ID: 922124444

View in Genome Browser
Species Human (GRCh38)
Location 1:222709135-222709157
Sequence ATGTATTTTCAACTGTAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922124444 Original CRISPR ATGTATTTTCAACTGTAGCC GGG Intronic
901712786 1:11128843-11128865 AAGTATCCTCACCTGTAGCCAGG + Exonic
902981148 1:20124265-20124287 ATGTTTTTCCAACTGTTGCCAGG - Intergenic
903598718 1:24517436-24517458 TTTTCTTTTTAACTGTAGCCTGG + Intronic
905351984 1:37353657-37353679 ATGTATTTCCAAATGTAACATGG + Intergenic
906922108 1:50075751-50075773 ATGTATTTTCAACTTATGACGGG - Intronic
908122831 1:61002005-61002027 GTGCATTTTCAACAGTATCCTGG + Intronic
909335840 1:74472764-74472786 AGGTATTTTGAAATATAGCCAGG + Intronic
910767379 1:90795283-90795305 ATGTATTTTCACAAGTACCCTGG - Intergenic
911107673 1:94149196-94149218 ATTTAAATTCACCTGTAGCCTGG - Intronic
912361261 1:109098195-109098217 ATGTGTTTTAAAAAGTAGCCAGG + Intergenic
916208773 1:162341342-162341364 CTGTATTTTAATCTGTACCCTGG + Intronic
917388826 1:174509685-174509707 TTGTATTTCCAGCTGTTGCCTGG + Intronic
917461152 1:175230525-175230547 ATGGAGTTTCATCTTTAGCCAGG + Intergenic
917924501 1:179778024-179778046 ATGCATTTTCAACTGATGACAGG - Intronic
922048974 1:221972472-221972494 ATGTAAATTCACCTATAGCCTGG + Intergenic
922124444 1:222709135-222709157 ATGTATTTTCAACTGTAGCCGGG + Intronic
924215545 1:241817792-241817814 ATGTACTTTCAAATGAAGTCTGG + Intergenic
1068020956 10:51583209-51583231 ATGTCTTTTTAACTTTATCCTGG - Intronic
1070551993 10:77497177-77497199 ATGAATTTTCAAAAGCAGCCAGG + Intronic
1070595168 10:77827778-77827800 ATATCTTTCCAAGTGTAGCCTGG - Intronic
1071876529 10:89849143-89849165 ATGTATTTTCTACTAAACCCTGG - Intergenic
1072658971 10:97350792-97350814 ATGGATTTGCAACTGGTGCCAGG - Intergenic
1073494116 10:103876137-103876159 CTGTATTTTCCAATGTGGCCAGG + Intergenic
1075624803 10:123954665-123954687 AAGTATCTTCAGCTGTAGCAAGG + Intergenic
1083381869 11:62275767-62275789 ATGTATATTCATCTGTTGTCTGG + Intergenic
1085795436 11:79535340-79535362 GTGCATTTCCAACTGTAGCCTGG - Intergenic
1090911349 11:131122249-131122271 ATGCATTTTCACCTGCAGGCTGG - Intergenic
1092571146 12:9722944-9722966 ATTTTTTTTCAAATGTACCCTGG - Intronic
1092606388 12:10124165-10124187 ATTTATTTTCAATTATAGGCTGG + Intronic
1093697029 12:22172355-22172377 GTGCATTTTCAAATGTTGCCAGG - Intronic
1094150632 12:27279036-27279058 ATGAATTTTCAACTTTAGGTTGG + Intronic
1095649403 12:44589186-44589208 AAGAATTTTCAACAGTAGGCAGG - Intronic
1097770616 12:63580266-63580288 AAGTATCTTCTGCTGTAGCCTGG + Intronic
1099028457 12:77495089-77495111 AAGCATTTACAACTGTAGCGGGG + Intergenic
1099709822 12:86209092-86209114 ATATTTTTTCAATTGTAGACAGG - Intronic
1100706003 12:97200807-97200829 ATGAATATTCAACTGTAGAATGG - Intergenic
1100717877 12:97324828-97324850 ATGTATTTTTAAATGTCTCCTGG + Intergenic
1103808785 12:123596421-123596443 ATGTATTTTCAACATAAGCTGGG + Intronic
1105809506 13:23982284-23982306 ATGCATTTTCCACTGCAGCCTGG + Intronic
1107036625 13:35909127-35909149 ATGTATTTTCAATAGCACCCGGG + Intronic
1112701007 13:102008011-102008033 ATTCATTCTCACCTGTAGCCTGG - Intronic
1112849974 13:103694076-103694098 ATTTATTTTCAAATGTAGTTGGG + Intergenic
1113172159 13:107516996-107517018 ATGCATTTCCAACTATAGCCTGG - Intronic
1113380196 13:109797077-109797099 ATGCAAGTTCAGCTGTAGCCTGG + Intergenic
1115025698 14:28742971-28742993 AAGTATTTAAAACTCTAGCCTGG + Intergenic
1126802642 15:52313664-52313686 ATGTATTGTCAATTTTTGCCTGG + Exonic
1127227078 15:56942003-56942025 ATATATTTTCTTGTGTAGCCTGG + Intronic
1129622097 15:77157034-77157056 ATGTATTTTCAACTGCATATGGG + Intronic
1130454079 15:84087314-84087336 ATGTATTGTAACCTGTGGCCTGG + Intergenic
1133886982 16:9839289-9839311 ATGAAATTTCAACTCTAGCCAGG + Intronic
1135863858 16:26082276-26082298 ACGTAGTTGCAACTGCAGCCTGG - Intronic
1138910581 16:61393246-61393268 ATATATGCTTAACTGTAGCCAGG + Intergenic
1139937078 16:70579264-70579286 ATGTCTCTTCATCTGTAGACTGG + Intergenic
1145857594 17:28176932-28176954 ATGGATTTTCAACTGTAGGCAGG - Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1148768044 17:50050804-50050826 CAGTATTTTCAACCATAGCCTGG + Intergenic
1155912069 18:31515557-31515579 ATGTATTTTCAAAGGTGGCATGG - Intronic
1156062543 18:33097838-33097860 ATGTATAATTAACAGTAGCCTGG - Intronic
1158037028 18:53044357-53044379 ATGTATTTTTAAATGTAGTTTGG + Intronic
1159304235 18:66618443-66618465 ATGTATTTTCATTTGATGCCTGG - Intergenic
1162973979 19:14197953-14197975 ATGTAGGTGCAACTGTAGACAGG + Intronic
1163022715 19:14491905-14491927 ATATATTTTCAAAATTAGCCAGG + Intronic
1164302627 19:23975075-23975097 ATGTATTCTCATCTCTTGCCTGG - Intergenic
925552416 2:5090712-5090734 ATGTGTTTTCAACCCTAGACTGG - Intergenic
927941622 2:27106984-27107006 ATGTATTTTGAAGTGCAACCTGG + Intronic
928213335 2:29340227-29340249 ATGCAATTTCAACTGTACCTTGG + Intronic
928992878 2:37254192-37254214 ATTTTTTTTTACCTGTAGCCAGG + Exonic
931525811 2:63151640-63151662 ATGTATATTCAACTGTAATATGG + Intronic
932059837 2:68485002-68485024 ATGTACTTTCAACTGTGTTCAGG - Intronic
937033060 2:118756914-118756936 ATGCCTTTGCAGCTGTAGCCTGG + Intergenic
937894581 2:126969048-126969070 ATCTATTTTCCTCTGTAGACTGG - Intergenic
938758928 2:134406268-134406290 ATTTGTTTTCAACTGTAGAAAGG - Intronic
940061785 2:149579142-149579164 ATGTAATTACATCTGTAGACTGG - Intronic
943435289 2:187858224-187858246 CTGTATTTTAAATTGTAGCTTGG - Intergenic
944619168 2:201495772-201495794 GTGTATTTTTTACAGTAGCCAGG + Intronic
945986687 2:216360182-216360204 AACTATTTTAAATTGTAGCCAGG + Intronic
947362174 2:229357084-229357106 ATGCATTTTTAACTGTACACAGG - Intergenic
948042858 2:234917601-234917623 ATGAATCTACAGCTGTAGCCAGG + Intergenic
1170597939 20:17819434-17819456 ATGTATTCTCATCTGGAGGCTGG + Intergenic
1173840069 20:46151347-46151369 ATGTGTTTCCCACTGCAGCCTGG - Intergenic
1174969659 20:55260049-55260071 ATGGAGCTCCAACTGTAGCCTGG - Intergenic
1176682288 21:9825648-9825670 ATGGATTTTCAACGGGAGTCCGG - Intergenic
1179646777 21:42781013-42781035 ATGTATTTTCACTTGTAACCAGG - Intergenic
1181526598 22:23492977-23492999 TTGTGTTTTAAACTGTGGCCAGG + Intergenic
949615016 3:5744129-5744151 ATGTATTTTCAGTTGTACACAGG + Intergenic
949750963 3:7352439-7352461 ATGTATGTGCATCTGGAGCCTGG - Intronic
953006087 3:38980600-38980622 AGGTGTTATAAACTGTAGCCTGG + Intergenic
954160197 3:48716146-48716168 CTGTATTTGCAGTTGTAGCCAGG - Intronic
956614230 3:71155183-71155205 ATGTATTTTTAAAGGTAACCAGG + Intronic
956890182 3:73605715-73605737 ATGTATTCTGCACTGTTGCCTGG - Intronic
960404399 3:117241346-117241368 CTTGATTTTCAACTGTAGCAAGG + Intergenic
960559130 3:119063078-119063100 ATGTATTATCACCAGTACCCTGG - Intronic
960888300 3:122419089-122419111 AGGTATTTTAAAAAGTAGCCGGG - Intergenic
963174777 3:142286522-142286544 TTGCATTTTTAACTGTACCCTGG + Intergenic
963608994 3:147441638-147441660 ATGAAATTTCCACTGCAGCCAGG - Intronic
964933698 3:162056087-162056109 ATGTATGTTTAAATGTAACCAGG - Intergenic
966048827 3:175588370-175588392 ATCTATTTTCAACCATATCCTGG - Intronic
967264407 3:187677561-187677583 ATGTATTTTCCACTGTTCCAGGG - Intergenic
967956096 3:194878570-194878592 CTGTATTTTCAACAGTATTCAGG + Intergenic
968009829 3:195266831-195266853 CTGTATTTTCAAGTGTCCCCAGG + Intronic
969309120 4:6342309-6342331 ATGTACTTTCAACTGCATTCAGG + Intronic
970082160 4:12299730-12299752 ATGTATTTGCAATTTTAGCAAGG - Intergenic
970139281 4:12963239-12963261 ATGTATTTTCATCTGTACACAGG - Intergenic
970898788 4:21134489-21134511 ATGAATTTTCAACTGCAAACGGG + Intronic
971468937 4:26998614-26998636 AAATATTTTCAACTTTAGGCTGG + Intronic
971581236 4:28344030-28344052 AGGTATTTCCAAATGTATCCTGG - Intergenic
972803337 4:42500790-42500812 TTGTATTTTCAACTGTAGTTTGG + Intronic
973941278 4:55913030-55913052 AAGAATATTCAACAGTAGCCTGG + Intergenic
975233397 4:71961351-71961373 ATGTGTTTTCATCTGAAGACAGG - Intergenic
976231411 4:82847154-82847176 ATAGATTTTCAACTGTACGCAGG + Intronic
976694860 4:87908544-87908566 ATGAATTTTCCACTGTTGTCAGG - Intergenic
976909161 4:90278982-90279004 ATGTATTTTCCACCATAACCTGG - Intronic
978665608 4:111177806-111177828 GTGCATTTTTAACTGTAGGCAGG + Intergenic
980039415 4:127922326-127922348 AAGTATTATCATCTGTGGCCTGG + Intronic
981705539 4:147655519-147655541 TTGTATTTTCAACTGGTTCCAGG - Intronic
982753107 4:159186224-159186246 ATCCATTTTTAAGTGTAGCCAGG + Intronic
983501282 4:168502741-168502763 ATATATTTTAAAATTTAGCCAGG + Intronic
985110668 4:186543739-186543761 ATGTATTTTCAATTTTACACGGG + Intronic
989048086 5:37292673-37292695 ATGTATGTTCAGCTGTAGAAAGG + Intronic
990299520 5:54436599-54436621 TGGTATTATCAACTGTGGCCAGG + Intergenic
991200179 5:63982811-63982833 GAGTATTTTCAACTGGAGCTGGG - Intergenic
991509238 5:67358574-67358596 ATGTCTTTGCAACTGTAGATTGG + Intergenic
993512498 5:88788745-88788767 ATGTCTTTTCATCTGAAGTCTGG + Intronic
994679456 5:102867020-102867042 ATGGAGTTTTAAATGTAGCCTGG + Intronic
995344013 5:111091016-111091038 TTGTATTTTCATTTGTACCCCGG - Intergenic
997204816 5:132041146-132041168 ATGTATTTTCTACTGTTTCGGGG + Intergenic
1000763023 5:165250350-165250372 ATTTATTTTCAACTGAATCATGG + Intergenic
1001783147 5:174387587-174387609 TTTTATTTTTTACTGTAGCCTGG - Intergenic
1004049497 6:12061823-12061845 ATTTTTTTTAAACTGTAGCTTGG - Intronic
1004116000 6:12768567-12768589 ATTTTTTTTCATCTGTAGCTGGG + Intronic
1005387817 6:25303089-25303111 ATGTACTTTCAACTTTTGGCTGG + Intronic
1008001286 6:46362795-46362817 ACATATTTTCAAATGTATCCAGG + Intronic
1008440925 6:51531098-51531120 CTGTAATTTCAACTACAGCCTGG - Intergenic
1011431034 6:87287086-87287108 ATATATTTTCAAATGTCCCCTGG + Intronic
1016655796 6:146517109-146517131 ATGTGTTGTCAACTGTTGCTGGG + Intergenic
1017332033 6:153210574-153210596 ATGTTTTTTCATCTGTAGAAAGG - Intergenic
1017700111 6:157061225-157061247 ATGTAAATTCAAATGCAGCCAGG - Intronic
1019093155 6:169556711-169556733 ATGTATTCTCAGCTCTAGACAGG - Intronic
1020625271 7:10570311-10570333 ATTTATTTCCAACTTTTGCCTGG + Intergenic
1026433562 7:70372680-70372702 AAGTATTTTAAACTGCAACCTGG + Intronic
1028509413 7:91607267-91607289 ATACATTTTCAAATGTAGACTGG + Intergenic
1028711127 7:93909718-93909740 AATTATTTTCAACTGGAGCCAGG - Intronic
1029480336 7:100808524-100808546 ATGTATCTCCACCTGTAGACGGG - Intronic
1029825990 7:103195040-103195062 AAGTATCTTCTGCTGTAGCCTGG + Intergenic
1029836131 7:103312897-103312919 TTGTATTTTAAATTGTAGCTTGG - Exonic
1030825610 7:114153840-114153862 AGGTATTTGAAACTGAAGCCAGG - Intronic
1030861739 7:114640045-114640067 CTGTATTGTCAACTCTTGCCTGG - Intronic
1031166285 7:118231461-118231483 ATTTATTTTCATCTCTAGGCTGG - Intronic
1031407020 7:121397865-121397887 ATATAATTTCTACTGTATCCAGG - Intergenic
1033295274 7:140127254-140127276 ATGTATTTTAAACTTTTGGCTGG - Intronic
1033328898 7:140401899-140401921 ATGTCTTTTTAACTGTAGGCTGG - Intronic
1035012118 7:155728421-155728443 AAGGATTTGCAAGTGTAGCCTGG - Intronic
1038777498 8:30544207-30544229 ATGTCTTTCCGACTGTAGCTGGG - Intronic
1041761314 8:61369837-61369859 ATGTATTTTGACCTCTAGACTGG - Intronic
1041864436 8:62553707-62553729 TTGTATTTTCTACTGGAGACAGG + Intronic
1044540701 8:93405770-93405792 ATATATTTTAAACTTTACCCTGG + Intergenic
1051146879 9:14036196-14036218 AAGTATTTTTCACTGTTGCCTGG + Intergenic
1053250125 9:36567291-36567313 AAATATTTTCTACTGGAGCCAGG - Intergenic
1055543388 9:77339589-77339611 AAGTAATTTTAAATGTAGCCTGG - Exonic
1059108999 9:111536715-111536737 ATGGATTTTCAACTGTACGGGGG - Intronic
1186028551 X:5341533-5341555 AAGTATTTTAAACGTTAGCCTGG + Intergenic
1186161562 X:6782260-6782282 ATGTGTTTTAAAATGTATCCAGG - Intergenic
1187523244 X:20031794-20031816 ATGTATGTGCAACTTTTGCCAGG - Intronic
1188984501 X:36757136-36757158 ATGTATTCTCAACAGCTGCCTGG + Intergenic
1191034818 X:56013436-56013458 ATGTATTTCCAACAGTATCAAGG - Intergenic
1192405487 X:70881569-70881591 ATTTATTTTTTACTGTAGCAAGG - Intronic
1194072073 X:89338308-89338330 GTGTATTTTCAATTGTATACAGG - Intergenic
1194530455 X:95042010-95042032 ATGTATTTTCATCAGTGGCTAGG - Intergenic
1194538574 X:95141357-95141379 GTGTATTTTCAACTGTACACAGG - Intergenic
1196534846 X:116831602-116831624 TTTTATTTTCCACTGGAGCCAGG - Intergenic
1197311938 X:124915958-124915980 ATGTATTCTCCATTTTAGCCTGG + Intronic
1198073638 X:133174020-133174042 ATGCATCTCCAACTCTAGCCAGG + Intergenic
1198272234 X:135065809-135065831 ATGTATTATCAACTTAGGCCAGG + Intergenic
1199532136 X:148861784-148861806 ATGTATTTTCAGATGTGGCGGGG - Intronic