ID: 922138356

View in Genome Browser
Species Human (GRCh38)
Location 1:222854988-222855010
Sequence CAGTACTACTAGTGGGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922138349_922138356 9 Left 922138349 1:222854956-222854978 CCAGAGAGCTCTGGGGCTCCTCA No data
Right 922138356 1:222854988-222855010 CAGTACTACTAGTGGGAATAGGG No data
922138351_922138356 -9 Left 922138351 1:222854974-222854996 CCTCAGAGGAACCTCAGTACTAC No data
Right 922138356 1:222854988-222855010 CAGTACTACTAGTGGGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922138356 Original CRISPR CAGTACTACTAGTGGGAATA GGG Intergenic
No off target data available for this crispr