ID: 922137041

View in Genome Browser
Species Human (GRCh38)
Location 1:222839348-222839370
Sequence TTCCACAGACAACGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922137041_922137045 -1 Left 922137041 1:222839348-222839370 CCCTGCCCACGTTGTCTGTGGAA No data
Right 922137045 1:222839370-222839392 AAAATTGTTTTCCATGAAATTGG 0: 2
1: 42
2: 477
3: 825
4: 1495
922137041_922137046 6 Left 922137041 1:222839348-222839370 CCCTGCCCACGTTGTCTGTGGAA No data
Right 922137046 1:222839377-222839399 TTTTCCATGAAATTGGTTCCTGG No data
922137041_922137048 22 Left 922137041 1:222839348-222839370 CCCTGCCCACGTTGTCTGTGGAA No data
Right 922137048 1:222839393-222839415 TTCCTGGTGCCAAAAAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922137041 Original CRISPR TTCCACAGACAACGTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr