic
951805310 3:26637159-26637181 GCTAATTTTTTAGTAGAGACAGG + Intronic
952076128 3:29700278-29700300 AATAATTTATTAGTCAAGACAGG + Intronic
952178857 3:30896460-30896482 ATTAATTTATTATTAAATAAAGG - Intergenic
952442531 3:33346551-33346573 ATTTATTTATTTTTAGAGACGGG - Intronic
952678542 3:36063446-36063468 GTCAATTTATTACTAGAGAGTGG + Intergenic
952789439 3:37187803-37187825 ATTAATTTTTTAATAGAGACTGG + Intergenic
952926258 3:38322125-38322147 GTTTATTTGTTTTTAGAGACAGG + Intergenic
953282590 3:41573541-41573563 GTTAATTCATTGTTAAATTCTGG - Intronic
953619708 3:44522578-44522600 GTTTGTTTATTTTTAGAGACAGG - Intergenic
953659314 3:44879968-44879990 AATAATTTTTTTTTAAAGACAGG + Intronic
954116785 3:48471031-48471053 TTTAATTTATTTTTTGAGACAGG + Intronic
954254395 3:49394041-49394063 TTTTATTTTTTATTAGAGACAGG + Intronic
954340231 3:49947420-49947442 TTTATTTTATTTTTAGAGACTGG - Intronic
954528603 3:51296944-51296966 TTTAAATTTTTAGTAAAGACGGG - Intronic
954555491 3:51514521-51514543 ATTATTTAATTATTTAAGACTGG + Intergenic
954824669 3:53362221-53362243 ATTTATTTATTTTTAAAGACAGG + Intergenic
955156309 3:56420347-56420369 GCTAATTTTTTAGTAAAGACAGG + Intronic
955218036 3:57000943-57000965 TTTAATTTTTTTTTAGAGACAGG + Intronic
955710767 3:61776802-61776824 TTTAAGTTACTCTTAAAGACAGG - Intronic
955779277 3:62466489-62466511 CTTAATTTATAAATAAAGCCTGG + Intronic
956246024 3:67184477-67184499 GTTAAGGAATTATTAATGACAGG - Intergenic
956649373 3:71489750-71489772 GTTAATTTATTATGCAAGCATGG + Intronic
956670486 3:71685131-71685153 TTTAGTTTATTTTTAAAGATAGG - Intronic
957115210 3:76014920-76014942 ATTTATTTATTTTTAGAGACAGG - Intronic
957120028 3:76078367-76078389 ATTTATTTATTTTTAAAGACAGG + Intronic
957386105 3:79499300-79499322 CTTAAATTGTTTTTAAAGACTGG - Intronic
957467904 3:80619387-80619409 GTTAACTTATTTTAAAATACAGG + Intergenic
957785588 3:84878029-84878051 ATTAATTAATTTTTAGAGACAGG - Intergenic
958069267 3:88588557-88588579 ATTTATTTATTATTAAACAATGG + Intergenic
958702574 3:97613457-97613479 GTTATTTTATTATGAAGGAGTGG + Intronic
958812388 3:98876347-98876369 TTTTTTTTATTTTTAAAGACAGG - Intronic
959053670 3:101548631-101548653 GATAATTTTTTTTTCAAGACAGG + Intergenic
959406044 3:105962682-105962704 GCTTATTTATTTTTAGAGACAGG + Intergenic
959917799 3:111837365-111837387 GTTGATCTATTAATAAAGAGGGG + Intronic
959928848 3:111956186-111956208 ATTAATTTATTTTTTGAGACAGG - Intronic
959963579 3:112329620-112329642 GTTATTTTAATTTTAAAGCCAGG - Intergenic
959971095 3:112410932-112410954 GCTAATTTTTTAGTAGAGACAGG + Intergenic
960150790 3:114246753-114246775 GGTAATTTATTTTTAAAAAGAGG - Intergenic
960237931 3:115305873-115305895 TTTAATTTTTTATTAAAAGCAGG - Intergenic
960382544 3:116981777-116981799 ATGAATATATTATTAAATACTGG - Intronic
960387937 3:117043891-117043913 TTTAATTTTTTTTTAGAGACTGG - Intronic
961172102 3:124804540-124804562 TTTATTTTATTTTTAGAGACAGG - Intronic
961179970 3:124868793-124868815 GTTAATTTATTTTCGGAGACAGG - Intronic
961210051 3:125118621-125118643 ATTAATTTATTTTTTGAGACAGG - Intronic
961232598 3:125330655-125330677 TTTAATTTTTTAATAGAGACAGG - Intronic
961342325 3:126236040-126236062 CTTAATTTTTTAGTAGAGACTGG - Intergenic
961503374 3:127353227-127353249 ATTCATTTTTTTTTAAAGACAGG - Intergenic
961708711 3:128810120-128810142 GGTAATTTTTTAGTAAAGATAGG + Intronic
961837241 3:129672592-129672614 GTTTTTTTATTTTTAGAGACAGG - Intronic
961994305 3:131224960-131224982 CTTAATTTATTATTGAAGAAGGG + Intronic
962326197 3:134434596-134434618 TTTAATTTATTTTTAAAGACAGG + Intergenic
962428373 3:135296075-135296097 TTTAATTTGTTTTTAATGACAGG - Intergenic
963085766 3:141434958-141434980 CTAAATTTTTTATTAGAGACGGG - Intronic
963203434 3:142608015-142608037 TTTTATTTATTTTTAGAGACAGG + Intronic
963334681 3:143960812-143960834 TTTAATTTTTTTTTAGAGACAGG - Intergenic
963588539 3:147226739-147226761 TTTATTTTATTATTTGAGACAGG - Intergenic
963773139 3:149409896-149409918 GGTATTTTATTATTGGAGACAGG - Intergenic
963853561 3:150231546-150231568 GCTAATTTTTTAGTAGAGACGGG + Intergenic
964146565 3:153470960-153470982 GTAAATTGATTATCAAAGCCTGG - Intergenic
964365725 3:155949236-155949258 TTTTATTTATTTTTTAAGACAGG - Intergenic
964431962 3:156616761-156616783 ATTTATTTATTTTTAGAGACAGG + Intergenic
964774182 3:160256848-160256870 GTTTATTTATTTTTTGAGACAGG - Intronic
965056799 3:163729211-163729233 GTTAACTTATTCTTGAAAACTGG - Intergenic
965182171 3:165417751-165417773 GGTAATTTATAAATAAAAACAGG - Intergenic
965364964 3:167786719-167786741 GTTAATTTATTATTGAAGAAAGG - Intronic
965415793 3:168390524-168390546 TTTAATGTATTAGTAGAGACGGG - Intergenic
965466972 3:169041644-169041666 TTAATTTTATTATTAAACACTGG - Intergenic
965476960 3:169168218-169168240 GTTTATTTGTTTTTAGAGACAGG + Intronic
965851052 3:173024521-173024543 GTTAATTAATGATTCAAGAAAGG + Intronic
966079667 3:175985269-175985291 GTTAATTTATTATGATCAACTGG - Intergenic
966098468 3:176236648-176236670 GTTAATTTATTATGTTAGTCTGG + Intergenic
966126741 3:176586363-176586385 ATTTATTTATTTTTAGAGACAGG - Intergenic
966620535 3:181958649-181958671 ATTAATTAATTAATAAAGACTGG - Intergenic
966717268 3:183026046-183026068 TTTGATTTATTTTTTAAGACAGG + Intronic
967286174 3:187872729-187872751 GCTAATTTTTTAATAGAGACAGG + Intergenic
967343003 3:188421849-188421871 ATAAATTTATTTTTAAAGCCTGG + Intronic
967620003 3:191621265-191621287 AATCATTTATTATTAAAGAAAGG - Intergenic
968187243 3:196641217-196641239 ATTTATTTATTTTTAGAGACAGG + Intronic
968195908 3:196706045-196706067 GTTTATTTTTTATTTGAGACAGG - Intronic
968416268 4:437039-437061 GTTAATTTTTTATTAAGGATGGG + Intronic
968562725 4:1293383-1293405 ATTTATTTATTATTTGAGACAGG - Intronic
968675174 4:1873853-1873875 ATTTATTTATTTTTAGAGACAGG + Intronic
968779397 4:2568510-2568532 ATTTATTTATTTTTACAGACAGG - Intronic
969030809 4:4211754-4211776 TTTAATTTAATTTTAGAGACAGG - Intronic
969135842 4:5028137-5028159 GTTACTTTGTTTTTAGAGACAGG + Intergenic
969711123 4:8844601-8844623 GTTTGTTTTTTATTAAAGACAGG - Intergenic
969800644 4:9562082-9562104 TTTATTTTTTTATTAGAGACAGG + Intergenic
970702392 4:18757670-18757692 GCTAATTTTTTAGTAGAGACGGG - Intergenic
970716162 4:18927009-18927031 GTCAATTTATTTTTAAAAATAGG - Intergenic
970746941 4:19310109-19310131 GTTTATTTAGTATTCAACACTGG - Intergenic
970828836 4:20310888-20310910 ATTAATTTATTTTCAGAGACAGG + Intronic
971021423 4:22540346-22540368 GTTGACTTAGTATTAGAGACCGG - Intergenic
971432678 4:26584523-26584545 GTTAATAGATTTTTAAAGAAGGG + Intronic
971724087 4:30286116-30286138 ATAAATTTATTAATAAAAACTGG + Intergenic
972435282 4:39027926-39027948 TTTAATTTTTTAGTAGAGACAGG + Intronic
972493937 4:39615104-39615126 TTTAATTTATTTATAGAGACAGG + Intronic
972807183 4:42541118-42541140 ATTCATTTATTTTTAGAGACAGG - Intronic
973610366 4:52630571-52630593 GCTAATTTTTTAGTAGAGACAGG - Intronic
973652176 4:53007107-53007129 TTTAATTTTTTTTTAGAGACAGG - Intronic
973738427 4:53895479-53895501 ATTTATTTATTTTTAGAGACAGG - Intronic
973864570 4:55099019-55099041 ATTTATTTATTTTTAGAGACAGG + Intronic
973944930 4:55946362-55946384 TTAAATTTGTTATTAGAGACTGG + Intergenic
974241300 4:59251643-59251665 GATAATGTATTTTTCAAGACAGG + Intergenic
974497051 4:62644923-62644945 ATTACTTTAATATGAAAGACAGG - Intergenic
974994065 4:69130914-69130936 TTTATATTTTTATTAAAGACAGG + Intronic
975456634 4:74598300-74598322 GGTAATTTATAATTAAAAAGAGG - Intergenic
975624288 4:76328453-76328475 TTTAATTTACTTTTAGAGACAGG + Intronic
975867186 4:78736270-78736292 TTTAATTTTTTTTTAGAGACAGG + Intergenic
975940850 4:79643991-79644013 GGTAATTTATTTTTAAAAAGAGG + Intergenic
976194613 4:82520867-82520889 GTTTGTTTATTTTTAGAGACAGG - Intronic
976406740 4:84667879-84667901 GCTAATTTTTTAGTAGAGACGGG + Intergenic
976467223 4:85384444-85384466 TTTAATTTTTTTTTAGAGACAGG + Intergenic
976471665 4:85436269-85436291 TTTAAGTTTTTAGTAAAGACGGG + Intergenic
976880991 4:89925147-89925169 ATTTATTTATTTTTAGAGACAGG + Intronic
976898567 4:90142921-90142943 GTTATTTTATTCTGAAAAACTGG - Intronic
976909751 4:90287622-90287644 GTTAGTTTATTTTTAAATGCAGG - Intronic
977153966 4:93550107-93550129 TTTTATTTATTTTTAGAGACAGG + Intronic
977470842 4:97439653-97439675 ATTAATTTAATATTACAGAAAGG + Intronic
977678392 4:99772614-99772636 GTTATTTTTTTAGTAGAGACAGG - Intergenic
978107246 4:104917901-104917923 GTAAATTTATTTTTAAATAAAGG + Intergenic
978152439 4:105453106-105453128 ATTAACTTATTATTAAAATCTGG + Intronic
978414488 4:108460855-108460877 GTTGTTTTATTATTTGAGACAGG - Intergenic
978473219 4:109094468-109094490 TTTAATTTTTTTTTAAAGAAAGG - Intronic
978567686 4:110101677-110101699 GTTCATTTATTTTTTGAGACAGG + Intronic
978766195 4:112407471-112407493 TTTAATTAATTTTTAGAGACAGG - Intronic
979060700 4:116057437-116057459 ATTAATTTCATATTAAAGCCTGG - Intergenic
979244197 4:118480848-118480870 GTTAATTTATTCTTTGAGATGGG + Intergenic
979455903 4:120925266-120925288 GTTATTTATTTTTTAAAGACTGG - Intergenic
979668993 4:123342726-123342748 ATTTATTTATTTTTAGAGACAGG - Intergenic
979794305 4:124827405-124827427 GTCAATTTAATATTAAAGAAAGG + Intergenic
980024597 4:127749862-127749884 GTTAATTTATTTTTAGACATGGG - Intronic
980165885 4:129226514-129226536 TTTAATTTTTTTGTAAAGACAGG - Intergenic
980383090 4:132051405-132051427 ATTAATTTAGTATTAAAGTTTGG - Intergenic
980778125 4:137462698-137462720 GTTATTTTATTTTTTGAGACAGG + Intergenic
980980792 4:139653098-139653120 ATTTATTTATTATTTGAGACAGG - Intergenic
981543000 4:145865258-145865280 TTTAATTTATTATGAAATAATGG - Intronic
981587122 4:146316141-146316163 GTTAATTTATCCTCACAGACAGG + Intronic
981594512 4:146404189-146404211 TTTAATTTTTTTGTAAAGACGGG + Intronic
981704053 4:147640723-147640745 CTTTATTTATTTTTAGAGACAGG + Intronic
981957224 4:150492984-150493006 ATTAATTTAATTTTCAAGACAGG + Intronic
981961233 4:150541686-150541708 ATTCATTTATTTTTAGAGACAGG + Intronic
982223015 4:153140938-153140960 TTTAATTTTTTTTTAAAGACAGG + Intergenic
982435384 4:155379037-155379059 TTTATTTTATTTTTAGAGACAGG + Intergenic
982924506 4:161319173-161319195 GTTAATTTATTATTGAAGAAAGG + Intergenic
983231018 4:165128932-165128954 ATTTATGTATTATTAGAGACAGG - Intronic
983561440 4:169105719-169105741 GCTAATTTTTTTGTAAAGACGGG - Intronic
984179283 4:176462225-176462247 TTTAATTTTTTAGTAGAGACAGG - Intergenic
984339135 4:178431336-178431358 TTTATTTTTTTTTTAAAGACAGG - Intergenic
985060755 4:186075622-186075644 ATTTATTTATTTTTAGAGACAGG - Intronic
985105272 4:186493407-186493429 ATTGATTTATTTTTATAGACAGG + Intronic
985305992 4:188540827-188540849 TCTATTTTATTATTAAAGAAAGG + Intergenic
985368707 4:189261731-189261753 GGTAATTTATTTTTAAAAAATGG + Intergenic
985974256 5:3402950-3402972 ATTAATTTAGCATTAAAGAAGGG + Intergenic
986083539 5:4419089-4419111 ATTATTTTATTTTTAGAGACAGG - Intergenic
986391497 5:7291642-7291664 TTTAATTTATTAACAAATACTGG - Intergenic
986836137 5:11639536-11639558 GTTAATATCGTATTAGAGACAGG - Intronic
987093541 5:14528456-14528478 ATTTATTTATTTTTAGAGACGGG + Intronic
987588254 5:19887741-19887763 TTTAATTTTTTTGTAAAGACTGG + Intronic
987693073 5:21293634-21293656 GTGTATTTTTTATTAGAGACGGG + Intergenic
987740195 5:21898224-21898246 TTTATTTTATTTTTAGAGACAGG + Intronic
987770796 5:22301635-22301657 TTTAATTTTTTTTTCAAGACAGG + Intronic
987793390 5:22596955-22596977 GTTAATTTAGGATAAAACACGGG + Intronic
988005519 5:25405299-25405321 GTTATTTTAGTATTAAAAAATGG - Intergenic
988017395 5:25576855-25576877 ATTTATTTATTTTTACAGACTGG + Intergenic
988076734 5:26363586-26363608 GTTAATTTATTTTAAAAAAGAGG - Intergenic
988182483 5:27815815-27815837 GTAGATATATTATTAAAAACCGG - Intergenic
988246374 5:28687864-28687886 ATTTATTTATTTTTTAAGACAGG + Intergenic
988317530 5:29649798-29649820 TTTATTTTTTTAGTAAAGACAGG - Intergenic
988506526 5:31828491-31828513 TTTATTTTATTTTTTAAGACAGG + Intronic
989046231 5:37276531-37276553 TTTATATTATTAGTAAAGACAGG + Intergenic
989392788 5:40919618-40919640 ATTTATTTATTTTTAGAGACAGG - Intronic
989492577 5:42074762-42074784 TTTAATTTTTTGTTTAAGACTGG - Intergenic
990102827 5:52214384-52214406 GTTAATTTATTATTGACGAAAGG + Intergenic
990544613 5:56810559-56810581 ATTTATTTATTTTTAGAGACAGG + Intergenic
990722592 5:58713719-58713741 TTTAATTTATGTTTAAAGTCAGG - Intronic
990795083 5:59530767-59530789 ATTATTTTGTTATTAGAGACCGG - Intronic
990863243 5:60351809-60351831 ATTTATTTATTTTTAGAGACAGG + Intronic
991071706 5:62490265-62490287 TTTATTTTATTAATGAAGACAGG + Intronic
991108744 5:62872628-62872650 GTTAAATTATTATTAGAGTGAGG + Intergenic
991646515 5:68806255-68806277 AATAATTTATGATTAAAGAAAGG + Intergenic
991702220 5:69327030-69327052 TTTTATTTATTTTTAGAGACAGG - Intronic
991747208 5:69755918-69755940 GTGTATTTTTTATTAGAGACGGG - Intergenic
991750497 5:69799324-69799346 GTGTATTTTTTATTAGAGACGGG + Intergenic
991798810 5:70335856-70335878 GTGTATTTTTTATTAGAGACGGG - Intergenic
991802069 5:70379109-70379131 GTGTATTTTTTATTAGAGACGGG + Intergenic
991826586 5:70631231-70631253 GTGTATTTTTTATTAGAGACGGG - Intergenic
991829785 5:70674225-70674247 GTGTATTTTTTATTAGAGACGGG + Intergenic
991891141 5:71335183-71335205 GTGTATTTTTTATTAGAGACGGG - Intergenic
991934495 5:71788604-71788626 GTCAACTTTTTTTTAAAGACTGG - Intergenic
992056974 5:73000009-73000031 GTGAATTAATTTTTCAAGACAGG + Intronic
992297757 5:75343151-75343173 TTTAATTTTTTTTTAAAGACTGG - Intronic
992307136 5:75452836-75452858 GCTAAATTATTTTTAAAGATAGG - Intronic
992500998 5:77343690-77343712 GCTAATTTACTATTGAAGAAAGG - Intronic
993288252 5:86030313-86030335 ATTAATTCATTAATAAAGATGGG + Intergenic
993301140 5:86212067-86212089 GTTAATTTGTCTTTAAATACTGG - Intergenic
993583183 5:89689717-89689739 GTTAATATATTAGGAAAAACAGG - Intergenic
994399250 5:99258248-99258270 GTTAATTTATAATTAAGTAAGGG + Intergenic
994569375 5:101495232-101495254 GTTTTTTTTTTCTTAAAGACAGG + Intergenic
994711271 5:103267703-103267725 GTTCATTTATTTTTAATGTCAGG + Intronic
994912104 5:105923629-105923651 ATTTATTTATTATTTCAGACAGG - Intergenic
995103677 5:108348808-108348830 GTATATATATTTTTAAAGACAGG + Intronic
995167155 5:109057494-109057516 TTTATTTTATTTTTAGAGACAGG + Intronic
995303707 5:110617789-110617811 GTTGATTTTTTAGTAGAGACAGG - Intronic
995307188 5:110666071-110666093 ATTAATTTATTTTTAGAGACAGG - Intronic
995326808 5:110898718-110898740 ATTTATTTATTTTTAGAGACAGG - Intergenic
995478790 5:112574566-112574588 GTAAAGTTGTTATTAAAGGCAGG - Intergenic
995562014 5:113392232-113392254 TTTTCTTTATTTTTAAAGACGGG - Intronic
995936442 5:117521228-117521250 ATTTATTTATTTTTAGAGACGGG - Intergenic
996201089 5:120674354-120674376 GTTAATTAACTTTTAAAGAATGG + Intronic
996334038 5:122363826-122363848 ATTTATTTATTTTTAGAGACAGG + Intronic
996343960 5:122469779-122469801 GATAATATATCATTACAGACTGG - Intergenic
996552866 5:124748087-124748109 GATAATTTAATATTAAACAAGGG - Intronic
996640441 5:125745102-125745124 TTTATTTTATTTTTAGAGACAGG + Intergenic
996925821 5:128825164-128825186 TTTAATTTAGTATTAAAAAAAGG + Intronic
997313950 5:132916071-132916093 GATAATTTTTTAGTAGAGACAGG - Intronic
997512684 5:134464352-134464374 TTTATTTTATTTTTAGAGACAGG + Intergenic
997917668 5:137944592-137944614 GCTAATTTTTTAGTAGAGACAGG - Intronic
997966216 5:138358475-138358497 TTTTATTTATTAGTAGAGACGGG + Intronic
998999525 5:147904717-147904739 GCTAATTTTTTGTTAAAGGCAGG - Intronic
999081358 5:148847244-148847266 TTTAATTTGTTATTGAAGAAAGG - Intergenic
999087841 5:148909044-148909066 ATTCATTTATTTTTAGAGACAGG - Intergenic
999140277 5:149356929-149356951 ATTTATTTATTTTTAAAGACAGG + Intergenic
999536678 5:152524962-152524984 GTTTTTTTCTTATTAAAGACAGG + Intergenic
999593033 5:153170117-153170139 TATTATTTATTTTTAAAGACAGG + Intergenic
999944690 5:156582079-156582101 TTTAATTTATTTTTTAAGAATGG + Intronic
1001062990 5:168509963-168509985 ATTTATTTATTTTTAGAGACAGG - Intronic
1001201407 5:169720893-169720915 GCTAATTTTTTAGTAGAGACGGG + Intronic
1001283476 5:170405373-170405395 TTTAATTTTTTAGTAGAGACAGG + Intronic
1001453545 5:171844259-171844281 GTTGTTTTATTTTTAGAGACAGG + Intergenic
1001504092 5:172263100-172263122 GTTAATTTTTTTGTACAGACAGG + Intronic
1003008800 6:2407214-2407236 TTTTATTTATTTTTGAAGACAGG - Intergenic
1003358459 6:5398567-5398589 GTTCCTTTTTTATTAAAGAATGG + Intronic
1003681258 6:8259236-8259258 GTTCATTTATTTTTTGAGACGGG - Intergenic
1003761727 6:9185933-9185955 ATTAATTTATTTTTAGAGATGGG - Intergenic
1004096395 6:12559260-12559282 ATTTATTTATTTTTAAAGACAGG + Intergenic
1004226617 6:13790622-13790644 TTTAATTTTTTAGTAGAGACGGG + Exonic
1004545158 6:16591126-16591148 TTTAATTTTTTAGTAGAGACAGG + Intronic
1004682713 6:17912052-17912074 GTTAAATTATTATTGATGGCCGG - Intronic
1005049772 6:21673959-21673981 TTTTCTTTATTATTAGAGACGGG + Intergenic
1005592483 6:27343357-27343379 GGTAATTTTTTAGTAGAGACAGG + Intergenic
1005675577 6:28151462-28151484 GGTAATTAATTAATAGAGACTGG + Intronic
1005848200 6:29799290-29799312 TGTAATTTTTTATTAGAGACGGG - Intergenic
1006245882 6:32735481-32735503 ATTTATTTATTTTTAGAGACGGG + Intergenic
1006247383 6:32749992-32750014 ATTTATTTATTTTTAGAGACGGG - Intergenic
1006520168 6:34566759-34566781 GTTTGTTTATTATTTAAGACAGG - Intergenic
1006834938 6:36992257-36992279 GCTAATTTTTTAGTAGAGACGGG + Intergenic
1007372778 6:41437637-41437659 ATTTATTTATTTTTAGAGACAGG + Intergenic
1007439474 6:41845690-41845712 TTTATTTTATTTTTAGAGACAGG - Intronic
1007493285 6:42241055-42241077 GTTAATTTTTTAGTAGAGATGGG + Intronic
1007551114 6:42730236-42730258 GCTAATTTTTTAGTAGAGACAGG + Intergenic
1007672165 6:43564546-43564568 GTTAATTCATTATTGAAGAAAGG - Intronic
1007795872 6:44346682-44346704 GGTAACTTATTTTTAAAAACAGG - Intronic
1007844919 6:44745981-44746003 TTTAATTTTTTAGTAGAGACAGG + Intergenic
1007883765 6:45201463-45201485 ATTAATTTATTTTTAAAAATGGG - Intronic
1008106700 6:47446398-47446420 ATTAATTTTTTTTTAGAGACAGG - Intergenic
1008741219 6:54610846-54610868 GTTAGCTTATTATTAAATATTGG + Intergenic
1008897852 6:56578365-56578387 TTGAATTTATTTTTAGAGACAGG - Intronic
1009214594 6:60906017-60906039 GTGAATTTATTATAAAAGAGTGG - Intergenic
1009610537 6:65935163-65935185 GTTATTTTTTTAGTAGAGACAGG + Intergenic
1010121480 6:72380458-72380480 ATTACTTTATTATTATAGTCAGG + Intronic
1010238635 6:73596681-73596703 TTTATTTTTTTAGTAAAGACGGG - Intronic
1010501420 6:76605595-76605617 GTTAAAATATTTTTAAAGATAGG + Intergenic
1010812480 6:80315622-80315644 TTTTATTTATTTTTAGAGACAGG + Intronic
1010920950 6:81679982-81680004 GTTAATTTTTTTGTAGAGACTGG - Intronic
1011292304 6:85789557-85789579 GGTAATTTATTTTTAAAAAGAGG - Intergenic
1011412216 6:87077570-87077592 GTTTACTTATTTTTCAAGACAGG - Intergenic
1011521089 6:88207518-88207540 TTTAATTTATTATTGAAGAAAGG - Intergenic
1011616515 6:89202702-89202724 ATTTATTTATTTTTAGAGACAGG + Intronic
1011617100 6:89207198-89207220 GTTAATTTTTTTTTGAAGACAGG + Intronic
1011953969 6:93002167-93002189 ATTTATTTATTTTTACAGACAGG - Intergenic
1012495713 6:99831453-99831475 TTTAATTTATTTTTTGAGACAGG + Intergenic
1012564387 6:100628730-100628752 GGTAATTTATTTTTAAAAAGAGG - Intronic
1013039201 6:106417164-106417186 GTTATTTTTTTTTAAAAGACAGG + Intergenic
1013120052 6:107133238-107133260 GTTTATTTATTTTTTGAGACAGG + Intergenic
1013364760 6:109428377-109428399 CTTAATTTTTTTGTAAAGACAGG - Intronic
1013691412 6:112649033-112649055 ATTTATTTATTTTTAGAGACAGG - Intergenic
1013781618 6:113734604-113734626 ATTTATTTATTTTTAAAGACAGG + Intergenic
1013785933 6:113780742-113780764 GTTAATCTATTATAAACAACAGG + Intergenic
1014158658 6:118141012-118141034 GTTAATTTACTATTAAAGAAAGG + Intronic
1014222647 6:118813897-118813919 TTTATTTTATTTTTAGAGACAGG + Exonic
1014351945 6:120356689-120356711 GTTTATTTATTTTTTGAGACAGG - Intergenic
1014431755 6:121379454-121379476 TTTATTTTATTTTTAGAGACAGG + Intergenic
1015721191 6:136244120-136244142 GTTAATGTATTATTGAAGAAAGG + Intronic
1015781203 6:136867856-136867878 GTTAATTTATTATTGAAGAAAGG + Intronic
1015963202 6:138671283-138671305 GCTAATTTTTTAGTAGAGACGGG - Intronic
1016036864 6:139392246-139392268 GTTTATTTGTTTTTAGAGACAGG - Intergenic
1016503796 6:144753611-144753633 TTTGTTTTATTTTTAAAGACAGG - Intronic
1016726565 6:147376804-147376826 ATTAATGTATTTTTAGAGACAGG - Intronic
1017096685 6:150811273-150811295 GTTTTTTTTTTTTTAAAGACAGG + Intronic
1017132200 6:151117182-151117204 GTTTATTTATTTTTAGAGACAGG - Intergenic
1017369602 6:153689577-153689599 GTTAAAATATTATGAAAGTCAGG + Intergenic
1017449716 6:154543307-154543329 GAATATTTATTATTAAAAACGGG + Intergenic
1017802578 6:157910946-157910968 GCTAATTTTTTAGTAGAGACAGG - Intronic
1017915272 6:158826647-158826669 ATTTATTTATTTTTAGAGACAGG + Intergenic
1018608407 6:165623144-165623166 GTTTATTTATTTTTTGAGACAGG + Intronic
1018901297 6:168053122-168053144 GTTAATTGTTTATTAATCACAGG - Intergenic
1019295400 7:271317-271339 ATTTATTTATTTTTTAAGACAGG - Intergenic
1020000346 7:4752157-4752179 ATTTATTTATTTTTAGAGACAGG + Intronic
1020148019 7:5660123-5660145 GTTATTTTATTTGTACAGACAGG + Intronic
1020251850 7:6475418-6475440 ATTAATTTATTTTTTGAGACAGG - Intronic
1020277846 7:6635757-6635779 TTTTATTTATTATTAGAGACAGG + Intergenic
1020421737 7:8014160-8014182 TTTAATTTTTTAGTAGAGACGGG + Intronic
1020505142 7:8977106-8977128 GTTAATTAATTCTTCAAGAAAGG + Intergenic
1020726886 7:11827007-11827029 TTTAATTAATTTTTAGAGACAGG + Intronic
1020761766 7:12276403-12276425 ATTTATTTATTTTTAGAGACAGG + Intergenic
1021488872 7:21196884-21196906 TTTAATTTTTTAGTAGAGACGGG + Intergenic
1021519225 7:21522546-21522568 TTTAATTTTTTTGTAAAGACAGG + Intergenic
1021668013 7:23006188-23006210 GTTAATTTATATTTAAAGGGAGG + Intronic
1021732562 7:23609854-23609876 ATTTATTTATTTTTTAAGACAGG - Intronic
1021816735 7:24454467-24454489 ATTATTTTATTTTTAGAGACAGG + Intergenic
1021938827 7:25658839-25658861 GTTTATTTATTTTTAAATTCAGG - Intergenic
1022084677 7:27055665-27055687 ATTGATTTATTTTTAGAGACAGG + Intergenic
1022088343 7:27090366-27090388 TTTAATTTATTTTGAGAGACAGG - Intergenic
1022243716 7:28536620-28536642 GTTAATTTAGGATTGATGACCGG - Intronic
1022455888 7:30558029-30558051 CTTAATTTTTTTTTTAAGACAGG - Intergenic
1022755121 7:33279041-33279063 GTTTATTTATTTTTAGAGACAGG + Intronic
1022962539 7:35442521-35442543 GTATGTTTATTATTAAAGAAAGG - Intergenic
1023223655 7:37946970-37946992 ATTAATGTATTATTGAAGAAAGG + Intronic
1023291838 7:38676210-38676232 ATTAATTTATTTTTAAAAATAGG - Intergenic
1024077119 7:45827102-45827124 GTCAATTTTTTTTTAGAGACAGG - Intergenic
1025297523 7:57788017-57788039 ATTAATTTTTTTTTTAAGACAGG - Intergenic
1025297904 7:57790745-57790767 GTTTAAATATTAATAAAGACAGG - Intergenic
1026051066 7:66947039-66947061 TTTAATTTTTTCATAAAGACAGG - Intronic
1026098580 7:67366401-67366423 ATTTATTTATTTTTAGAGACAGG - Intergenic
1026280470 7:68917792-68917814 TTTATTTTATTTTTAGAGACAGG - Intergenic
1026351793 7:69523319-69523341 GCTAATTTTTTAGTAGAGACAGG + Intergenic
1026539873 7:71270348-71270370 GTTATTTTTTTAGTAGAGACGGG - Intronic
1026546817 7:71330401-71330423 ATTTATTTATTTTCAAAGACAGG + Intronic
1026574106 7:71557619-71557641 TTTTATTTTTTATTAGAGACAGG - Intronic
1026631316 7:72040477-72040499 ATTAATTTATTTTTTGAGACAGG - Intronic
1026705214 7:72684937-72684959 TTTAAATTTTTATTAGAGACAGG - Intronic
1027009032 7:74725672-74725694 GTTACTTTATTTTTTAAGACAGG - Intronic
1027127346 7:75566191-75566213 GCTAATTTTTTAGTAGAGACGGG + Intronic
1027162951 7:75815468-75815490 TTTATTTTTTTTTTAAAGACGGG - Intronic
1027172253 7:75880895-75880917 TTTAAATTTTTTTTAAAGACGGG + Intronic
1027217466 7:76193255-76193277 ATTTATTTATTTTTAGAGACAGG + Intergenic
1027267199 7:76500925-76500947 ATTTTTTTATTCTTAAAGACGGG + Intronic
1027319010 7:77000793-77000815 ATTTTTTTATTCTTAAAGACGGG + Intergenic
1027403515 7:77833816-77833838 TTTAATTTATTTTTAGAGATAGG - Intronic
1027495622 7:78884469-78884491 GTTTATTTATTTTTGGAGACAGG - Intronic
1027716642 7:81679636-81679658 GTGGAATTATTATTAAAGAATGG + Intergenic
1027801395 7:82755450-82755472 GTGAATTTTTTACAAAAGACAGG - Exonic
1027926552 7:84472087-84472109 ATTAATATTTTATTATAGACTGG - Intronic
1028076845 7:86527010-86527032 GTGACTTTACTATTAAAAACAGG - Intergenic
1028100172 7:86809571-86809593 AATAATTTATTATTAATGATAGG + Intronic
1028172393 7:87614222-87614244 GTTAATTTTTCTTTAGAGACAGG - Intronic
1028433345 7:90773510-90773532 TTTACTTTATTTTTAGAGACAGG + Intronic
1028878826 7:95855973-95855995 GTTAATTTACTATTGAAGAAAGG - Intronic
1029218877 7:98972212-98972234 GTTAATTTTTTAGTAGATACAGG + Intronic
1029300839 7:99581166-99581188 ATTTATTTATTTTTAGAGACAGG + Intronic
1029385446 7:100240559-100240581 TTTATTTTATTTTTTAAGACAGG - Intronic
1029416069 7:100443982-100444004 ATTTATTTATTTTTAGAGACAGG - Intergenic
1029691435 7:102184649-102184671 TTTATTTTATTTTTAAAGACAGG + Intronic
1029735908 7:102465664-102465686 GTTACTTTATTTTTAGAGACGGG - Intronic
1029867505 7:103650629-103650651 TTTAATTTATTGTTAGAGACAGG + Intronic
1029961757 7:104695119-104695141 ATTAATTTTTTTTTTAAGACAGG + Intronic
1030576034 7:111287161-111287183 ATTAATTTATTACCACAGACAGG - Intronic
1030874192 7:114792969-114792991 ATTTATTTATTTTTTAAGACAGG - Intergenic
1031107935 7:117568556-117568578 GTTAAATTATTTTTAAAAATTGG - Intronic
1031716202 7:125111712-125111734 GTTAATTTATTATTGAGGAAGGG - Intergenic
1031917029 7:127573250-127573272 TTTTATTTATTTTTAGAGACAGG - Intergenic
1032120430 7:129151289-129151311 GCTAATTTTTTTTTAGAGACTGG + Intronic
1032149825 7:129418736-129418758 GTAATTTTATTTTTAGAGACAGG - Intronic
1032557253 7:132849479-132849501 GGTTATTTATTATTGATGACTGG - Intronic
1033186841 7:139234362-139234384 GTTCATTTAGTATTTAAGAAGGG - Intronic
1033189354 7:139262779-139262801 GTTCTTTTATTATTAAACAGCGG + Intronic
1033261518 7:139848154-139848176 ATTTATTTATTTGTAAAGACAGG + Intronic
1033289376 7:140070045-140070067 GCTAATTTTTTAGTAAAGATGGG - Intergenic
1033441103 7:141379477-141379499 TTTATTTTATTATTTTAGACAGG - Intronic
1033784088 7:144709147-144709169 GTTAATTTATTCCTGAAGAAAGG + Intronic
1033849767 7:145481403-145481425 TTTAACTTTTTATTAGAGACAGG + Intergenic
1034115600 7:148581004-148581026 TTTAATTTATTTTTAGAGATGGG - Intergenic
1034254706 7:149718233-149718255 ATTAATTAATTAAAAAAGACAGG - Intronic
1034741824 7:153481477-153481499 GTTATTTTTTTAGTAGAGACAGG - Intergenic
1035256255 7:157630007-157630029 GTTCATGTATTAATGAAGACAGG - Intronic
1035651040 8:1265047-1265069 GGTAATTTATTTTTAAAAAGAGG - Intergenic
1035879815 8:3233859-3233881 GTTAATTTATTTTTGAAAAAAGG - Intronic
1036447390 8:8833621-8833643 ATTTATTTATTCTTAAAGACAGG - Intronic
1036928851 8:12932849-12932871 ATTATTTTATTATTAGAGATGGG - Intergenic
1036967592 8:13318031-13318053 GTTTATTTATTTTTAGAGACAGG + Intronic
1037109923 8:15153813-15153835 TTTAATTTATAATTAAACACAGG - Intronic
1037374508 8:18213080-18213102 TTTAATTTTTTATTAGAGATGGG + Intronic
1037379536 8:18269842-18269864 GTCAATTTATTAGGAAAGACTGG - Intergenic
1037780708 8:21867143-21867165 ATTTATTTATTTTTAGAGACAGG + Intergenic
1037852226 8:22340882-22340904 TTTAATTTTTTTGTAAAGACAGG + Intronic
1037864225 8:22430237-22430259 TTTAATTTTTTTTTAGAGACGGG + Intronic
1037932986 8:22894574-22894596 TTTATTTTATTTTTAGAGACAGG - Intronic
1038014294 8:23500345-23500367 ATTTATTTATTTTTAGAGACAGG + Intergenic
1038759049 8:30369370-30369392 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1038800149 8:30742354-30742376 TTTATTTTATTTTTAGAGACAGG + Intronic
1038840452 8:31180133-31180155 GTTTATTTATTTTTAGAGGCAGG + Intergenic
1038849999 8:31266434-31266456 ATTTATTTATTTTTAGAGACAGG + Intergenic
1039098299 8:33911492-33911514 GTTATTTTTTTAGTAGAGACAGG - Intergenic
1039460419 8:37738877-37738899 ATTATTTTATTTTTAGAGACAGG - Intronic
1039484976 8:37903325-37903347 GTTTGTTTGTTTTTAAAGACAGG - Intergenic
1039485378 8:37905659-37905681 GTTACTTTGTTTTTAGAGACAGG + Intergenic
1039757873 8:40542392-40542414 ATTTATTTATTTTTAGAGACAGG + Intronic
1039922005 8:41899603-41899625 TTTATTTTATTTTTAGAGACAGG - Intergenic
1040046773 8:42972415-42972437 CTTACTTTTTTTTTAAAGACAGG + Intronic
1040423717 8:47263490-47263512 TTTAAATTTTTATTAGAGACAGG + Intronic
1040440505 8:47436718-47436740 TTTATTTTATTTTTAGAGACAGG - Intronic
1040881291 8:52207484-52207506 ATTAATTTATTTTTTGAGACAGG - Intronic
1040908206 8:52490907-52490929 TTTTATTTTTTCTTAAAGACAGG + Intergenic
1041103683 8:54420999-54421021 ATTTATTTATTTTTAGAGACAGG - Intergenic
1041544949 8:59032570-59032592 GTTTCATTATTATTAAAGAAAGG - Intronic
1042141483 8:65683566-65683588 GTTAATCTATTATTTAAAAGTGG - Intronic
1042269835 8:66943536-66943558 TTTAATTTTTTTGTAAAGACGGG + Intergenic
1042370168 8:67982415-67982437 TTTAATTTTTTTTTAGAGACAGG - Intronic
1042514087 8:69641736-69641758 ATTTATTTATTTTTAGAGACAGG - Intronic
1042547210 8:69961426-69961448 GTTAATTTTTTTGTAGAGACGGG - Intergenic
1042965429 8:74346889-74346911 GCTAATTTTTTAGTAGAGACAGG + Intronic
1042970871 8:74407712-74407734 ATTAATTCATTTATAAAGACAGG - Intronic
1043276035 8:78394183-78394205 GTTTGTTTATTTTTAGAGACAGG + Intergenic
1043638177 8:82413148-82413170 TTTAATTTATTATTAGAGACCGG + Intergenic
1043865107 8:85365697-85365719 GTTAATTTATTTTTAAGTTCGGG + Intronic
1043909534 8:85845466-85845488 GTTAATTTATTATTGAAGAAAGG + Intergenic
1044172859 8:89077902-89077924 GTTAATTTTTTTTTAAAGACAGG + Intergenic
1044219683 8:89654994-89655016 GTTAATTTATTTTTAGAGACAGG - Intergenic
1044507906 8:93041390-93041412 CTAAATTTATTATTAAAAAAAGG + Intergenic
1044518060 8:93162766-93162788 CTAAATTTATTTTTAAAGACTGG - Intronic
1044638716 8:94355583-94355605 TTTATTTTATTTTTCAAGACAGG - Intergenic
1044704518 8:94995567-94995589 TTTATTTTATTTTTAAAGATGGG - Intronic
1044734007 8:95259090-95259112 GTTAATTTTTTAAGAAAGAATGG - Intronic
1045021426 8:98047478-98047500 GTTAATTTCTCATCAAAGAGGGG - Intergenic
1045172007 8:99681660-99681682 ATTTATTTATTTTTCAAGACAGG - Intronic
1045279106 8:100734098-100734120 TTTAATTTTTTTTTAGAGACAGG + Intergenic
1045279829 8:100740651-100740673 TTTAATTTTTTTTTAAAGATGGG + Intergenic
1045523843 8:102926800-102926822 GTTTATTTTTTAGTAGAGACAGG - Intronic
1045848711 8:106667674-106667696 ATTAATTTCGTATAAAAGACTGG - Intronic
1045853070 8:106726660-106726682 GTAAATTAATTATTATTGACTGG + Intronic
1046195075 8:110851864-110851886 ATTTATTTATTTTTAAATACAGG + Intergenic
1046267514 8:111849345-111849367 TTTTATTTGTTAGTAAAGACAGG + Intergenic
1046306091 8:112369380-112369402 GTTAATTGCTTATTAAAGAAGGG - Intronic
1046955203 8:120055987-120056009 GCTAATTTGTTTTAAAAGACAGG - Intergenic
1047274948 8:123398674-123398696 GCTAATTTGTTTTTAGAGACGGG + Intronic
1047291890 8:123539009-123539031 TTTTATTTATTTTTAGAGACAGG + Intronic
1047387187 8:124421050-124421072 GCTAATTTTTTTTTAAAGATGGG + Intergenic
1047591555 8:126332323-126332345 GCTAATTTAGGATTAAAAACTGG - Intergenic
1047647119 8:126880799-126880821 TTTTATTAATTTTTAAAGACAGG - Intergenic
1047731455 8:127732204-127732226 TTTAATTTTTTTTTTAAGACAGG - Intergenic
1050584873 9:7100218-7100240 GTAAATTTTATATTAGAGACAGG - Intergenic
1050714764 9:8510284-8510306 ATTTATTTATTTTTAGAGACAGG - Intronic
1051011445 9:12419248-12419270 TTTAATTCTTTATTAGAGACAGG + Intergenic
1051312206 9:15788588-15788610 GTTTTTTTTTTTTTAAAGACAGG + Intronic
1051480671 9:17556624-17556646 TTTAATCTATTTTCAAAGACAGG + Intergenic
1051620671 9:19046858-19046880 TTAAATTTATTTTTAGAGACAGG - Intronic
1051695954 9:19768084-19768106 ATTAATTGATTAATGAAGACAGG + Intronic
1051765854 9:20522954-20522976 ATTTATTTATTTTTTAAGACAGG - Intronic
1051785758 9:20741571-20741593 ATTAATTTATTTTTAAATAAGGG + Intronic
1051791408 9:20807025-20807047 GTTATTTTCATTTTAAAGACAGG - Intronic
1051807326 9:21009873-21009895 GTTACTTGATTCTTAAAGAATGG + Intronic
1051859198 9:21605339-21605361 GTTATTTTCTTATTGAAGCCAGG - Intergenic
1051976334 9:22954145-22954167 ATTAATTTATTTTTAGAGATGGG - Intergenic
1052179485 9:25506538-25506560 GGTAATTTATTTTTAAAAAGTGG + Intergenic
1052336533 9:27325579-27325601 GTTAATATATTTTTTAAGGCAGG + Exonic
1052336908 9:27329675-27329697 GTTTGTTCTTTATTAAAGACAGG - Exonic
1052424060 9:28281085-28281107 TTTAATTTCTTTTTAAACACAGG + Intronic
1052630099 9:31026494-31026516 GTTTATTTATTTTTTGAGACAGG - Intergenic
1052976092 9:34411382-34411404 TTTTTTTTATTTTTAAAGACAGG - Intronic
1053616506 9:39771523-39771545 GGTAATTTATTTTTAAAAAGAGG + Intergenic
1053793779 9:41706136-41706158 ATTTATTTATTGTTAGAGACAGG - Intergenic
1053795707 9:41725269-41725291 GTTTAAATATTAATAAAGACAGG + Intergenic
1053897940 9:42763757-42763779 GGTAATTTATTTTTAAAAAGAGG - Intergenic
1054149483 9:61589636-61589658 GTTTAAATATTAATAAAGACAGG - Intergenic
1054151396 9:61608694-61608716 ATTTATTTATTGTTAGAGACAGG + Intergenic
1054182188 9:61918149-61918171 ATTTATTTATTGTTAGAGACAGG - Intergenic
1054184117 9:61937324-61937346 GTTTAAATATTAATAAAGACAGG + Intergenic
1054237012 9:62570866-62570888 GGTAATTTATTTTTAAAAAGAGG - Intergenic
1054469243 9:65520739-65520761 GTTTAAATATTAATAAAGACAGG - Intergenic
1054471169 9:65539833-65539855 ATTTATTTATTGTTAGAGACAGG + Intergenic
1054529808 9:66170085-66170107 TTTTATTTTTTATTAGAGACGGG + Intergenic
1054551149 9:66605377-66605399 GGTAATTTATTTTTAAAAAGAGG - Intergenic
1054654388 9:67651155-67651177 GTTTAAATATTAATAAAGACAGG - Intergenic
1054674535 9:67842188-67842210 TTTTATTTTTTATTAGAGACGGG - Intergenic
1054928724 9:70614488-70614510 ATTTATTTATTTTTAGAGACAGG - Intronic
1055122758 9:72681613-72681635 GTGAAATTATAATTAAACACAGG - Intronic
1055179801 9:73371550-73371572 ATTAATTTATTATTGAAGAAAGG + Intergenic
1055305943 9:74929021-74929043 ATTAATTTTTTTTTTAAGACAGG - Intergenic
1055316185 9:75036663-75036685 TTAAATTTTTTATTAAAGACAGG - Intergenic
1055321191 9:75084782-75084804 TTTATTTTATTTTTTAAGACAGG - Intronic
1055378784 9:75683185-75683207 GTTAATTCATCATGAAACACAGG - Intergenic
1055811719 9:80156575-80156597 TTTAATTTATTTTTAATGCCTGG - Intergenic
1055812537 9:80165897-80165919 TATAATTTATTATTAAAACCAGG + Intergenic
1056161551 9:83900962-83900984 ATTCATTTATTTTTAGAGACAGG + Intronic
1056313053 9:85361317-85361339 CATAATTTATGATAAAAGACTGG + Intergenic
1056358573 9:85828240-85828262 ATTCATTTATTTTTAGAGACAGG - Intergenic
1056810918 9:89763317-89763339 GTTTGTTTATTTTTACAGACAGG - Intergenic
1057105580 9:92412091-92412113 ATTTATTTATTTTTAGAGACGGG + Intronic
1057112626 9:92487827-92487849 GTTTATTTATTTTTTGAGACAGG - Intronic
1057716399 9:97499203-97499225 GCTAATTTTTTGGTAAAGACAGG - Intergenic
1057744215 9:97738730-97738752 GTTATTTATTTATTTAAGACAGG - Intergenic
1057793068 9:98136857-98136879 TTTAATTTTTTAATAGAGACAGG + Intronic
1057797029 9:98165129-98165151 GCTAATTTTTTTGTAAAGACAGG + Intronic
1057866453 9:98685696-98685718 CTTATTTTATTTTTAAAGACAGG + Intronic
1058065854 9:100547019-100547041 GTTATTTATTTATTTAAGACAGG + Intronic
1058193643 9:101948608-101948630 GAAAATTTATTTTTAAAAACCGG - Intergenic
1058220873 9:102300098-102300120 TTTAATTTATTAAAGAAGACTGG + Intergenic
1058711073 9:107679643-107679665 ATTAATTAATTATTTCAGACAGG + Intergenic
1058934041 9:109751251-109751273 AATAATTTATTATTAAAGTGGGG - Intronic
1059154797 9:111980123-111980145 ATTTATTTATTTTTAGAGACAGG - Intergenic
1059227448 9:112685260-112685282 TTTAATTTTTTAGTAGAGACAGG + Exonic
1059267051 9:113044357-113044379 GTTAAATTTTTATTCAAGCCTGG + Intronic
1060033199 9:120233211-120233233 GGTAATTTATTTTTAAAAAGAGG + Intergenic
1060120678 9:120986776-120986798 TTTATTGTTTTATTAAAGACAGG + Intronic
1060370885 9:123069876-123069898 TTTATTTTATTTTTAGAGACAGG - Intronic
1060395090 9:123310682-123310704 ATTAAATTATTATTAGAGACAGG + Intergenic
1060589695 9:124808982-124809004 TTTAATTTTTTAGTAGAGACGGG - Intronic
1060645563 9:125276407-125276429 GTAACATTTTTATTAAAGACTGG - Intronic
1061106514 9:128535011-128535033 ATTAATATATTATTACAGGCCGG - Intronic
1061213681 9:129208059-129208081 GTTAATTATTTTTTAGAGACAGG + Intergenic
1061492181 9:130951527-130951549 TTTAATTTTTTTTTAGAGACAGG - Intergenic
1061657984 9:132107414-132107436 TTTAATTTTTTTTTACAGACAGG - Intergenic
1061728013 9:132591873-132591895 GTGAAGTTATTATTACAGATGGG - Intergenic
1061975138 9:134064354-134064376 TTTAATTTTTTAGTAAAGATGGG - Intronic
1061990923 9:134158263-134158285 TTTAATTTTTTATTACAGAAGGG + Exonic
1203482845 Un_GL000224v1:22787-22809 GTTTATTTTTTTTTTAAGACAGG + Intergenic
1203611511 Un_KI270749v1:10805-10827 TTTAAATTTTTATTAGAGACGGG + Intergenic
1203611560 Un_KI270749v1:11303-11325 TTTTTTTTATTATTAGAGACGGG - Intergenic
1185595502 X:1304233-1304255 GCTAATTTTTTAGTAGAGACGGG - Intronic
1185727702 X:2435757-2435779 ATTCATTTATTTTTAGAGACAGG - Intronic
1185809916 X:3098259-3098281 GTTAAAAAATTATTCAAGACTGG - Intronic
1185979232 X:4757612-4757634 GTTAATGTTTTGGTAAAGACGGG + Intergenic
1186125816 X:6412843-6412865 GTTAATTATATTTTAAAGACTGG - Intergenic
1186202166 X:7165637-7165659 ATTATTTTATTTTTAGAGACAGG - Intergenic
1186344743 X:8680222-8680244 ATTTATTTATTCTTAGAGACAGG + Intronic
1186553535 X:10532529-10532551 ATTTATTTATTTTAAAAGACAGG - Intronic
1186583828 X:10850270-10850292 TTTATTTTTTTTTTAAAGACAGG - Intergenic
1186636037 X:11406072-11406094 TTTATTTTATTTTTAGAGACAGG + Intronic
1186790649 X:12994795-12994817 ATTAATTTTTTTTTAGAGACGGG - Intergenic
1186838950 X:13465737-13465759 GCTAATTTTTTAGTAGAGACAGG + Intergenic
1186898661 X:14030337-14030359 GTTAATCTATTTTCAAAGACTGG - Intergenic
1187072060 X:15898339-15898361 GTTTTTTTTTTTTTAAAGACAGG - Intergenic
1187192605 X:17049872-17049894 GTTAATTTATTATTGATGAAAGG + Intronic
1187365772 X:18664886-18664908 GTTAATTTTTTTGTAGAGACGGG + Intronic
1187856665 X:23643547-23643569 GTTAATGTATTATTCTAGATTGG + Intergenic
1187899699 X:24016173-24016195 GCTAATTTTTTAGTAGAGACGGG - Intronic
1188100585 X:26078393-26078415 GTTAATTTACTGTTTAACACTGG + Intergenic
1188381789 X:29503653-29503675 TTTATTTTATTATTTGAGACAGG + Intronic
1189149595 X:38691592-38691614 TTTATTTTATTTTTAGAGACAGG - Intergenic
1189976748 X:46468361-46468383 GCTAATTTTTTAGTATAGACGGG - Intronic
1190000166 X:46678440-46678462 ATTTATTTATTTTTAGAGACCGG + Intronic
1190081578 X:47360755-47360777 GTTTATTTATTTCTAGAGACAGG + Intergenic
1190096616 X:47486237-47486259 TTTTATTTTTTAGTAAAGACAGG - Intergenic
1190225024 X:48538835-48538857 TTTAATTTTTTGTTAGAGACGGG + Intergenic
1190616976 X:52243809-52243831 ATTTATTTATTTTTAGAGACAGG - Intergenic
1190837803 X:54117345-54117367 TTTATTTTATTTTTAGAGACAGG - Intronic
1191579191 X:62741329-62741351 GTTAAATTACTATTATAGCCTGG - Intergenic
1191603374 X:63034640-63034662 GGTAGTTTTTTAGTAAAGACGGG - Intergenic
1191964045 X:66736839-66736861 TTTTATTTTTTAGTAAAGACGGG - Intergenic
1192364344 X:70458461-70458483 GTTAATTTATTTGTAGAAACAGG + Intronic
1193032792 X:76917762-76917784 GTTATTTTTTTTTTAAAGATGGG + Intergenic
1193108851 X:77706898-77706920 CTTTATTTATTTTTAGAGACAGG - Intronic
1194047817 X:89031217-89031239 TTTAATGTTTTTTTAAAGACAGG + Intergenic
1194321640 X:92455418-92455440 ATTTATTTATTTTTAGAGACAGG + Intronic
1194590509 X:95794766-95794788 ATTTATTTATTGTTAGAGACAGG - Intergenic
1194615737 X:96101421-96101443 GTTAATTTATTATTGAAGAAAGG + Intergenic
1194690142 X:96974145-96974167 TTTAATTTATTAATAAGGAGGGG + Intronic
1195106307 X:101604674-101604696 CTTAATTTGTTTTTAAAAACTGG + Intergenic
1195330713 X:103797019-103797041 TTTTATTTTTTATTCAAGACAGG - Intergenic
1196192578 X:112810378-112810400 GTTATTTTATCTTTAAAGTCAGG - Intronic
1196558301 X:117117499-117117521 TTTTATTTTTTAGTAAAGACGGG + Intergenic
1196662637 X:118283585-118283607 TTTAATTTATTTTAAGAGACGGG - Intergenic
1197317081 X:124980198-124980220 TTTTTTTTATTATTAAAGATGGG - Intergenic
1197610052 X:128628104-128628126 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1197651719 X:129072435-129072457 ATTTATTTTTTATTAGAGACAGG - Intergenic
1198082932 X:133255940-133255962 GGTAATTTATTTTTAAAAAGAGG - Intergenic
1198472435 X:136960038-136960060 TTTATTTTATTTTTAGAGACAGG - Intergenic
1198523562 X:137476099-137476121 ATTCATTTATTTTTAGAGACAGG - Intergenic
1198665834 X:139021722-139021744 AATAAATTATTATGAAAGACAGG + Intronic
1198726222 X:139680127-139680149 ATTTATTTATTTTTAGAGACAGG + Intronic
1198867216 X:141136945-141136967 TTTAATTTCTTCTTAAAGCCAGG - Intergenic
1199165858 X:144674429-144674451 GTAACTTTATTTTCAAAGACTGG + Intergenic
1199270400 X:145875789-145875811 GTTAATTTATTAATGAAGAAGGG + Intergenic
1199768488 X:150958128-150958150 GTTTATTTATTTTTTGAGACAGG - Intergenic
1200282814 X:154792531-154792553 TTTTATTTATTTTTAGAGACAGG - Intronic
1200629812 Y:5568897-5568919 ATTTATTTATTTTTAGAGACAGG + Intronic
1202025153 Y:20513812-20513834 GTTCATTTACTATTAAAGAAAGG + Intergenic
1202299855 Y:23400853-23400875 ATTAATTTATCCTTAAAGAATGG + Intergenic
1202377621 Y:24251510-24251532 GTTAAATTATTATTATAGGCTGG + Intergenic
1202493160 Y:25418612-25418634 GTTAAATTATTATTATAGGCTGG - Intergenic
1202570955 Y:26269745-26269767 ATTAATTTATCCTTAAAGAATGG - Intergenic
1202584855 Y:26411420-26411442 GTTAATTTTTTCTTATAAACTGG - Intergenic