ID: 922140492

View in Genome Browser
Species Human (GRCh38)
Location 1:222880716-222880738
Sequence GTAGTCTTCTCTCGCCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922140492_922140495 18 Left 922140492 1:222880716-222880738 CCTGTGTGGCGAGAGAAGACTAC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 922140495 1:222880757-222880779 TCATCTTAAAATAAAATGTCTGG 0: 1
1: 1
2: 4
3: 59
4: 573
922140492_922140496 19 Left 922140492 1:222880716-222880738 CCTGTGTGGCGAGAGAAGACTAC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 922140496 1:222880758-222880780 CATCTTAAAATAAAATGTCTGGG 0: 1
1: 1
2: 4
3: 56
4: 644
922140492_922140494 -9 Left 922140492 1:222880716-222880738 CCTGTGTGGCGAGAGAAGACTAC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 922140494 1:222880730-222880752 GAAGACTACACGTAACTTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 42
922140492_922140497 29 Left 922140492 1:222880716-222880738 CCTGTGTGGCGAGAGAAGACTAC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 922140497 1:222880768-222880790 TAAAATGTCTGGGCCAGACATGG 0: 1
1: 1
2: 7
3: 105
4: 694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922140492 Original CRISPR GTAGTCTTCTCTCGCCACAC AGG (reversed) Intronic
905922168 1:41727064-41727086 GCAGTCTTCTCCCCCAACACTGG - Intronic
906608453 1:47186789-47186811 GAAGCCTTCTCTGGCCACCCCGG + Intronic
909186503 1:72493231-72493253 TTATTCTGCTCTAGCCACACTGG - Intergenic
920311570 1:205051904-205051926 GCAGCCTTCTTTCTCCACACGGG + Intronic
920877558 1:209850740-209850762 TTAGTCTTTTCTTGCCACTCTGG - Intronic
922140492 1:222880716-222880738 GTAGTCTTCTCTCGCCACACAGG - Intronic
1067092359 10:43274463-43274485 TTACTCTTCTCCAGCCACACAGG - Intergenic
1067156217 10:43783197-43783219 GTGGTCATCTCTCCCCTCACAGG + Intergenic
1075519111 10:123133522-123133544 GGACTCTTCTCCCGCCACACTGG + Intergenic
1076134066 10:128032623-128032645 GAAGCCTCCTCCCGCCACACTGG - Intronic
1077084790 11:744021-744043 TTTGTCTTCCCTTGCCACACTGG - Intergenic
1077269691 11:1669884-1669906 TTAGTCTCCTCTCACCTCACAGG - Intergenic
1081552797 11:44129770-44129792 CTAGTGTGCTCTAGCCACACTGG - Intronic
1084557607 11:69884172-69884194 GTAGGCTGCACACGCCACACGGG + Intergenic
1091031460 11:132192117-132192139 GTTGACCTCTCTAGCCACACTGG - Intronic
1096592393 12:52669602-52669624 GTAGTCTTCACTGGCCTCAGGGG - Intergenic
1103716299 12:122947348-122947370 ACAGTCTTCTCCAGCCACACAGG - Intronic
1111893627 13:94114241-94114263 GTAGTCTTCTCTCTCAAAAATGG + Intronic
1118000876 14:61522443-61522465 GCTCTCTTCTCTCGCCACCCAGG + Intronic
1118908266 14:70039234-70039256 TTTGGCTTCTCTGGCCACACTGG - Intergenic
1126860724 15:52880146-52880168 GCAGGCCTCTCTCTCCACACTGG - Intergenic
1127977146 15:64006172-64006194 GTGGTCTCCGCTCACCACACTGG + Intronic
1129274104 15:74434043-74434065 GCAGCCTTTTCTCGCCTCACTGG + Exonic
1134143713 16:11743143-11743165 GTAGTCTGCTCTCGCCGCGCTGG + Intergenic
1138624320 16:58237060-58237082 TTAGTCCTTTCTAGCCACACTGG - Intronic
1143770544 17:9165747-9165769 GTAGTCTTCTGTCACCAATCAGG - Intronic
1163737622 19:18991091-18991113 GAAGTGCTCTCTCGCCACTCTGG - Intronic
1166937442 19:46343008-46343030 GAAGACTTCTCCAGCCACACAGG + Exonic
925938247 2:8788665-8788687 GTAGTCTGCTCTGGCAACTCAGG + Exonic
933771601 2:85748141-85748163 ATACTCTGCTCTCACCACACAGG - Intergenic
940899674 2:159115070-159115092 GTTGTCATCTCTTGCCAAACTGG - Intronic
941980199 2:171447388-171447410 GGAGTCTTCTGTCGCCAGGCTGG + Intronic
945319159 2:208401756-208401778 GAAATCCTCTCTCACCACACAGG + Intronic
1174337082 20:49870402-49870424 GCTGGCTCCTCTCGCCACACAGG - Intronic
1174367933 20:50067638-50067660 GTACTCTGCTCCAGCCACACTGG + Intergenic
1174831487 20:53816973-53816995 GTCGTCTTCTCTGACCACAATGG - Intergenic
1175630881 20:60535292-60535314 TTATTCTCCTCTCTCCACACTGG - Intergenic
1183305629 22:37081620-37081642 TCAGTCCTCCCTCGCCACACGGG - Intronic
949262960 3:2123639-2123661 GTAGTTTTCTAGCGCTACACTGG + Intronic
953720048 3:45347325-45347347 GTAGTCTGGCCTCACCACACTGG - Intergenic
956594373 3:70949736-70949758 CTCTTCTTCTCTGGCCACACTGG - Intergenic
960509573 3:118532140-118532162 GCAATCTTCTCTGGCCAAACAGG + Intergenic
962384560 3:134922388-134922410 GTGGTCTTCTGTCTCCACAATGG + Intronic
962935478 3:140076682-140076704 GAAGTCTTCCCTGGCCACCCTGG + Intronic
964415886 3:156446983-156447005 CTTCTCTTCTCTGGCCACACTGG + Intronic
966352623 3:179046902-179046924 ATGGTCTTCTCTACCCACACTGG + Intronic
974166852 4:58214959-58214981 GGACTCTTCTCTGACCACACCGG + Intergenic
974565548 4:63575394-63575416 TAGGTCTTCTCTGGCCACACTGG + Intergenic
977154076 4:93551498-93551520 TTATTCTTCTCTAGCCACACTGG - Intronic
984788462 4:183591807-183591829 CCACTCTTCTCTCTCCACACAGG - Intergenic
987017169 5:13832448-13832470 GTAGAATTCTCTAGACACACAGG - Intronic
989625113 5:43421979-43422001 GTAGACTTCTGTGACCACACTGG - Intergenic
990511562 5:56493714-56493736 GGATTCTTTTCTCTCCACACTGG + Intergenic
993040008 5:82803753-82803775 GTTGTTTTCCCTCGCCACATTGG + Intergenic
996571429 5:124936134-124936156 GTAGACCTCTCTGACCACACTGG - Intergenic
1011572067 6:88748326-88748348 TTAGTCATCTCTTGCCACACAGG + Intronic
1013178781 6:107700537-107700559 GTGGTCCTCTCTTGCCACAGGGG + Intergenic
1014276652 6:119396728-119396750 GAGGTCTTCTCTGGCCACATAGG + Intergenic
1031922978 7:127614853-127614875 GTACCCTTCCCTCCCCACACTGG - Intronic
1032002025 7:128271753-128271775 GGAGTCCTCTCTCCCCACGCAGG + Intergenic
1039484297 8:37899230-37899252 GTGGCCTCCTCGCGCCACACGGG + Exonic
1048595271 8:135859852-135859874 GTCTTGTTCTGTCGCCACACTGG + Intergenic
1052364972 9:27602200-27602222 GTAGTAAGCTCTAGCCACACTGG - Intergenic
1060072588 9:120563276-120563298 GTACACTGCTCTAGCCACACAGG - Intronic
1187644035 X:21327480-21327502 GTTATCTTCTCTTACCACACTGG + Intergenic
1188484514 X:30668583-30668605 TTAGTCTTCTTTTGACACACTGG - Intronic
1197024735 X:121735437-121735459 GGAGGCTTCTATGGCCACACAGG - Intergenic