ID: 922128406

View in Genome Browser
Species Human (GRCh38)
Location 1:222752526-222752548
Sequence CTGGGTCTCCAGTTGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922128406 Original CRISPR CTGGGTCTCCAGTTGGTGAA TGG Intergenic
900437604 1:2639015-2639037 CTGGGTCTCCACATGGTGGAGGG + Intronic
900829049 1:4950939-4950961 CTGGGTCTTCAATTTGGGAAAGG + Intergenic
901529340 1:9843538-9843560 CTGAGCTTCCAGTTGGGGAAGGG - Intergenic
903374759 1:22858885-22858907 CTGGGTTTCTAGTGGGTGATGGG - Intronic
903385499 1:22923648-22923670 CTGTGTCTTCACTTGGTGGAAGG - Intergenic
903666492 1:25010872-25010894 CTGTGTCTTCACTTGGTGGAAGG - Intergenic
904324708 1:29720862-29720884 CTGTGTCTTCACTTGGTGGAAGG + Intergenic
905467801 1:38168800-38168822 CTGGGTCTCCAGTTTGCAAATGG + Intergenic
906581576 1:46939672-46939694 CTGGGTCTCCCAGTAGTGAAGGG - Intronic
907287222 1:53389677-53389699 CTGTGTCTTCATTTGGTGGAAGG + Intergenic
907338504 1:53716371-53716393 GTGGGTGACCAGTTGGGGAAAGG + Intronic
908076158 1:60521204-60521226 CTGTGTCTTCAGATGGTGAAAGG + Intergenic
909283828 1:73789886-73789908 CTGGGTCTTGACTTGTTGAATGG + Intergenic
910084245 1:83380285-83380307 CTGTGTCTTCACATGGTGAAAGG + Intergenic
910892398 1:92030984-92031006 CTGAGGCTCCAGGTGGTGAAGGG + Intronic
910933006 1:92461118-92461140 CTTTGTCTCCTGTTGGTGAGAGG + Intergenic
913510103 1:119553627-119553649 CTGGGGCTGCAGGTGGTGAGAGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915405845 1:155659158-155659180 CTGAGTCTCAAGTTGGAAAAGGG + Intergenic
917652664 1:177094490-177094512 CTGTGTCTCCACATGGTGAAAGG - Intronic
918122409 1:181551165-181551187 CTGTGTCTCCAGGTGGTGTCAGG + Intronic
918709273 1:187706620-187706642 GTGGGTGTCCAGGTGGTGCAGGG + Intergenic
920178709 1:204119407-204119429 CTGTGTCCTCAGGTGGTGAAAGG + Intronic
920543383 1:206796026-206796048 CTGGGTCTCCAGCTGCAGACAGG - Intergenic
920744350 1:208612387-208612409 CTGTGTCTTCATGTGGTGAAAGG + Intergenic
922128406 1:222752526-222752548 CTGGGTCTCCAGTTGGTGAATGG + Intergenic
922514630 1:226197870-226197892 CTGGGTCCCCAAGTGCTGAAAGG + Intergenic
922978116 1:229801909-229801931 CTGAGTCTCCACATGGTGGAAGG + Intergenic
923094580 1:230764463-230764485 CTGGTTCTCCAGTTTGCAAATGG + Intronic
923280836 1:232441617-232441639 CTGGGTCTCCAGATGCAGGAGGG - Intronic
923503058 1:234582458-234582480 CTCTGTCTGCAGTGGGTGAAAGG - Intergenic
923906828 1:238394354-238394376 CTGGGTCTCCAGTTTGCAGAAGG - Intergenic
1063079468 10:2751774-2751796 CTTGATTTCCAGATGGTGAATGG - Intergenic
1063827212 10:9911242-9911264 CAGGGTCTCCAGCTTGTGGATGG + Intergenic
1064017055 10:11780945-11780967 CTGGGTCTCTAGTTTGCGGACGG - Intergenic
1065386396 10:25137974-25137996 CTGGGTCTACAGCTTGTGGATGG - Intergenic
1068412864 10:56680002-56680024 CTAGGTGTCCACATGGTGAAGGG + Intergenic
1068419653 10:56773483-56773505 CTGTGTCTCCAGAGTGTGAAAGG - Intergenic
1068611985 10:59070252-59070274 CTGGCTCTCCAGTTTGCAAAGGG - Intergenic
1068935459 10:62631530-62631552 CTGGGTCCCTAGTTCTTGAAGGG + Intronic
1069727583 10:70591055-70591077 CTGGGTCTCCAGTGTGTGGCTGG + Intergenic
1069823523 10:71241740-71241762 CTGGGCCTCCACTTGGGCAATGG - Intronic
1071229164 10:83564924-83564946 CTGGTTTAACAGTTGGTGAACGG + Intergenic
1073299000 10:102459359-102459381 CTGGGTATCCAGTGGGGAAATGG - Intergenic
1074228228 10:111508287-111508309 CTCAGTCTCCATTTGGGGAAAGG + Intergenic
1074988105 10:118675258-118675280 CTGGGTCTCAGGACGGTGAAAGG - Intronic
1075002839 10:118810643-118810665 CTGGGTCTGCAGGTGGTCATGGG - Intergenic
1075483063 10:122798810-122798832 CTGGGACTGCGGCTGGTGAACGG + Intergenic
1076591898 10:131589140-131589162 CAGGGTCTGCAGCTCGTGAAGGG + Intergenic
1076620483 10:131784295-131784317 CTGGGTCTCCAGCTTGCAAATGG - Intergenic
1077305461 11:1866889-1866911 CTGGGGCTGCAGTTGGTGCTGGG - Exonic
1081340489 11:41921519-41921541 CTGGGTCTCCAGAAAGGGAAAGG - Intergenic
1085387039 11:76163433-76163455 CTGGGCTTCCAGTTTGTGACTGG - Intergenic
1089173549 11:116532748-116532770 CTGTGTCTTCAGATGGTGAAAGG - Intergenic
1089535430 11:119158171-119158193 CTGGGTGTTCTGTGGGTGAATGG + Intronic
1091796785 12:3301867-3301889 CTGGGTCTCAGGTTGTTGTATGG + Intergenic
1092335379 12:7628553-7628575 CTGGGTCTCCAGTCAGTGGCCGG + Intergenic
1092335403 12:7628673-7628695 CTGGGTCTCCAGTCAGTGCCGGG + Intergenic
1092749581 12:11706156-11706178 CTGGCTTCCCAGTTGGTTAAAGG + Intronic
1092769202 12:11881549-11881571 CTGTGTCTTCACTTGGTGGAAGG + Intronic
1094378948 12:29821809-29821831 CTGGTTCTTCACTTAGTGAATGG - Intergenic
1100223159 12:92528502-92528524 CTGGGTCTCCAGGTTGTAGATGG + Intergenic
1100339370 12:93663598-93663620 TCAGGTCTCCAGTTTGTGAATGG + Intergenic
1102037589 12:109781110-109781132 CTGGGTCTCAACTTCGAGAAGGG - Intergenic
1103505610 12:121440872-121440894 CTGGATGTCCAGTGGGTGGAGGG - Exonic
1104211416 12:126692218-126692240 CTGGGTCTTCAGATGGTGGGGGG - Intergenic
1105832576 13:24177433-24177455 CTGTGTCTTCATATGGTGAAGGG + Intronic
1105853139 13:24353456-24353478 CTGGGTCTCCAGCTGGCAGATGG - Intergenic
1107300799 13:38963881-38963903 CTGTGTCCTCAGTTGGTGGAAGG - Intergenic
1108564030 13:51676418-51676440 CTGTACCTCCAGCTGGTGAAGGG + Intronic
1108735660 13:53281196-53281218 ATTGGTCTGCAGTTGATGAATGG + Intergenic
1108762052 13:53579836-53579858 CTAGATTTGCAGTTGGTGAATGG + Intergenic
1109153282 13:58871637-58871659 CTGGGTCTCCAGTTTGCAGATGG + Intergenic
1110008057 13:70297150-70297172 CTGGGTCTACAGCTGCTGAGTGG - Intergenic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1110397006 13:75041982-75042004 CTGGGTCTCCAGCTTGCAAATGG + Intergenic
1110473990 13:75891842-75891864 CTGGGTCTCCAGGTTGTGCCAGG + Intergenic
1113124812 13:106965667-106965689 CCTGGTCTCCAGCTGGTGAATGG - Intergenic
1113364730 13:109665534-109665556 CTTGGTCTCCAGGAGGTGAGAGG - Intergenic
1114888757 14:26889023-26889045 CTGGGTCCTCATATGGTGAAAGG + Intergenic
1116861292 14:49997669-49997691 CTGGGTCTCCAGCTTGTAGATGG + Intronic
1120739912 14:88096743-88096765 CTGGGTTTCCTACTGGTGAAGGG - Intergenic
1122694385 14:103545678-103545700 ATGGGCCTCCTGTTGGTAAAGGG - Intergenic
1123075115 14:105664228-105664250 CGTGGTTTCCAGTTGGTGAGTGG - Intergenic
1127296007 15:57608998-57609020 CTGGGTGTCCTGTAGGTTAAGGG - Intronic
1128741451 15:70086575-70086597 TTGGGTCTCCACTTGAGGAAAGG + Intronic
1129786660 15:78314347-78314369 CGGGGTCTCTAGATGCTGAAGGG + Intergenic
1129926296 15:79367348-79367370 CTGGGTTTGCAGTGGGAGAAAGG + Intronic
1130579033 15:85118283-85118305 CTGGGTATCCGGTTGGATAATGG - Intronic
1131115377 15:89792104-89792126 CTGGTTCTCCAGGTGGGGAGAGG + Intronic
1131240166 15:90733567-90733589 GTCTGTCTCCAGTTGTTGAAGGG + Intronic
1137394513 16:48107329-48107351 CTGGGTCTCTGGTTGGACAAGGG - Exonic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1137932771 16:52604346-52604368 CTTGGTCTCCATTTGGGGAGGGG - Intergenic
1138973509 16:62174580-62174602 CTCGGTCTCCAGTTTGTAGATGG + Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141930592 16:87199939-87199961 CTGGGTCTCCATTCGCTGACGGG - Intronic
1142115672 16:88354918-88354940 CAGGGTCTCCAGTGGGGGCAGGG + Intergenic
1143165658 17:4896122-4896144 CTGGGACTCCAGATGGTGTTAGG - Intronic
1144184993 17:12788890-12788912 CTTGGTCTCCTGGTGGTGGAAGG + Intergenic
1144411998 17:15010569-15010591 CTGGGACTCCAGGTGGCGGAGGG + Intergenic
1145279065 17:21455316-21455338 CTGGGTCACCATCTGGGGAATGG - Intergenic
1146839992 17:36144874-36144896 CTGTGTCTTCATGTGGTGAAAGG + Intergenic
1148745402 17:49915284-49915306 CTGGAACCCCAGTTGGTGACAGG - Intergenic
1149852063 17:60043661-60043683 CTGTGTCTCCAGTTGGTGCCTGG + Exonic
1150266111 17:63833379-63833401 CTGGGTCTTCAGCTGGTTGATGG + Exonic
1151166322 17:72206645-72206667 TTGTGATTCCAGTTGGTGAAAGG - Intergenic
1152688313 17:81705776-81705798 CTGGTTCCCCAGTGGGGGAAAGG - Intronic
1154335119 18:13458836-13458858 CTGGCTTTCCAGATGATGAAGGG + Intronic
1155802306 18:30123125-30123147 CTGGGTCTCCAGCCATTGAATGG - Intergenic
1156352135 18:36310783-36310805 GTGGGGTTTCAGTTGGTGAAAGG + Intronic
1156842686 18:41628058-41628080 CTGAGTATCCAGTTGAAGAAGGG - Intergenic
1157574209 18:48732816-48732838 CAGGGTCTCCAATTTGTGCAAGG + Intronic
1160868795 19:1267751-1267773 CTGGGGCTCCAGTGGGTGGGTGG + Intronic
1161105771 19:2443274-2443296 GAGGGTCTCCTGTTGGGGAAGGG + Intronic
1162738438 19:12759749-12759771 CTGGGTCTACAGTTAGAGAAGGG - Intergenic
1163707166 19:18821283-18821305 CTGGGTCTCCAGCTTGCAAATGG + Intergenic
1164707337 19:30329823-30329845 CTGGGTCTACACTTGGTGGGGGG + Intronic
1164735506 19:30538111-30538133 GTGGGACTCAAGTTGGTGAGAGG + Intronic
1165342413 19:35222546-35222568 CTGGGTGTCTACTTGGTGGACGG - Intergenic
1165859198 19:38898403-38898425 CTGGGTCTCCAGAGGGTGAGAGG + Exonic
1166315173 19:41985536-41985558 CTGGGTGCCCAGTGGGTGAGTGG + Intronic
1167317037 19:48770275-48770297 CTGTGTTTCCACTTGGTGAAAGG - Intergenic
1167735075 19:51289408-51289430 CTGTGTCCCCACTTGGTGGAAGG + Intergenic
1167735286 19:51290792-51290814 CTGGGTCCTCATGTGGTGAAAGG - Intergenic
1168287171 19:55340654-55340676 CTGGGTGTCCAGTGAGTGAAGGG - Intronic
925119048 2:1403323-1403345 CTGGGCCTCCAGTGGGACAAGGG - Intronic
925894589 2:8461519-8461541 CTGGATCTCCAGTGGGTGGGAGG + Intergenic
926415298 2:12643719-12643741 AGGGGTCTCCAGTTGTTGAGTGG - Intergenic
926795330 2:16614531-16614553 CAGGCTCTCCAGAGGGTGAAAGG - Intronic
926842120 2:17092505-17092527 CTGGGTCTCCAGCTGGCAAAGGG + Intergenic
927592467 2:24368114-24368136 CTGTGTCTTCACTTGGTGGAAGG - Intergenic
928599845 2:32893694-32893716 CTGGTTCTCCAGTTTGCAAATGG - Intergenic
929608724 2:43253961-43253983 CTGGGTCTCCAGAGGGAGACTGG - Intronic
929941796 2:46339827-46339849 CTGTGTCTCCACATGGTGGAAGG + Intronic
932894649 2:75627143-75627165 CTAGGTCCCCAGTTGGTGTAGGG - Intergenic
933872164 2:86577211-86577233 CTGGGTTTCCAGTTTGCAAATGG + Intronic
934919608 2:98332216-98332238 GAGGGCCTCCACTTGGTGAAGGG - Intronic
934946416 2:98545733-98545755 CTGGGTGCTCAGGTGGTGAATGG - Intronic
935190232 2:100771694-100771716 CTGGGTCTCCAGCTGGCAGACGG + Intergenic
935581809 2:104762245-104762267 GTGGGTTGCCAGTTGGTGACAGG + Intergenic
936344985 2:111668739-111668761 CTGGGTCTCCAGCTTGTTGATGG - Intergenic
937007368 2:118529470-118529492 TTGGGGCTCCAGTAGGTGTAAGG + Intergenic
937554302 2:123134157-123134179 CTGTGTCTTCACATGGTGAAAGG + Intergenic
939834027 2:147106277-147106299 CTGGGCCTCCAGCTTGTGTAAGG - Intergenic
943385164 2:187194620-187194642 CTGGGTCACCAGTTGGCTACTGG + Intergenic
944364811 2:198905687-198905709 ATGGGTCTCAAATTGGTGGAGGG - Intergenic
945145463 2:206733470-206733492 CTGTGTCTCCACATGGTGGAAGG - Intergenic
946397509 2:219450577-219450599 CAGGGTCACTATTTGGTGAACGG + Intronic
947218961 2:227774492-227774514 CTGGCTCAACAGTTGGTTAACGG + Intergenic
947867141 2:233406517-233406539 CTGTGTCTCCTGTTGTTGGACGG + Intronic
948141834 2:235678937-235678959 CTGGGCATCCAGATGGTGAGTGG + Intronic
1169676596 20:8161441-8161463 CTGGTTGTACAGTTGGTTAATGG + Intronic
1170291249 20:14771244-14771266 CTGGGTCTCTAGTTTGTAAATGG + Intronic
1171205676 20:23278932-23278954 CATGGTCTCCAGCTGGCGAATGG - Intergenic
1171933096 20:31246333-31246355 CTGGGTCTCAACTTGGGGAAGGG - Intergenic
1172390156 20:34560271-34560293 CTCGGTCTCCACGTGGTGTATGG + Exonic
1172998517 20:39089097-39089119 CTGGGACTGCAGTAGGTGATGGG - Intergenic
1173100708 20:40085453-40085475 CTAAGTCACCAGTTGGAGAAAGG + Intergenic
1173324665 20:42021656-42021678 CTGGGTCTCCAGTTTGTAAATGG + Intergenic
1173435818 20:43031355-43031377 CTGTGTCTTCACTTGGTGGAAGG - Intronic
1173942789 20:46926331-46926353 CTGGGTCTCCAGGTTGCAAATGG - Intronic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175207604 20:57323308-57323330 CTGGGTCTGTAGTCTGTGAAGGG + Intergenic
1175522619 20:59611759-59611781 CTGGCTCCCCAGCTTGTGAATGG + Intronic
1175585298 20:60134319-60134341 CTGGGTCTCCAGCTTGCTAATGG + Intergenic
1177224183 21:18232453-18232475 CTGTGTCTCCACATGGTGGAAGG + Intronic
1177462329 21:21429286-21429308 CAGGGTGCACAGTTGGTGAATGG + Intronic
1177796807 21:25787778-25787800 CTGGGTCTTCATATGGTTAAAGG + Intergenic
1178134313 21:29609774-29609796 CTGGGTCTCCAGTTTGCAAATGG + Intronic
1179457713 21:41510531-41510553 CTGGGTCTCCAGTCTGTAGATGG - Intronic
1182520882 22:30883953-30883975 GTAGGACTCCAGGTGGTGAAAGG + Intronic
1183109011 22:35634986-35635008 CTGGGTCTCCAGCTTGCAAATGG - Intronic
1184112967 22:42405930-42405952 CTGGGGCTCCCGGGGGTGAAAGG + Intronic
1184249409 22:43251593-43251615 CTGGCTCTGCAGGTGGAGAAGGG + Intronic
949134994 3:553944-553966 CTGGGTATCCTGTTGGTCCAAGG - Intergenic
953297869 3:41738936-41738958 CTGGGGCTCCATTTGCTGTAGGG - Intronic
955483987 3:59417508-59417530 CTGGGGTTCCAGTAAGTGAAGGG - Intergenic
958949225 3:100399455-100399477 CTGGGTCTGGAGTTGTTCAATGG - Intronic
961988913 3:131166787-131166809 CTGGATCCCTAGTTGGAGAAAGG + Intronic
963507613 3:146206720-146206742 CTGGGTAGCCAGTAGGTGGAGGG + Exonic
965117452 3:164510361-164510383 CTGGTGTGCCAGTTGGTGAATGG + Intergenic
965421578 3:168465852-168465874 CTGGGTCTTGAGTTAGTGCAAGG + Intergenic
965850834 3:173020729-173020751 CTGGGTCCCCATTTGGTGATAGG - Intronic
967091936 3:186142028-186142050 TTGGGTTTCCAGTTTGAGAAGGG + Intronic
967544177 3:190703923-190703945 CTGGGTCTCTAGAAGGTTAAGGG + Intergenic
969234222 4:5853938-5853960 CTGGGTCACCAGCAGGCGAATGG - Intronic
970207312 4:13667952-13667974 CTGTGTCTCCACATGGTGGAAGG + Intergenic
970249579 4:14100076-14100098 CTGGGTCTCCAGCTTGTAGAAGG + Intergenic
975684642 4:76907533-76907555 ATGAGTCTTCAGTTGGTGGAAGG + Intergenic
978579003 4:110213994-110214016 CTGGGTCTCCAGCTTGTAGATGG - Intergenic
979862850 4:125715912-125715934 CTGTGTCTTCACATGGTGAAGGG - Intergenic
982463652 4:155703459-155703481 CTGGGTGTGGAGTTTGTGAAAGG + Intronic
984289728 4:177780663-177780685 CTGTGTCTTCACATGGTGAAGGG + Intronic
985198993 4:187464547-187464569 CTGAGTCAAAAGTTGGTGAAGGG - Intergenic
985491773 5:184104-184126 TTGGGTCTCCAGCTTGTGGATGG - Exonic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
987150075 5:15029579-15029601 CAAGCTCTCCAGTTGGTGATGGG - Intergenic
988789782 5:34596938-34596960 CTGGGTCTCCAGTTCATCATTGG + Intergenic
989002519 5:36775849-36775871 CTTGGTCTTCAGTTGGTGCTGGG - Intergenic
989178418 5:38553095-38553117 CTGTGGCTGGAGTTGGTGAAAGG - Intronic
991403538 5:66278792-66278814 CTGGGTCTTCACCTGGTGGAAGG + Intergenic
991445136 5:66691656-66691678 CTGTGTCTTCACTTGGTGGAAGG + Intronic
994036086 5:95202396-95202418 CTGGTTCTCCAGTTTGCAAATGG + Intronic
999122212 5:149218279-149218301 CTGTGTCTCCACATGGTGGAAGG + Intronic
999256054 5:150210575-150210597 CTTGGGGTCCAGTGGGTGAAGGG - Exonic
999816141 5:155178250-155178272 CTGTGTCTTCACATGGTGAAAGG - Intergenic
1000633521 5:163617528-163617550 CTGGTTCTCCACTAGGTAAAGGG + Intergenic
1001417235 5:171554696-171554718 ATGGCTCCCCAGTTGGAGAAAGG - Intergenic
1001511431 5:172325583-172325605 CTGGGTCCTCACGTGGTGAAAGG + Intronic
1001543408 5:172554858-172554880 CAGGGGCTCCAGTGTGTGAAAGG + Intergenic
1001871185 5:175157303-175157325 TTGGGTCTCCACTTAGTGGAAGG - Intergenic
1003980910 6:11388935-11388957 CTGGGTCTGCATGTGGTGAGAGG - Intergenic
1006349932 6:33513515-33513537 CTGGGTCTCTAGGTGCTTAAAGG - Intergenic
1010662955 6:78592630-78592652 CTGGGTCTCCAGTTTGAAGATGG - Intergenic
1012094403 6:94940420-94940442 CTGAGTCACCAGTGGGTCAAAGG + Intergenic
1012729106 6:102857903-102857925 CTGGTTCTTCAGCTGGTAAATGG - Intergenic
1012954327 6:105552745-105552767 GTGGGTCTCCTGTTGCAGAACGG - Intergenic
1013377008 6:109527082-109527104 CTGGGTCTCCATTAGGTGTTGGG - Intronic
1015275397 6:131378626-131378648 CTGGGTCTCCAGCTTGCGGATGG + Intergenic
1018334791 6:162775135-162775157 CTGGGTCCCCACATGGTGGAAGG - Intronic
1020240877 7:6393991-6394013 CTGGGTCTCTTGTTGATAAAGGG + Intronic
1021518727 7:21517018-21517040 CTGTGTCTTCACATGGTGAAAGG + Intergenic
1022260850 7:28703537-28703559 CTGGGTCTCCAGCTGGCAGATGG - Intronic
1023047414 7:36222740-36222762 CGGGGTCCCCACTTGGTGGAAGG + Intronic
1023163853 7:37323983-37324005 CTGGGTCTCCAGTGCCTTAAAGG - Intronic
1023343119 7:39243428-39243450 CTGGGTCTTCCATTGGTGAGTGG - Intronic
1023683423 7:42712083-42712105 CAGGGTCTCCAGCTTGTGAGTGG - Intergenic
1025227476 7:57177878-57177900 CTTTGTCTGCAGTGGGTGAATGG - Intergenic
1025230594 7:57201327-57201349 CTGTGTCTGCAGTGGGTGAATGG - Intergenic
1025730399 7:64102429-64102451 CTGTGTCTGCAGTGGGTGAATGG + Intronic
1025928901 7:65979901-65979923 CTGTGTCTGCAGTGGGTGAATGG - Exonic
1026869045 7:73839863-73839885 CTGGGTCTGCTGTTGGTGGCTGG + Intronic
1027301070 7:76836413-76836435 CTGTGTCTTCACATGGTGAAAGG + Intergenic
1028603349 7:92627467-92627489 CTGTGTCTTCATATGGTGAAAGG - Intronic
1029476145 7:100786008-100786030 CTGGGTCTCCAGCGGTTGCACGG + Exonic
1029538987 7:101172116-101172138 CTGGGACTGGAGCTGGTGAAGGG - Exonic
1029596280 7:101539036-101539058 CTGGCTCTCAAGTTGTTTAAAGG + Intronic
1032357636 7:131225277-131225299 CTGTGTCTCCACATGGTGGAAGG + Intronic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034276725 7:149827093-149827115 CTGGGTCTCCAGTTAGAGAGAGG - Intergenic
1034715628 7:153238780-153238802 CTGTGTCTTCATTTGGTGTAAGG + Intergenic
1035642810 8:1196943-1196965 CTGGGTCTCCAGCTTGTGGATGG - Intergenic
1036170987 8:6484622-6484644 CTGTCCCTCCAGTGGGTGAATGG + Intronic
1038165613 8:25082584-25082606 CTGTGTCTTCACATGGTGAAAGG - Intergenic
1039608210 8:38900291-38900313 CTGGGTACCCAGTTAGTAAACGG - Intergenic
1039826279 8:41176567-41176589 CAGGGTCTCCAGCTTGTGGATGG - Intergenic
1040891409 8:52320812-52320834 CTGCGTCTCCTGTGGGTGAATGG - Intronic
1042958398 8:74276643-74276665 TTGGGCCACCAGTTGGTGAGTGG + Intronic
1043530382 8:81143454-81143476 CTGGATCTTCACATGGTGAAAGG - Intergenic
1044888213 8:96803057-96803079 CTGGGTCTCCATCTGGTAGATGG - Intronic
1045573175 8:103391154-103391176 CTGGTTCTCCAGTTTGCAAATGG - Intergenic
1049101595 8:140583275-140583297 CAGGGTCTCCAGCTTGTAAATGG + Intronic
1051781736 9:20696222-20696244 TTAGGTCTCCATTTGGTCAAAGG - Intronic
1055223095 9:73962735-73962757 CTGGGTCTCCAGATGGCAGATGG - Intergenic
1055360342 9:75483092-75483114 CTGGGCCTCCAGCTTGTCAAGGG - Intergenic
1057036127 9:91812807-91812829 CTGGGTCTCTCTTTGGTGAAGGG - Intronic
1057452148 9:95174245-95174267 CTGTGTCTTCACATGGTGAAAGG + Intronic
1057752962 9:97807104-97807126 CTGGGTCTTAAGATAGTGAATGG + Intergenic
1058271827 9:102982018-102982040 CTGGGTCCTCACTTGGTGGAAGG - Intergenic
1059299305 9:113299286-113299308 CAGGGACTCCAGGTGTTGAAGGG - Exonic
1060947561 9:127579144-127579166 CTGAGTCACCAGCTGGTGAGGGG - Intergenic
1061027026 9:128056390-128056412 CTGGGTCTGCAGTATGTGCAAGG - Intergenic
1188511582 X:30941988-30942010 CTGGGCCTCCAAGTGGTGACTGG - Intronic
1191674926 X:63784335-63784357 CAAGGTCTCCAGGTGGAGAAGGG + Intronic
1194177625 X:90670641-90670663 CTGGGCCTCCAGCTTGTAAATGG - Intergenic
1199572316 X:149279275-149279297 CTGGGTCTCCAGCTTGTAGATGG + Intergenic
1200182462 X:154159093-154159115 CTGGGTCTCGAGAGGGTGCAAGG + Intergenic
1200188116 X:154196207-154196229 CTGGGTCTCGAGAGGGTGCAAGG + Intergenic
1200193766 X:154233347-154233369 CTGGGTCTCGAGAGGGTGCAAGG + Intergenic
1200199521 X:154271151-154271173 CTGGGTCTCGAGAGGGTGCAAGG + Exonic
1200524295 Y:4252790-4252812 CTGGGCCTCCAGCTTGTAAATGG - Intergenic
1201245035 Y:11995127-11995149 CTGGTTCTTCAGATGGTGCAGGG + Intergenic
1201493563 Y:14568978-14569000 GTGAGCCTCCAGTGGGTGAAAGG - Intronic