ID: 922135733

View in Genome Browser
Species Human (GRCh38)
Location 1:222824421-222824443
Sequence GTGTATAAGCAAAAGCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922135733_922135735 17 Left 922135733 1:222824421-222824443 CCCTTCTGCTTTTGCTTATACAC No data
Right 922135735 1:222824461-222824483 CAAAAGCACCTTAAATGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922135733 Original CRISPR GTGTATAAGCAAAAGCAGAA GGG (reversed) Intergenic
No off target data available for this crispr