ID: 922122891

View in Genome Browser
Species Human (GRCh38)
Location 1:222691138-222691160
Sequence GAGCCATGACCTAGGATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922122889_922122891 -2 Left 922122889 1:222691117-222691139 CCAAATTATTAGAAGACATTTGA 0: 1
1: 0
2: 0
3: 38
4: 347
Right 922122891 1:222691138-222691160 GAGCCATGACCTAGGATGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 149
922122888_922122891 8 Left 922122888 1:222691107-222691129 CCTTTCAAAACCAAATTATTAGA 0: 1
1: 0
2: 1
3: 42
4: 484
Right 922122891 1:222691138-222691160 GAGCCATGACCTAGGATGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922122891 Original CRISPR GAGCCATGACCTAGGATGAG AGG Intronic
901933001 1:12608898-12608920 AAGCCATGACTTAGGTTGGGTGG - Intronic
902658344 1:17884823-17884845 AATCCATGACCAAGGTTGAGGGG - Intergenic
903620667 1:24695855-24695877 GGGCCATGACACAGGCTGAGGGG - Intergenic
904424062 1:30412359-30412381 GAGCCAAGACCTGTGAGGAGAGG + Intergenic
905020674 1:34808919-34808941 GAGCCATGAACTAGGATATGTGG - Intronic
905349393 1:37334270-37334292 GAGCCATGAGCTAGGACATGAGG - Intergenic
905434360 1:37946657-37946679 GAGCCATGTCCTAGGAGCAAAGG - Intronic
908549463 1:65194259-65194281 GAGCAATGAACTAGGATATGTGG - Intronic
910443562 1:87277899-87277921 AAGCAATGATCTAGGAGGAGGGG - Intergenic
911651255 1:100391595-100391617 GAGCCCTCCCCAAGGATGAGGGG - Intronic
915328176 1:155092068-155092090 GAGACAAGGACTAGGATGAGGGG + Intergenic
922122891 1:222691138-222691160 GAGCCATGACCTAGGATGAGAGG + Intronic
1062844943 10:696727-696749 GAGCCATGTCCTAGGACTACAGG - Intergenic
1063530020 10:6821774-6821796 GAGACATAACCTAAAATGAGAGG - Intergenic
1064266599 10:13830458-13830480 GAGCCCTGAGCCAAGATGAGAGG + Intronic
1067431685 10:46249689-46249711 GAGCCAGGACCAAGGGGGAGAGG + Intergenic
1067441735 10:46312485-46312507 GAGCCAGGACCAAGGGGGAGAGG - Intronic
1069588425 10:69626784-69626806 GAGCAATAAGCTAGGAAGAGTGG + Intergenic
1070400622 10:76050484-76050506 CAGCCATGAACTATGATGAATGG - Intronic
1072125833 10:92444538-92444560 GAACCAGGACATAGGATGAAAGG - Intergenic
1073072052 10:100800739-100800761 GGGCCCTGACCTGGGGTGAGAGG + Intronic
1074792042 10:116899261-116899283 GAGAAATGACGTAGGATAAGGGG + Intronic
1077441589 11:2571539-2571561 GAGCCATGTGCTGGGATGGGTGG + Intronic
1077895543 11:6450791-6450813 GAGCCAAGATATAGGAGGAGAGG + Intronic
1079022660 11:16922714-16922736 GAGCCTTTACCTGGGATGGGTGG - Intronic
1081867814 11:46369258-46369280 CACCCAGGACCCAGGATGAGGGG - Intronic
1083404334 11:62446287-62446309 GAGCCCTGAGCTGGGAAGAGAGG - Intronic
1083983136 11:66190937-66190959 GGGCCAGGCCCTGGGATGAGGGG + Intronic
1084452131 11:69245451-69245473 GAGAGATTAACTAGGATGAGGGG + Intergenic
1084676895 11:70640605-70640627 GAGCCCTGACCTGGGATCACAGG + Intronic
1087038091 11:93773871-93773893 GGGCCATGAGCTAGGCAGAGGGG - Intronic
1090863780 11:130676975-130676997 GAGCCATGACTTGGGTTGATGGG + Intronic
1091405485 12:206771-206793 GTCCCAGGACCTAGGCTGAGGGG + Intronic
1091802932 12:3336108-3336130 GAGCCATGACCTAGGAGTTTGGG - Intergenic
1093135026 12:15439680-15439702 GAGGCAAGGCCGAGGATGAGTGG + Intronic
1096227104 12:49873088-49873110 GAGCCATGGCCAGGGCTGAGAGG + Intronic
1096531655 12:52246484-52246506 GAGACATGACGGAGGATGAATGG + Intronic
1096582316 12:52593853-52593875 GAGCCAGGGGCTAGGAAGAGGGG + Intronic
1096742442 12:53703599-53703621 GACCCATGACCTAGTATGGAAGG + Intergenic
1098834626 12:75407152-75407174 TAGCCATGGAGTAGGATGAGGGG - Intronic
1099059684 12:77891817-77891839 GAGCCAGCACTTAAGATGAGTGG - Intronic
1100245695 12:92754354-92754376 GAGCCATGACCTCAAATCAGTGG - Intronic
1102491260 12:113290845-113290867 GTGCCATGTGCTAAGATGAGAGG - Intronic
1105557626 13:21461179-21461201 GTGCCATCCCCTTGGATGAGGGG + Intergenic
1105864948 13:24451185-24451207 GAGCCCTGACCTGGGAGCAGGGG + Intronic
1110441855 13:75535228-75535250 GGGGCATGAGCTAGGAAGAGTGG + Intronic
1111017707 13:82402847-82402869 GTGCCCTGACCTAGGGTGATGGG - Intergenic
1112363452 13:98738063-98738085 GAGCAATGACCTAGGATATCTGG + Intronic
1113662149 13:112114941-112114963 GAGCCATGTCCTTGGATGCCGGG + Intergenic
1113885328 13:113655881-113655903 GAGCCCTGAGCTGTGATGAGAGG + Intronic
1115140877 14:30169474-30169496 GAGTGATGACCTAGGATGTCTGG - Intronic
1119608631 14:76043015-76043037 GAGCCCTGGGCTGGGATGAGAGG + Intronic
1121315432 14:92958502-92958524 GAGCCTTGAGCCAGGGTGAGTGG + Intronic
1121715348 14:96070027-96070049 GAGCCCTGCCCCAGGAAGAGGGG + Intronic
1122053985 14:99079827-99079849 TTGCCATGATCTAGGAAGAGAGG + Intergenic
1122255408 14:100472519-100472541 GGGCCATGACGGAGGAGGAGAGG - Intronic
1122826842 14:104374689-104374711 GAGCCCTGGCCCAGGAGGAGAGG + Intergenic
1124999257 15:34754282-34754304 GAGCCTTGACCTAGGACGATGGG + Intronic
1125356779 15:38824824-38824846 GAGCCAAGCCCCAGGAAGAGGGG - Intergenic
1126246945 15:46518304-46518326 GAGCAAAGACCTAGCATCAGGGG - Intergenic
1127681378 15:61301927-61301949 CAGCCATGGCTGAGGATGAGGGG + Intergenic
1129076401 15:73000130-73000152 GAGGCATGGCCAAGGATAAGGGG - Intergenic
1130076644 15:80695436-80695458 GAGCCAGGCCCCAGGATGAACGG + Exonic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136566918 16:31076233-31076255 GGGCCAAGGCCTAGGAAGAGGGG - Exonic
1138548549 16:57734814-57734836 GAGCCCTGACCTGCGGTGAGAGG + Intergenic
1138611301 16:58127363-58127385 GGGACTTGACCTAGGAGGAGAGG - Intronic
1141069484 16:80940330-80940352 GAGCCATCACCTAGTGTGAGAGG + Intergenic
1141109962 16:81264246-81264268 GAGCAATGACCTGGGCAGAGAGG - Intronic
1146717642 17:35099838-35099860 GAGCCATGACCCTGGCTGGGAGG - Intronic
1148085763 17:44992985-44993007 GAGACAGGACCTGAGATGAGAGG - Intergenic
1151972393 17:77465575-77465597 GCTCCATGAACTAGGATGAATGG + Intronic
1152236721 17:79142838-79142860 GAGCCATGTTCAAGGATGGGGGG + Intronic
1153778363 18:8473479-8473501 GAGCCAGGACCTAGAGAGAGAGG + Intergenic
1153942029 18:9986728-9986750 GTGCCATGAGCTGGGAGGAGCGG + Intergenic
1157490686 18:48121718-48121740 GAGCCATCACCTGGCCTGAGAGG + Intronic
1159059782 18:63502481-63502503 GAGCCATGCCCTAGGGTCATAGG - Intronic
1159340230 18:67125025-67125047 GAGCCATGACCTAACAACAGAGG - Intergenic
1160157764 18:76446445-76446467 GGGCCATGACCACGGCTGAGCGG + Intronic
1161416755 19:4151548-4151570 GTGCCATGTGCTAGGTTGAGAGG - Intergenic
1162012329 19:7825068-7825090 GAGGCAGGACCCAGGAGGAGAGG + Intergenic
927056986 2:19374427-19374449 GAGCAATGAACTAGGATAATTGG - Intergenic
927630219 2:24766724-24766746 GATCGTTGACCTAGGAAGAGAGG + Intronic
929844097 2:45503295-45503317 GAGCTATCACCTAGGAAGACTGG + Intronic
930030476 2:47055580-47055602 GAGCCGTGACCTGGGATCATGGG - Intronic
932029753 2:68171685-68171707 GAGGCTTGACCAAGGATGAAAGG + Intronic
932201887 2:69835862-69835884 GAACCATGACTTAGGGTGAATGG + Intronic
935560034 2:104550134-104550156 GAGCAATGGACTAGGATGTGTGG - Intergenic
935975505 2:108574484-108574506 GAGCCATGACCTCGAGTGAAAGG - Intronic
938976478 2:136483098-136483120 GTGCCATGAGGAAGGATGAGAGG + Intergenic
941692165 2:168512162-168512184 GTGCCAGGAGCTAGGAGGAGAGG + Intronic
947403896 2:229755100-229755122 CAGCCATGACCTTGGATGATGGG + Intergenic
1170587451 20:17745531-17745553 GAGAGATGACCGAGGAGGAGCGG + Intergenic
1172096973 20:32465277-32465299 GACCCATCACCCGGGATGAGTGG + Intronic
1172870003 20:38129967-38129989 GAGCCCTGACCTTGGCTGACTGG - Exonic
1173167334 20:40694737-40694759 GAGGCAGGACCCAGGATCAGAGG - Intergenic
1173182483 20:40815507-40815529 GAGCCATGACAGAGGAAGCGTGG + Intergenic
1173844046 20:46177010-46177032 GAGCCATGGGCTAGGGTGGGGGG + Intronic
1177303241 21:19277626-19277648 GAGTCATGAGCCAGGATGTGTGG + Intergenic
951054567 3:18132855-18132877 AAGACTTGACCTAGGCTGAGAGG + Intronic
952832281 3:37575171-37575193 CAGGAATGCCCTAGGATGAGTGG - Intronic
953454473 3:43030773-43030795 GACCCATGACCTAAGCTGATGGG - Intronic
956736103 3:72239500-72239522 GACCCAGGGCCTTGGATGAGTGG - Intergenic
959725308 3:109535316-109535338 CAGACTTGACATAGGATGAGAGG - Intergenic
961121210 3:124372886-124372908 GAGCCCTTCCCTTGGATGAGCGG + Intronic
961878065 3:130039327-130039349 GAGCCATGACCATGGAGGACAGG + Intergenic
966589498 3:181665883-181665905 TGGCCATGACCTAGGATGGATGG - Intergenic
968515879 4:1015439-1015461 GAGCCATGATCCAGGATGGCTGG + Intronic
970212786 4:13728552-13728574 GAGCCTTGACATAGAATGATGGG + Intergenic
970902618 4:21177078-21177100 GATCCCTGAACTAGGATGACAGG + Intronic
971545827 4:27884916-27884938 GAGCAATGAACAAGGATGACAGG - Intergenic
975693407 4:76987848-76987870 AAGACATGACCTAAGATGAAGGG + Intronic
981495399 4:145385945-145385967 GAGCCATGCCCTACGACAAGGGG - Intergenic
982616809 4:157648353-157648375 GCCACATGAACTAGGATGAGTGG - Intergenic
983498924 4:168477860-168477882 GAGCTATGACCAAGGAAGAATGG + Intronic
987987757 5:25170979-25171001 GAGCTATGCCCTAGGAACAGAGG - Intergenic
991044923 5:62212669-62212691 TAGGCATGTCCTAGGATGACAGG + Intergenic
994676014 5:102822914-102822936 GGGCCATGGACTGGGATGAGTGG - Intronic
998009044 5:138678538-138678560 GAGTTATGACCTAGAATTAGAGG - Intronic
998175886 5:139901912-139901934 GAGCCATGAGATTGGAGGAGTGG - Intronic
999351952 5:150880561-150880583 GATACATGACCTAGGAGGACAGG - Intronic
1006591956 6:35164796-35164818 AAGCCATGTGCTAGAATGAGAGG - Intergenic
1007077237 6:39075543-39075565 GAGCCCTGAGCTAGGGTGTGAGG - Intronic
1009637324 6:66282568-66282590 GAGCAATGAGCAAGGAGGAGTGG - Intergenic
1013834903 6:114323179-114323201 GAGCCATGCCCCAGAATGAAGGG + Intronic
1015162092 6:130164687-130164709 GAGCCATGTCCTTGGGTAAGGGG - Intronic
1018468974 6:164079934-164079956 GAGCCCTGATCTAAGATGACTGG - Intergenic
1019209368 6:170392827-170392849 GAGCCATGTCCAACCATGAGAGG + Intronic
1019907856 7:4078235-4078257 CAGCCACTACCCAGGATGAGTGG - Intronic
1021273659 7:18623539-18623561 GAGCCAAGAACCAGGATGTGTGG + Intronic
1022836284 7:34118518-34118540 GAAGCATTACCTTGGATGAGTGG + Intronic
1023769007 7:43537667-43537689 GAGCCATGAACTATGATCTGGGG - Intronic
1024230304 7:47358668-47358690 ATGCCAGGACCTGGGATGAGGGG - Intronic
1026871545 7:73855820-73855842 GCCCCAGGACCCAGGATGAGAGG - Intergenic
1029180874 7:98700807-98700829 GTGCCATGACCTTGTAGGAGAGG - Intergenic
1034537252 7:151733163-151733185 GAGCCAAGAGCTAGGCTGGGTGG - Intronic
1035565174 8:636324-636346 GAGCCAAGGCCTCGGATGTGTGG + Intronic
1037416355 8:18654901-18654923 AAGCCATGATCTATGATGATAGG + Intronic
1040875511 8:52147742-52147764 GACCCTTGACCCAGGATGTGTGG - Intronic
1041029818 8:53725245-53725267 GAGACCTGAGCTAGCATGAGCGG + Intronic
1041595626 8:59647515-59647537 GAGGCATGACCAAGGCTGGGTGG - Intergenic
1042508551 8:69587619-69587641 GGGATATGACCTAGGATGAGTGG - Intronic
1043912087 8:85875117-85875139 GAGCAATGACCTAAGATTGGTGG - Intergenic
1045380964 8:101625407-101625429 CACCCATGTCCTAGAATGAGAGG + Intronic
1047427440 8:124759584-124759606 GAGCCATGCCTTAGAATCAGAGG - Intergenic
1048181858 8:132202567-132202589 GAGCCATGAACTAGGATATCTGG - Intronic
1048664028 8:136641108-136641130 GAGCCCTAACCTAGGATCATGGG - Intergenic
1050979733 9:11995436-11995458 GAGACATGTTCCAGGATGAGTGG - Intergenic
1053466474 9:38312196-38312218 GAGCCGTGACCTGGGAGGCGGGG - Intergenic
1062032851 9:134369820-134369842 GAGCCTTGAACTAGGAGGAGGGG - Intronic
1062636410 9:137493900-137493922 GCGCCAGGACCTAGGATCTGCGG + Intronic
1187104282 X:16223937-16223959 GAGCAATGACCTAGGATAACTGG - Intergenic
1187661857 X:21556426-21556448 GAATCCTGACCTAGAATGAGAGG + Intronic
1188533055 X:31163690-31163712 GAGGCGTGACCTTGAATGAGAGG - Intronic
1193782425 X:85719979-85720001 GAACCATGTCCGAGGGTGAGGGG + Intergenic
1196119755 X:112037203-112037225 GAGGAATTACCTAGGATGATAGG - Intronic
1198974346 X:142318753-142318775 GAGACATAACCTTGGTTGAGTGG + Intergenic