ID: 922125099

View in Genome Browser
Species Human (GRCh38)
Location 1:222713458-222713480
Sequence GAGGACTCCCGCTCCTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922125099_922125103 27 Left 922125099 1:222713458-222713480 CCTTGTTAGGAGCGGGAGTCCTC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 922125103 1:222713508-222713530 CGATCCGAATGTTGTATTGGTGG 0: 1
1: 0
2: 0
3: 0
4: 13
922125099_922125102 24 Left 922125099 1:222713458-222713480 CCTTGTTAGGAGCGGGAGTCCTC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 922125102 1:222713505-222713527 CTTCGATCCGAATGTTGTATTGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922125099 Original CRISPR GAGGACTCCCGCTCCTAACA AGG (reversed) Intronic
900406174 1:2494019-2494041 GCGGAAGCCCCCTCCTAACAGGG + Intronic
904952710 1:34256962-34256984 GAGGACTGCCCCTGCTAACTGGG - Intergenic
905880582 1:41460721-41460743 AAGGAGTCCCCCTCCTAAGATGG - Intergenic
921379251 1:214506756-214506778 GAGGTCTCCCTCCCCTCACAGGG - Intronic
922125099 1:222713458-222713480 GAGGACTCCCGCTCCTAACAAGG - Intronic
923621326 1:235581860-235581882 GAAGACACCCGGTCCTCACAGGG + Intronic
1064650569 10:17505226-17505248 GAGGACTCCAGCCACTACCAGGG - Intergenic
1070148998 10:73794014-73794036 GAGGCCTCCAGCTTCTACCAAGG + Exonic
1077135001 11:994096-994118 GAGGACTCCCGCTCCGGGAATGG - Exonic
1077183765 11:1227568-1227590 GAGGACTCCCACTCCTGCCTAGG - Intronic
1077490983 11:2860872-2860894 GGGGACTCCAGCTCCTCCCAAGG - Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1083887833 11:65581408-65581430 GAGGACTGCAGCTCCTATCAGGG - Intronic
1085052195 11:73385523-73385545 GAGGCCTCCCGCTTCAGACATGG + Intronic
1090299731 11:125625397-125625419 GAAGCCTCTCGCTCCCAACACGG + Exonic
1097034426 12:56113448-56113470 GAAGGCTCCAGCTCCTAAAATGG - Exonic
1104983103 12:132582692-132582714 GAGGCCCCCCTGTCCTAACAGGG + Intronic
1106413730 13:29528695-29528717 CAGAACTCCACCTCCTAACATGG + Intronic
1109299648 13:60577715-60577737 GAGGACTCCCACTCCTACTCAGG + Intergenic
1124620601 15:31271899-31271921 GAGGCCTTCAGCTCCCAACAGGG + Intergenic
1129313645 15:74728486-74728508 CTGGTCTCCAGCTCCTAACAGGG + Intergenic
1129826957 15:78640705-78640727 ACCGACTCCCGCTCCCAACAGGG - Intronic
1136237606 16:28924588-28924610 GAGGACTCCCGGTCCCAGGAAGG - Exonic
1138146113 16:54613116-54613138 GAGGACTCCCTCCACCAACATGG + Intergenic
1142291219 16:89194420-89194442 GGGGACACACGCTCCTAACCGGG - Intronic
1143010705 17:3864866-3864888 GAGGCCTCCCTCTCATAAGAGGG - Intronic
1144221085 17:13100478-13100500 GATGTCTCCAGCTCCTATCACGG + Intergenic
1144602772 17:16633075-16633097 GAGGACACCTGCTTCAAACAGGG - Intronic
1148135605 17:45289893-45289915 GAGGACTCCCGGCCCTACCCAGG + Intronic
1149347616 17:55753933-55753955 GAGGACTCACCCTCCTAAGACGG - Intronic
1150999478 17:70358140-70358162 GAATACTCCGGCTACTAACATGG - Intergenic
1152937513 17:83148963-83148985 GCTGACTCCAGCTCCTAGCATGG + Intergenic
1165259148 19:34597929-34597951 CAGGACTCTCTATCCTAACATGG - Intronic
927818889 2:26244952-26244974 GAGGACTCCCTCTCGGAGCAAGG - Exonic
927857776 2:26538000-26538022 TAGCATTCCCGTTCCTAACATGG - Intronic
938697494 2:133848015-133848037 GAAGACACCAGCCCCTAACAGGG + Intergenic
941119516 2:161513074-161513096 GGGAACTCCCTCCCCTAACAAGG + Intronic
943228169 2:185208444-185208466 GAGGAATCCTGCTACTAACAGGG - Intergenic
948642925 2:239386742-239386764 GAGAACTTCTGCTCGTAACAAGG + Intronic
1178834424 21:36084466-36084488 GGGGACTCCCACTCATGACAAGG + Intergenic
1181983933 22:26786042-26786064 GAGAATTTCCGCTCCCAACATGG - Intergenic
960030903 3:113053847-113053869 GAGGAATCCAGCTACTAACCAGG + Intergenic
961980282 3:131070415-131070437 CAGGACTTACTCTCCTAACAAGG - Intronic
977349460 4:95862802-95862824 GAGGACTCCCTCCCATCACAAGG + Intergenic
978988385 4:115045678-115045700 AAGGACACCTGCACCTAACATGG + Intronic
984672767 4:182510817-182510839 GAAGACTGCCTCTCCTAATAAGG - Intronic
986574045 5:9194182-9194204 GAGGACTGCAGCCTCTAACAGGG + Intronic
1002003887 5:176216213-176216235 AAGGACTCTCTCTCCTTACAGGG + Intergenic
1002222484 5:177694393-177694415 AAGGACTCTCTCTCCTTACAGGG - Intergenic
1003115174 6:3278896-3278918 GAGGACTCCCCTTACTCACACGG + Intronic
1013688790 6:112616125-112616147 GAAGGCTCCAGCTCCTAAAATGG + Intergenic
1016887065 6:148968485-148968507 GAGGACTCCCACCCCCAAAAAGG - Intronic
1025003372 7:55336857-55336879 GTGGGCTCCCCCTCCTAAAAGGG - Intergenic
1026117513 7:67508482-67508504 CAGGCCTCCTGGTCCTAACATGG - Intergenic
1031553339 7:123142337-123142359 GAGGACTCCCCCTCCTTCCCAGG + Intronic
1036656555 8:10680907-10680929 GAGGACCCCCGCTCCTGCCTGGG - Intronic
1037882995 8:22581909-22581931 CAGGACTCCTGCTTCCAACAGGG + Intronic
1046820869 8:118632975-118632997 GAGGACTCGTGCTCATAAGATGG - Intergenic
1047973924 8:130111068-130111090 GAGGAATCCCGCTCATAGGAGGG - Intronic
1056767109 9:89451308-89451330 GAAGGCTCCAGCTCCTAAAATGG - Intronic
1061415232 9:130443999-130444021 GAGGACTCCCGGTCCTCAGCCGG - Intergenic
1196933303 X:120703641-120703663 CAGGACTGCCGCTGCTAAAAGGG + Intergenic