ID: 922122819

View in Genome Browser
Species Human (GRCh38)
Location 1:222690135-222690157
Sequence TCACACAACAAAATCACCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 2, 1: 5, 2: 5, 3: 29, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922122818_922122819 11 Left 922122818 1:222690101-222690123 CCATCTAGGTTTGTGTAAGTGCA 0: 92
1: 651
2: 1177
3: 1274
4: 1102
Right 922122819 1:222690135-222690157 TCACACAACAAAATCACCTAAGG 0: 2
1: 5
2: 5
3: 29
4: 266
922122816_922122819 25 Left 922122816 1:222690087-222690109 CCATATAGGCTATACCATCTAGG 0: 1
1: 0
2: 3
3: 7
4: 66
Right 922122819 1:222690135-222690157 TCACACAACAAAATCACCTAAGG 0: 2
1: 5
2: 5
3: 29
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922122819 Original CRISPR TCACACAACAAAATCACCTA AGG Intronic
901725881 1:11241733-11241755 TCCCACCTCAAAATCACCTTGGG + Intronic
901816606 1:11797282-11797304 AAACAAAACAAACTCACCTATGG - Intronic
905984466 1:42266470-42266492 ACACACAACTAAATCACCTTTGG + Intronic
906364619 1:45196339-45196361 TTTCACATTAAAATCACCTAGGG - Intronic
906864261 1:49399123-49399145 TCACTTAACAAAATGACCTCCGG + Intronic
908156713 1:61360821-61360843 ACACAAAACAAAAACACCTCAGG + Intronic
909471312 1:76031699-76031721 TGACACATCATAATCACCAAGGG + Intergenic
909885548 1:80938489-80938511 TCACAAAAAAAAATCCCCCAAGG + Intergenic
910477461 1:87622358-87622380 GAACTCAACACAATCACCTAAGG - Intergenic
911374286 1:97031967-97031989 TGACACATCATAATCACCCAAGG - Intergenic
912207011 1:107519746-107519768 GCACACAACAAAAATACGTATGG - Intergenic
914796225 1:150922827-150922849 TCACACTACATAATCATCTCTGG - Intergenic
914914745 1:151812617-151812639 GCACACATCAGAATCACCTGGGG - Intronic
916276487 1:162999708-162999730 TCACACAGCAAGATCACACATGG + Intergenic
917564171 1:176194635-176194657 TCAAACAACAAAAACAACAAAGG + Intronic
917580544 1:176373523-176373545 TCAAAAAAAAAAGTCACCTAGGG + Intergenic
917757226 1:178114309-178114331 ACAAACAACAAAAAAACCTAAGG - Intronic
917775712 1:178332344-178332366 TCACACAAAAAAATTAGCCAGGG + Intronic
917780854 1:178395130-178395152 CCATACATGAAAATCACCTAAGG + Intronic
918290844 1:183106594-183106616 CTGCACAACAAAATCACCTTTGG - Intronic
919155597 1:193761680-193761702 TCACCCCAGAAAGTCACCTACGG - Intergenic
919178427 1:194049887-194049909 TAAAACTACAAAACCACCTATGG - Intergenic
920997460 1:211009129-211009151 TCACACAATAAAATCCACAATGG - Intronic
921082227 1:211750726-211750748 TCATACAGCAATATTACCTAAGG + Intronic
921108672 1:212010851-212010873 TCAAACAACAAAACTGCCTAAGG + Intronic
922122819 1:222690135-222690157 TCACACAACAAAATCACCTAAGG + Intronic
922682759 1:227614475-227614497 TGACACAAGAACATCACCTGTGG - Intronic
922745883 1:228043536-228043558 TGACACAACAGAGTCAGCTATGG - Intronic
923421051 1:233815448-233815470 TCACTCAACATAATGACCTTTGG - Intergenic
923719339 1:236453774-236453796 TCACACAACGAAATCACCTAAGG + Intronic
923767944 1:236910286-236910308 TCACATAAAAAAACCATCTAAGG - Intergenic
923814882 1:237366373-237366395 TCACACAACAGGGTCACCGAAGG - Intronic
1063283454 10:4657368-4657390 CATAACAACAAAATCACCTATGG - Intergenic
1063899116 10:10713560-10713582 TCATATATCAAAATCACCGAAGG - Intergenic
1064174862 10:13066154-13066176 TAAAAAAAAAAAATCACCTAGGG - Intronic
1064348957 10:14559071-14559093 TCACACATCAAAATCACCTGTGG + Intronic
1064497691 10:15931182-15931204 ACACACATCAAAATTACCAAGGG - Intergenic
1064767862 10:18693235-18693257 CACAACAACAAAATCACCTAAGG + Intergenic
1064882362 10:20070333-20070355 TGAAGCAACAAAATCACCAAGGG - Intronic
1064905307 10:20339530-20339552 TCAAACAACAAACTCAGCGATGG + Intergenic
1066160928 10:32727293-32727315 TCAACCAACAAAATGCCCTAGGG - Intronic
1066591792 10:37003195-37003217 ACTCAAAACAAAATCAACTATGG - Intergenic
1066637900 10:37524966-37524988 TCACACAAAAAAATCACCTAAGG - Intergenic
1068208481 10:53889064-53889086 ACACACAAAAAAATCCCATATGG + Intronic
1068497218 10:57798078-57798100 GCACACAACAAAAGCACCATAGG + Intergenic
1070550081 10:77484030-77484052 TCAGGAAACAAAGTCACCTACGG + Intronic
1072446135 10:95500240-95500262 TTACACAAAAAGATCACCTGGGG + Intronic
1073230187 10:101962911-101962933 TCACATAACAAAGTGACCAAAGG + Intronic
1073622662 10:105065021-105065043 TAACAAAACTAAATCACGTAGGG + Intronic
1074224203 10:111467646-111467668 CTACACAACATAATCACCTAGGG + Intergenic
1075361506 10:121839796-121839818 ACACACAAAAAAATCACTTATGG + Intronic
1076787268 10:132757541-132757563 TCCCACAGCGAAATCGCCTAAGG + Intronic
1077821830 11:5752729-5752751 TCTCACAACCAAATCAAGTAAGG + Intronic
1078627489 11:12970861-12970883 TTGCACAAGAAAATCACCTGGGG + Intergenic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1079514081 11:21246499-21246521 TATAACAACAAAATCGCCTAAGG - Intronic
1080748296 11:35128683-35128705 TTTCAGAACAAAATCACCAATGG + Intergenic
1083786177 11:64948997-64949019 TCAATCAACAAAAACACCCATGG + Intronic
1085896486 11:80645834-80645856 ACTCAAAACAAAATCAACTATGG + Intergenic
1086400038 11:86453298-86453320 CCACACAACAAAAACAACTCTGG - Intronic
1087126826 11:94636523-94636545 ACACACACAAAAATCACCTAGGG - Intergenic
1087621406 11:100547085-100547107 TCTCACAACAACAGCACCCAGGG - Intergenic
1094017265 12:25878593-25878615 TCACACAACACAAAAACCTTGGG + Intergenic
1094651245 12:32377989-32378011 TCACACTCCAAATTCAGCTAGGG + Intronic
1097731932 12:63138227-63138249 ACACAAAACAAAATTAACTAAGG - Intergenic
1099092617 12:78332469-78332491 TGACAAGACAAAAACACCTAAGG - Intergenic
1100382253 12:94072885-94072907 TCCCTCATCAGAATCACCTAAGG + Intergenic
1100709995 12:97245497-97245519 CCACCCAACACAATCACCTGGGG - Intergenic
1102939139 12:116923293-116923315 TTACACATTAAAATCACCTGTGG - Intronic
1102988327 12:117296737-117296759 TCTCCCAACAAAATCACATGGGG - Intronic
1104516590 12:129432570-129432592 TCACACTACAGAGTCACATAAGG - Intronic
1104881844 12:132077243-132077265 TCACACAACAGTATGACCTCTGG - Intronic
1106669131 13:31886297-31886319 TCACAAACCAAAATCATCCATGG + Intergenic
1106679063 13:31991179-31991201 ACAGACAACGACATCACCTAGGG + Intergenic
1106824688 13:33507773-33507795 TCTCACAACAAAGTAAGCTAGGG + Intergenic
1107994771 13:45849258-45849280 GCACACAAAAAAACCACTTATGG - Intronic
1108118074 13:47151995-47152017 GCACAAAACAAAATCAACAAAGG - Intergenic
1108242974 13:48486240-48486262 GCACACAACAGAATAATCTATGG - Intergenic
1108720705 13:53128677-53128699 TCACATAACAAACTGTCCTAAGG - Intergenic
1109874675 13:68385734-68385756 TTGCATAACAAAATTACCTAAGG + Intergenic
1111315907 13:86559178-86559200 TCACACAGTGAAATCACCTAAGG + Intergenic
1111791462 13:92861694-92861716 TCACACAAGAAAAGAACCTTTGG - Intronic
1111854380 13:93618866-93618888 ACACAAGACAAAATCACCTGAGG - Intronic
1112188354 13:97149952-97149974 ACACACCACAAAATCACCTGAGG + Intergenic
1112754716 13:102618953-102618975 TCACTCAGCAAAATCATTTAAGG + Intronic
1112822505 13:103353191-103353213 TCACACAACAACAGCCCTTATGG - Intergenic
1114424980 14:22613919-22613941 TCACATAACAAAACAACCTGGGG + Intergenic
1115277524 14:31624512-31624534 CTACACATCAAAATCACCTCTGG - Intronic
1115922303 14:38389495-38389517 TCACAGATCAAAAGCAGCTAAGG + Intergenic
1116544087 14:46141085-46141107 TCAAACATCAGAAGCACCTAGGG - Intergenic
1116606138 14:46997963-46997985 TCAAATAACAAAATCACCATTGG - Intronic
1118170274 14:63381873-63381895 TCACACAATACAATTGCCTAAGG + Intronic
1120365754 14:83566231-83566253 CACAACAACAAAATCACCTAAGG + Intergenic
1120458270 14:84759865-84759887 TAACACAACAAACTCAACTGGGG + Intergenic
1121668918 14:95693150-95693172 TCACAAGAAAAAATCACCCATGG + Intergenic
1122450351 14:101800934-101800956 TCACGTAACACAATCACCTCTGG - Intronic
1123631554 15:22263915-22263937 TGACACAACAAGATCAGCTGAGG - Intergenic
1124839324 15:33227168-33227190 TAACACATCAGAATCACCCAGGG - Intergenic
1125004852 15:34806255-34806277 TAACACAACAAACAGACCTAGGG + Intergenic
1125326020 15:38536536-38536558 TTACACAACAAAATAATATAAGG + Intronic
1125988589 15:44081527-44081549 TCACACACAAAAATGAACTATGG + Intronic
1126765968 15:52011377-52011399 TTAAACAGCAAAATCACCAACGG - Intronic
1129155746 15:73716444-73716466 TCAATCTACAAAATCACCTAAGG - Intergenic
1130901311 15:88208765-88208787 CTGCACATCAAAATCACCTAGGG + Intronic
1131341324 15:91604207-91604229 CCACACATCAAAGTCACATATGG - Intergenic
1132362010 15:101224166-101224188 TTATACAACAAAATCACCTGAGG + Intronic
1132422242 15:101680433-101680455 AAACAAAACAAAAACACCTAAGG + Intronic
1133866516 16:9648989-9649011 TCACTCAACATAATGACCTCTGG - Intergenic
1134385914 16:13772268-13772290 TCCCACAACAAAATCACCTAGGG + Intergenic
1139415009 16:66801200-66801222 CCACACATCAAAGTCACCTGGGG + Intronic
1139851548 16:69953581-69953603 TGACACAAGCAGATCACCTAAGG + Intronic
1139880524 16:70176493-70176515 TGACACAAGCAGATCACCTAAGG + Intronic
1140371985 16:74419025-74419047 TGACACAAGCAGATCACCTAAGG - Intronic
1141971444 16:87486513-87486535 TCACACAACAAGATCAGCTGAGG + Intronic
1143276820 17:5717704-5717726 ACACAGAACACAATCACCAAGGG - Intergenic
1144086849 17:11817142-11817164 TCACATCACAAAATCCCCTCTGG + Intronic
1145744906 17:27310283-27310305 AGACACAACAAAATCTCCCAGGG - Intronic
1146475046 17:33156106-33156128 ATACACATCAAAATCACCTAGGG + Intronic
1148377747 17:47164273-47164295 ACAAATGACAAAATCACCTAAGG + Intronic
1149834458 17:59900232-59900254 ATACACAACAAAAACACATAGGG - Intronic
1150206154 17:63409587-63409609 ACAAATGACAAAATCACCTAAGG - Intronic
1153330201 18:3866113-3866135 TCAGACTACAAAATCACTTTTGG - Intronic
1153517428 18:5917106-5917128 TCAAACAAACAAATCTCCTATGG + Intergenic
1156774527 18:40770935-40770957 TCACACAATGAAATCGCCTTAGG - Intergenic
1157032667 18:43931580-43931602 ATACACAACAAAATCAGCAAGGG + Intergenic
1157945637 18:51976988-51977010 TACAATAACAAAATCACCTAAGG - Intergenic
1159919760 18:74216749-74216771 TCACTCAAAAAAATTAGCTATGG + Intergenic
1163181509 19:15607477-15607499 CCACACAAATAAATCACTTAAGG + Intergenic
1167886563 19:52504870-52504892 TCAAACAAAAAAACCACGTATGG - Intronic
926726489 2:16002411-16002433 TCCCAGAACAAAATCATCTAAGG + Intergenic
926860630 2:17305134-17305156 TTACACATTAAAATCACCTTGGG - Intergenic
929067148 2:37989581-37989603 TTACAAAACAAAATCAACTATGG + Exonic
929730410 2:44485503-44485525 TCGCACAACAAAATTGCCTAAGG - Intronic
930934985 2:56938015-56938037 TCAGTGAACAAAATCACCCATGG - Intergenic
932224223 2:70026565-70026587 TCACAAAACAAAATCAAGAAAGG + Intergenic
934882720 2:97997181-97997203 TCACTCAACAAATACAGCTAAGG - Intergenic
934984997 2:98878509-98878531 TCACACGATGAAATCACCTAAGG + Intronic
936672798 2:114678370-114678392 CCACAGAACAAAAACTCCTATGG - Intronic
938303686 2:130234018-130234040 TCACTCAACACAATCACTTTGGG + Intergenic
938452992 2:131440247-131440269 TCACTCAACACAATCACTTTGGG - Intergenic
940066024 2:149630586-149630608 TCAAACAATGAAATCACCTAAGG - Intergenic
940669930 2:156655083-156655105 CCACACATAAAAATCACCTGGGG - Intergenic
940804785 2:158174556-158174578 TCACACAACAAAATTGCCTAAGG - Intronic
942883206 2:180888724-180888746 TCACATAACATAATGACCTCAGG - Intergenic
945067688 2:205960929-205960951 GCACACAGCAGAATCACCGAGGG + Intergenic
945167283 2:206959442-206959464 TCACACATCAGAATCACTGAGGG - Intronic
946704255 2:222442482-222442504 TCACCCAACAAAATCAAAAAAGG - Intronic
947798984 2:232915335-232915357 ACACACAACAAACACTCCTAAGG - Intronic
947917654 2:233844579-233844601 TCAGACCACAAGAACACCTAGGG + Intronic
948042956 2:234918532-234918554 TCCCACGACAAAATTTCCTAAGG + Intergenic
1169093911 20:2879100-2879122 ACAGACATTAAAATCACCTATGG + Intronic
1169373201 20:5044359-5044381 GCACACAATGAAATTACCTAAGG - Intergenic
1169858530 20:10128754-10128776 TTATACAAAGAAATCACCTAGGG + Intergenic
1171318083 20:24213189-24213211 TCTCACAAGAAAATTTCCTATGG - Intergenic
1171468789 20:25353237-25353259 ACAAACAAAAAAAACACCTATGG - Intronic
1172184753 20:33024404-33024426 ACACAGAACAAGATGACCTAGGG + Intergenic
1172568639 20:35952098-35952120 TCACACAATAAAACTGCCTAAGG + Intergenic
1172856191 20:38004637-38004659 TCAAACAACAAATTCCCCTCTGG - Intronic
1174620350 20:51869578-51869600 GCACACAAAAAAATCAGCTGGGG + Intergenic
1177592047 21:23184012-23184034 TCAAATGACAAGATCACCTAAGG + Intergenic
1181949442 22:26543460-26543482 ACACACAAAAAAATCAGCCAAGG - Intronic
1184300718 22:43557804-43557826 TAACACACCAAGATCAACTACGG + Intronic
950866651 3:16195197-16195219 TGGCACAACTAAATGACCTAGGG - Intronic
950866898 3:16196791-16196813 TGGCACAACTAAATGACCTAGGG + Intronic
951840167 3:27025735-27025757 TCACACAACCAGATGGCCTATGG - Intergenic
952440763 3:33326074-33326096 TCAAACAACAAAAGTACATAAGG + Intronic
952765085 3:36946255-36946277 TTACACAATAGAATCACCTGGGG + Intergenic
953465668 3:43117259-43117281 GCACACAACAAAATCCACTCTGG + Intergenic
953896457 3:46806937-46806959 ACAAACAACAAAATTCCCTATGG - Intronic
955762407 3:62301556-62301578 TCACTCTGCAAAAGCACCTAAGG - Intergenic
956427067 3:69147021-69147043 TCACACAATGAAATCTCTTAAGG - Intergenic
956875910 3:73462979-73463001 TCACAAAACAAAATGACTGAAGG - Intronic
957277231 3:78106553-78106575 TCACAGAACAAAAGCCACTACGG - Intergenic
957403198 3:79743145-79743167 TTGCACAACAAAATTGCCTAAGG - Intronic
959687868 3:109167408-109167430 TGTCATAAGAAAATCACCTAAGG + Intergenic
960744254 3:120869001-120869023 TTACAAAACAAAATGTCCTAAGG + Intergenic
961768486 3:129230502-129230524 GCACACAACAGAATTGCCTAAGG - Intergenic
962732865 3:138299453-138299475 TCACACAACAGAAGCAAATATGG - Intronic
963834038 3:150038304-150038326 TCATTCAACCAAATCACCTGTGG + Intronic
964132497 3:153305727-153305749 ACACACAAAAAAATCACCTGTGG + Intergenic
965780704 3:172282905-172282927 TCAGTCAACAAAGACACCTATGG + Intronic
968623431 4:1614944-1614966 TTAAACAGCAAAATCACCAAAGG + Intergenic
968683282 4:1936935-1936957 TCACTCAACAACCTCACCTATGG - Intronic
968788157 4:2639875-2639897 TCACACCACAAAGACACATACGG - Intronic
970034086 4:11712225-11712247 ACACAAAACAAAATAACCTTAGG + Intergenic
970353928 4:15233713-15233735 TCAATCAGCAAAATCACCTCCGG - Intergenic
970713910 4:18897746-18897768 TCACTCTACAAAATCACTTTAGG - Intergenic
970880665 4:20925787-20925809 ACACAAAACAAAATCAGCAAAGG + Intronic
970964958 4:21917619-21917641 TGACACAACAAGGTCACATATGG - Intronic
972369777 4:38412076-38412098 TCACACAGCAAAAGAACTTAAGG - Intergenic
972689616 4:41383775-41383797 TCACACACCAGAATCACCTATGG - Intronic
973064434 4:45770737-45770759 GCAAACAACAAAATGACTTAAGG + Intergenic
973374900 4:49279885-49279907 CCACACTCCAGAATCACCTACGG - Intergenic
973375803 4:49285907-49285929 CCACACTCCAGAATCACCTACGG - Intergenic
973376703 4:49291926-49291948 CCACACTCCAGAATCACCTACGG - Intergenic
973377623 4:49298078-49298100 CCACACTCCAGAATCACCTACGG - Intergenic
973378543 4:49304214-49304236 CCACACTCCAGAATCACCTACGG - Intergenic
973379620 4:49311149-49311171 CCACACTCCAGAATCACCTACGG + Intergenic
973380518 4:49317289-49317311 CCACACTCCAGAATCACCTACGG + Intergenic
973381607 4:49324334-49324356 CCACACTCCAGAATCACCTACGG + Intergenic
973382511 4:49330356-49330378 CCACACTCCAGAATCACCTACGG + Intergenic
973386127 4:49515406-49515428 CCACACTACAGAATCACCTACGG + Intergenic
974007173 4:56570333-56570355 TACAACAACTAAATCACCTACGG - Intronic
974800203 4:66807520-66807542 TCACATGACAAAATCACCTAAGG - Intergenic
975067692 4:70088737-70088759 TCACTTAACATAATAACCTACGG + Intergenic
975354338 4:73382987-73383009 TGACACATCATAATCACCCAGGG + Intergenic
976094406 4:81492328-81492350 TAACACATGAAAATCACCTGGGG - Intronic
976662056 4:87549953-87549975 TCAAGCACCAAAAACACCTAAGG + Intergenic
977586466 4:98780391-98780413 TCAGATAACAAAATTTCCTAGGG + Intergenic
982133596 4:152251613-152251635 TCCCACAGCATAATCACCCAGGG + Intergenic
983146041 4:164215659-164215681 TCAAACAACAAAATTAAGTAAGG + Intronic
984234479 4:177139179-177139201 TCACACAACCAAATTGCCAAAGG - Intergenic
984276982 4:177622794-177622816 ACACACAAAAAAATGATCTATGG - Intergenic
984565626 4:181326889-181326911 TCCCACGACAAAATCACCTAAGG + Intergenic
986332755 5:6729756-6729778 ACACACAAAAAAACCACCAAGGG - Intronic
989719437 5:44506581-44506603 TCACAAAACTTAATCAACTAAGG - Intergenic
990098621 5:52154464-52154486 TTGCACAACAAAATTGCCTAAGG + Intergenic
990615083 5:57499638-57499660 ACAAACAAAAAAAACACCTATGG + Intergenic
990959723 5:61381594-61381616 TCACAGAACAAAAAAAACTATGG - Intronic
993603185 5:89954063-89954085 TCAGAAAAGAAAATCACCAATGG - Intergenic
993880977 5:93360590-93360612 TCACGTGACAAAATCACCTAAGG + Intergenic
994474034 5:100244578-100244600 TCAAAATACACAATCACCTATGG - Intergenic
994944947 5:106375497-106375519 CCACACATCAGAATCACCTGGGG + Intergenic
996951255 5:129128537-129128559 CTGCACAACAAAATCATCTAGGG + Intergenic
999693793 5:154170742-154170764 CCACACATCAGAACCACCTAAGG + Intronic
1000817768 5:165945183-165945205 TAATACATCAAAGTCACCTATGG - Intergenic
1001145917 5:169184578-169184600 ACACACAACAAAATCACCTAGGG + Intronic
1002952242 6:1825505-1825527 GGGCCCAACAAAATCACCTAAGG - Intronic
1003520127 6:6851213-6851235 TCACACAAAGTAAACACCTACGG - Intergenic
1006063872 6:31446727-31446749 ACACATGACAAAATCACCTAAGG - Intergenic
1006441049 6:34053855-34053877 ACACACATTAAAATCACCTAGGG + Intronic
1006614161 6:35313729-35313751 TCACTTAACAAAATGACCTATGG + Intronic
1006765789 6:36505186-36505208 TTGCACAACAAAATCACTTGGGG - Intronic
1007990795 6:46253986-46254008 TCACACAACGAAATCACCTAAGG + Intronic
1008125050 6:47658655-47658677 TCACATATTAATATCACCTAGGG + Intronic
1008601686 6:53102186-53102208 TCCCACAAAAAAAAGACCTACGG + Intergenic
1009846337 6:69140348-69140370 TCACTTAACAAAATGACTTATGG - Intronic
1012808810 6:103931088-103931110 TCATACAACAAGAACACCCAGGG + Intergenic
1012969616 6:105714753-105714775 TCTCACAACAAGATTATCTAAGG - Intergenic
1013238432 6:108220585-108220607 ACAAACAATGAAATCACCTAAGG + Intronic
1014333201 6:120096882-120096904 ACACACAAAAATATCACTTAGGG + Intergenic
1015146625 6:129994616-129994638 TTACTCAACAAAATCACTTAGGG + Intergenic
1016012481 6:139152583-139152605 TCACACACTAAAATAACATAAGG + Intronic
1018619803 6:165719198-165719220 TAACACAGGAAAATCACCTAGGG + Intronic
1021540024 7:21747210-21747232 CCACACAACAAAACAACCTTGGG - Intronic
1022830659 7:34062618-34062640 CACAACAACAAAATCACCTAAGG - Intronic
1023678923 7:42663401-42663423 TCATACAACAGGATCATCTAAGG + Intergenic
1025984270 7:66434150-66434172 TCACACAAAAAAAAAACATATGG + Intergenic
1027258138 7:76444390-76444412 TCAAAAAACAAAATTGCCTAGGG + Intergenic
1027280708 7:76607630-76607652 TCAAAAAACAAAATTGCCTAGGG - Intergenic
1028049991 7:86173909-86173931 ACACACAAAAAAAGCACCTTTGG + Intergenic
1028920430 7:96304744-96304766 CCATGCAACACAATCACCTATGG + Intronic
1028965244 7:96794970-96794992 TCACAGAAAAAAATTACCTCAGG + Intergenic
1029892487 7:103944992-103945014 ACAAACAAAAAAAACACCTACGG + Intronic
1030965165 7:115983018-115983040 TCACACAAGAAAATGAACTTTGG + Intronic
1030969075 7:116031845-116031867 TCATACATCTAAATCTCCTAAGG + Intronic
1030980237 7:116177849-116177871 TCACATGATGAAATCACCTAAGG - Intergenic
1035915296 8:3613985-3614007 GTAGATAACAAAATCACCTAGGG + Intronic
1037630987 8:20656065-20656087 TGTCACCACAAAATCACCAAGGG - Intergenic
1039037607 8:33376806-33376828 GAACAGAACAAAATCACGTAAGG + Intronic
1039226674 8:35396296-35396318 TTACACAGCAAAATCAGCAAAGG + Intronic
1039599400 8:38821795-38821817 TCACACAACAAAATCACCTAAGG - Intronic
1040769880 8:50960736-50960758 TTACATATCAAAATCAGCTAGGG + Intergenic
1041289130 8:56291987-56292009 TCACACTTCAAAATAACCCATGG - Intergenic
1041534327 8:58909082-58909104 TCACACATTAGAATTACCTAGGG + Intronic
1041852954 8:62413896-62413918 TAAAAAAACAAAATCACATAAGG - Intronic
1042189475 8:66171055-66171077 CATAACAACAAAATCACCTAAGG + Intronic
1042742107 8:72061405-72061427 TCACAAAATAAAATCACCTGTGG - Intronic
1042757813 8:72236681-72236703 TCACAGAATAAAATCTCCTGTGG - Intergenic
1043859430 8:85298741-85298763 ACCCACAACTGAATCACCTATGG + Intergenic
1045619875 8:103963696-103963718 TGACACATCATAATCACCCATGG + Intronic
1045826256 8:106402097-106402119 TCAAGCAACAAAATCACATCTGG + Intronic
1045888768 8:107129585-107129607 TGACACAAGAAAAGCACCTCAGG - Intergenic
1046132466 8:109983700-109983722 TGACATAACAAAATCATGTATGG - Intergenic
1046197465 8:110883399-110883421 TCAAACAACAAAACCACATCTGG - Intergenic
1048420202 8:134270613-134270635 TCTCAAAACAAGATGACCTAGGG - Intergenic
1048787407 8:138064598-138064620 TCTTACAACAAAATCACTTAAGG + Intergenic
1049227053 8:141459421-141459443 ACACAGAAGAACATCACCTAAGG + Intergenic
1052716297 9:32121795-32121817 TCATACAATAAAATAACCTACGG - Intergenic
1053402740 9:37841052-37841074 CACAACAACAAAATCACCTAAGG + Intronic
1053452660 9:38206091-38206113 CACAACAACAAAATCACCTAAGG + Intergenic
1054871604 9:70052112-70052134 ACACATATCACAATCACCTAGGG - Intronic
1055604407 9:77953321-77953343 TCTCTCAACAAAATCATCTCTGG + Intronic
1058191501 9:101922127-101922149 TCAAACAACAAAAACAGTTATGG + Intergenic
1058808337 9:108615001-108615023 TCAGAAAACAAAACTACCTAAGG + Intergenic
1059025028 9:110617292-110617314 TAGCACAATAGAATCACCTAGGG - Intergenic
1059958867 9:119545686-119545708 TTACAGAACCAAATTACCTAGGG - Intergenic
1203548718 Un_KI270743v1:151384-151406 CCACACTCCAGAATCACCTACGG - Intergenic
1203549699 Un_KI270743v1:157021-157043 CCACACTCCAGAATCACCTACGG + Intergenic
1203550642 Un_KI270743v1:163186-163208 CCACACTCCAGAATCACCTACGG + Intergenic
1185839381 X:3374607-3374629 TCTCACAATAGAATCACGTAAGG + Intergenic
1187004340 X:15217146-15217168 TCTCACAACAGAGTCACCTAGGG - Intergenic
1187488622 X:19728515-19728537 TTACTCAACAAAATCACCATGGG + Intronic
1188125220 X:26359214-26359236 TTACACAACAATATTAACTAAGG + Intergenic
1189063310 X:37777967-37777989 CACAACAACAAAATCACCTAAGG - Intronic
1189570224 X:42287054-42287076 ACACACATCTAAATAACCTATGG - Intergenic
1189679693 X:43503042-43503064 TTACACAACAGAATCCCCAATGG + Intergenic
1190874839 X:54452444-54452466 ACACACATTAAAATCACCTAGGG + Intronic
1190969778 X:55337267-55337289 GGATACATCAAAATCACCTAGGG + Intergenic
1191892730 X:65961337-65961359 TCACACATTAGAATCATCTAGGG - Intergenic
1191946261 X:66538187-66538209 TCAAACAATAAAACCACATATGG - Intergenic
1194488924 X:94522564-94522586 TCACACAACCAAATATCCTGGGG + Intergenic
1195413568 X:104595819-104595841 TCTTACATAAAAATCACCTAGGG + Intronic
1196023202 X:111011777-111011799 ACAAACAGCAAAATCCCCTATGG - Intronic
1197685420 X:129434705-129434727 TCACAGAACAAAATTACATTGGG - Intergenic
1197961933 X:132016546-132016568 GTACACAACATAATCACCTGGGG + Intergenic
1199251931 X:145673621-145673643 TTACACAAAAAAATGACTTAAGG - Intergenic