ID: 922142399

View in Genome Browser
Species Human (GRCh38)
Location 1:222901870-222901892
Sequence AAAAGGAAATTGAACCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 810
Summary {0: 1, 1: 1, 2: 17, 3: 115, 4: 676}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922142397_922142399 28 Left 922142397 1:222901819-222901841 CCAATACTTATAGATTTTTGTCA 0: 1
1: 0
2: 2
3: 27
4: 330
Right 922142399 1:222901870-222901892 AAAAGGAAATTGAACCCAGATGG 0: 1
1: 1
2: 17
3: 115
4: 676

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922142399 Original CRISPR AAAAGGAAATTGAACCCAGA TGG Intronic
900921476 1:5674095-5674117 AGAAGGAAAGTGAAACCAGATGG - Intergenic
901179092 1:7327772-7327794 AGAAGAAAAATGATCCCAGAAGG - Intronic
901766840 1:11505881-11505903 ACAAGGAAAATGATCCCAGAGGG - Intronic
901899049 1:12342313-12342335 AAAACGCACTTCAACCCAGATGG + Intronic
901950063 1:12737532-12737554 AAAAGGGAAATGATCACAGATGG + Intergenic
903253746 1:22076828-22076850 AAAAGGAAGTTGAATAAAGAAGG + Intronic
903416225 1:23185071-23185093 ATGAGGAAACTGATCCCAGAAGG - Intergenic
903511504 1:23878990-23879012 AGAAGGAAATTCAACCCAAAGGG + Intronic
903564455 1:24254226-24254248 AAGAGGAATTTGAAACCAGTGGG + Intergenic
903847380 1:26286449-26286471 AACTGGGATTTGAACCCAGAAGG - Intronic
904342053 1:29842534-29842556 AGAAGGACATTGAACCTAAAAGG + Intergenic
904669171 1:32149688-32149710 AGAAGGAAAATGATACCAGATGG - Intronic
904754755 1:32762046-32762068 ATGAGGAAATGGAAACCAGAGGG - Intronic
904834589 1:33327047-33327069 AAAAGGAAGGAGAACTCAGAGGG + Intronic
905168300 1:36096418-36096440 AACAGGAAATTGGAACCAGAGGG + Exonic
905229243 1:36503542-36503564 AAAAGGGAAATTACCCCAGAAGG - Intergenic
905968191 1:42116941-42116963 AGTAGGAAGTTGAACCCATAAGG + Intergenic
906006456 1:42476819-42476841 AAAAGGAAAATGATCCCGAATGG - Intronic
906090473 1:43174952-43174974 AGAAGGAAAATGATCCCAGCTGG - Intronic
906384046 1:45352094-45352116 AAAAGGGCAATGAACACAGACGG + Intronic
906942747 1:50270502-50270524 AGAAGGAAAATGAAACCAAATGG + Intergenic
907218003 1:52882815-52882837 AAAATGAAAATAAACCCACAGGG - Intronic
907328518 1:53656468-53656490 AAAATTCAATTGAACACAGATGG + Intronic
907416832 1:54320241-54320263 AAAAAGAAATGGACCACAGAGGG + Intronic
907557859 1:55360358-55360380 AAAAATCACTTGAACCCAGAAGG - Intergenic
908642102 1:66236468-66236490 AGAAGGAAAATGATACCAGATGG - Intronic
908718721 1:67099475-67099497 AAAATGTAATAGAACACAGATGG + Intronic
909044578 1:70693472-70693494 AACAGCAAATTCAAGCCAGAAGG + Intergenic
909110767 1:71474172-71474194 GAAAGAAAAGTGAACCCAGAGGG + Intronic
909218516 1:72923837-72923859 CAAAGGAAATCTAATCCAGAAGG - Intergenic
909349306 1:74630902-74630924 AAAAGGAAATTCAAGCAAGCAGG + Intronic
909726039 1:78836892-78836914 AAAATGAAAGTGAAAGCAGATGG + Intergenic
910647614 1:89530594-89530616 AAATGGAATTTGAAACCATATGG + Intronic
911108660 1:94160331-94160353 AGAAGGAAAGTAATCCCAGATGG - Intronic
911468640 1:98287075-98287097 AGAAAGAAGTTGAACCAAGAAGG + Intergenic
912879053 1:113390748-113390770 AAAAGGGAATTGTCCCCAGGAGG - Intronic
913114439 1:115683692-115683714 AAATGGAAAAAGAACTCAGAAGG - Intronic
913404827 1:118478048-118478070 AAAACAAAATTGAACACAGTTGG - Intergenic
913646309 1:120858628-120858650 AAAAGTAAATTTAAACCACAAGG - Intergenic
914529968 1:148514259-148514281 AAAAGTAAATTTAAACCACAAGG + Intergenic
914721889 1:150296039-150296061 AAGAGTCAATTGAACCCAGGAGG - Intronic
914735007 1:150407845-150407867 CATAGGATATTGAAGCCAGAGGG + Intronic
914978340 1:152388249-152388271 AAAAGGACATTGAAGGCAGATGG - Intergenic
914978469 1:152389879-152389901 AAAAGGACATTGAAGGCAGATGG - Intergenic
914993905 1:152523033-152523055 AGAAGAAAATTGAATCCATAAGG - Intronic
915579116 1:156802887-156802909 AAAAGAAAGCTGAACCTAGAGGG - Intergenic
915602295 1:156929848-156929870 AGAAGGAAATCAAGCCCAGAGGG - Intronic
915713770 1:157925388-157925410 AGAAGGAAACTGACCCCAGCAGG - Intergenic
916311313 1:163401808-163401830 AAAAATAACTTGAACCCAGGAGG - Intergenic
916700442 1:167288118-167288140 AGAAGGAAATTGAACTCAGAAGG + Intronic
916768281 1:167883023-167883045 AAAAAGAAATTTAACCTAGAAGG - Intronic
917137671 1:171803231-171803253 TATAGGAAATGGACCCCAGATGG - Intronic
917365172 1:174223351-174223373 AAAAGTCACTTGAACCCAGGAGG + Intronic
917579638 1:176362515-176362537 AAAAGAAAATTGAACTAACAAGG + Intergenic
918415560 1:184303030-184303052 AAAGAGAAATAGAAGCCAGAAGG - Intergenic
918470993 1:184873262-184873284 AAAAGGAAAATGTTTCCAGATGG + Intronic
919119022 1:193315730-193315752 ACAGGGGAATAGAACCCAGAGGG - Intergenic
919342379 1:196328794-196328816 AACAGGAAAATGAATCCAGAAGG + Intronic
920083478 1:203395642-203395664 AAAAGGAAAATGATGCCAAATGG - Intergenic
920267316 1:204733755-204733777 AATATGAAATGGGACCCAGACGG - Intergenic
920673670 1:208024104-208024126 AAAAGGAAGAGGACCCCAGAAGG - Exonic
921030430 1:211331211-211331233 AAAGGAAAATTGAATACAGATGG - Intronic
921267407 1:213434181-213434203 AGAAGGAAAGTGATACCAGATGG - Intergenic
921504912 1:215956003-215956025 AGAAGGACATTGGCCCCAGATGG + Intronic
921663245 1:217833555-217833577 CAAAGGAAAATGAAACCAAATGG - Intronic
921884242 1:220288646-220288668 AAAAGAAAATTTAATGCAGATGG - Intergenic
922083415 1:222321270-222321292 AAAAGAAAAATAATCCCAGAAGG + Intergenic
922142399 1:222901870-222901892 AAAAGGAAATTGAACCCAGATGG + Intronic
922150625 1:223000522-223000544 TAAAGAAAAATGAACCCAAAAGG - Intronic
922313615 1:224421100-224421122 AAAAGGACATTGGACTGAGAAGG + Intronic
922457441 1:225786708-225786730 ATGAGGAAATTGAGACCAGAAGG - Intronic
922634321 1:227150591-227150613 AACAAGAAATTTAACCAAGATGG + Intronic
922642779 1:227251092-227251114 AAAAGGAAAATGATCCCAAAGGG + Intronic
922919624 1:229291342-229291364 AAGAGGAAAATGAAGCCAGCAGG + Intronic
923001986 1:230013863-230013885 GTAAGGAGACTGAACCCAGAAGG - Intergenic
923071800 1:230572477-230572499 AAAATGAAGTTGAATCCACAGGG - Intergenic
923079273 1:230638430-230638452 CAAAGGAAATTGAGGCAAGATGG + Intergenic
923145520 1:231195019-231195041 AAAAGGACAGTGAAGCCAGGTGG - Intronic
923575123 1:235151386-235151408 ACAGGGAAATGGAACTCAGAAGG + Intronic
924188929 1:241528052-241528074 AAAAGAAAGTTGAAACCAAAAGG + Intergenic
924634860 1:245775885-245775907 GAAAGGAAAATCATCCCAGATGG + Intronic
1063055047 10:2495620-2495642 AAAAGGAATTGGAAACAAGAGGG - Intergenic
1063351310 10:5358414-5358436 AGACAGAAATTGAAGCCAGAGGG + Intergenic
1063355058 10:5391015-5391037 AAAAGGGAAATAATCCCAGATGG + Intergenic
1063617533 10:7614184-7614206 CAAAAGAAAAGGAACCCAGATGG + Intronic
1063717998 10:8548209-8548231 AGAAGGAAAATAAAACCAGATGG - Intergenic
1063894081 10:10660852-10660874 TAAAGTAAATTGAACCCAAATGG + Intergenic
1063947051 10:11187961-11187983 AGAAGGAAAATGATGCCAGAAGG - Intronic
1064215710 10:13398704-13398726 AAAAATCACTTGAACCCAGAAGG - Intergenic
1064527463 10:16272547-16272569 AAATGGAAATTGAACAGAAATGG - Intergenic
1064647442 10:17474019-17474041 AAAAGGTCATTGAAGGCAGAGGG - Intergenic
1065031613 10:21592275-21592297 AATAGGAAAATGATTCCAGAAGG - Intronic
1065161154 10:22923880-22923902 AAATGCAAATTAAACCCAGAGGG + Intergenic
1065248575 10:23785869-23785891 AAAAGGAACATGAAGCCATATGG + Intronic
1066016485 10:31249853-31249875 AAAAGGAAAAAAAACCCTGAAGG - Intergenic
1066520858 10:36217409-36217431 AAAAGAAAAATGAGTCCAGAAGG - Intergenic
1066783461 10:38977493-38977515 AAAAACAACTTGAACCCAGCAGG - Intergenic
1067035606 10:42914133-42914155 AGAAGGAAATTGAACACAGAAGG + Intergenic
1068108441 10:52649645-52649667 AAAAGGAAAGAAAACCCAGTGGG + Intergenic
1068261001 10:54581740-54581762 AACAGAAAAGAGAACCCAGAAGG + Intronic
1068403173 10:56556259-56556281 AACAGGAAACTGAAAACAGATGG + Intergenic
1068548204 10:58376605-58376627 AAAAGGTAAATGATCCCATATGG - Intergenic
1068735470 10:60409079-60409101 AAAAGAAATTTGAACTCAGCAGG - Intronic
1068923162 10:62506541-62506563 AAGAGGAACTTGGAGCCAGAGGG - Intronic
1069848326 10:71388594-71388616 AGAAGGAAAGTGGTCCCAGATGG - Intergenic
1070217769 10:74404399-74404421 AGAAGGAAAATGATACCAGATGG - Intronic
1070991921 10:80740354-80740376 AAATGGAAATGGGAGCCAGATGG - Intergenic
1071529961 10:86381722-86381744 AGAAGGAAAGTGATCCCAGATGG + Intergenic
1071686031 10:87757967-87757989 AAAAAGAAACTGAACCCAGAGGG + Intronic
1071738482 10:88328834-88328856 AAGAGGAAAATGAGCCTAGAGGG - Intronic
1072018464 10:91374070-91374092 AGAAGGAAAATAAAACCAGATGG - Intergenic
1072986995 10:100149591-100149613 ACCAGGAAATTGATCCCAGGAGG + Intergenic
1073481946 10:103791583-103791605 AAAGGGAAATAAGACCCAGAGGG - Intronic
1073594515 10:104786620-104786642 AAAAGAAAATTAAATCCTGAAGG + Intronic
1073757792 10:106599276-106599298 AAAAATCACTTGAACCCAGAAGG + Intronic
1073862630 10:107765035-107765057 AAAAGGAAAATGAAGGCAAATGG - Intergenic
1074150295 10:110753492-110753514 AGAAAGAAAGTGATCCCAGATGG - Intronic
1075134107 10:119767153-119767175 AAAAGGAAAATGATTCCAGATGG + Intronic
1075812893 10:125239119-125239141 AGAAAGAAAATGATCCCAGATGG + Intergenic
1075836847 10:125461376-125461398 AAAGGTGCATTGAACCCAGATGG - Intergenic
1076195045 10:128511792-128511814 AAAAAGAAATTGAAACAAAAAGG - Intergenic
1077200442 11:1304376-1304398 TAAAGGAAAGTGACCCCAAATGG + Intronic
1077446579 11:2594081-2594103 AAAAGGAAATTAAATCCAAATGG - Intronic
1078097022 11:8305281-8305303 AGAAGGAAATTGAAACCAAAAGG + Intergenic
1078288880 11:9986106-9986128 AACAGGAAATTGACGCCAAAAGG + Intronic
1078500241 11:11866614-11866636 AAAAAGAAAGTGACCCCAGAAGG - Intronic
1079027867 11:16963029-16963051 AAAAGGAGGCTGAATCCAGAGGG - Intronic
1080266374 11:30406141-30406163 AAAAGGAAAATGAATCCTCATGG + Intronic
1080594708 11:33760839-33760861 GGAAGGAAAGTGATCCCAGATGG + Intronic
1080726046 11:34900429-34900451 AAAGGGAACTTGAACCCTCATGG - Intronic
1081021502 11:37954020-37954042 AAATGGAATTTAAACCCAGTAGG + Intergenic
1081413569 11:42787471-42787493 AAAAGGAGATGAAACCCACAAGG + Intergenic
1082189218 11:49222215-49222237 CAAAAAAAATTGAACACAGATGG - Intergenic
1083847107 11:65342104-65342126 AAAAAAAAATTAAAACCAGAAGG + Intronic
1083903920 11:65657932-65657954 AAAAGGATCCTGAAGCCAGATGG + Intronic
1084221207 11:67680823-67680845 AAAAGCAAATTGGGCCCAGTGGG - Intronic
1086144396 11:83535662-83535684 AAAAAAAAATTGAAGCCATATGG + Intronic
1086677302 11:89624450-89624472 CAAAAAAAATTGAACACAGATGG + Intergenic
1087319954 11:96645949-96645971 AAAAGGAGATTTAACCCTGAAGG - Intergenic
1087704866 11:101478852-101478874 AAAAGAAATTTGAAGGCAGAGGG - Intronic
1087861720 11:103166454-103166476 AGAAGGAAAATGACACCAGAAGG - Intronic
1088041296 11:105385808-105385830 AGAAGGAAAATGATGCCAGAAGG + Intergenic
1088070767 11:105781774-105781796 AAGAGGAAATTATACCCAGATGG + Intronic
1088118491 11:106339744-106339766 ATAAGGAAAATGATCTCAGAAGG + Intergenic
1088257892 11:107917994-107918016 AAAACTCACTTGAACCCAGAAGG - Intronic
1088726578 11:112642742-112642764 CAAAGGAAAATGAAACTAGATGG - Intergenic
1088946189 11:114515560-114515582 AAAAGGAAATTGGAACCAGAAGG + Intergenic
1089107211 11:116022742-116022764 AGAAAGGAATTGAACCCAGAAGG - Intergenic
1089468224 11:118699805-118699827 GAAAGGAAATTGACCTCAAAAGG - Intergenic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1090620636 11:128558010-128558032 AAAATGACAATGAACCCAAAAGG + Intronic
1090730151 11:129565708-129565730 TAAAGGAAAATGATGCCAGATGG + Intergenic
1091094392 11:132805786-132805808 CAAAGGAAAATGATGCCAGATGG + Intronic
1091249006 11:134125890-134125912 AAGAGGAAAATGAACCCATCGGG - Intronic
1091505027 12:1059053-1059075 AAGAATAAATTGAACCAAGAAGG - Intronic
1091569928 12:1675845-1675867 AGAAGAAAACTGAACCCAGAAGG - Intergenic
1092270123 12:7017369-7017391 ATAAGGAAATTAGGCCCAGAGGG + Intronic
1092600585 12:10058632-10058654 GAGAGGCACTTGAACCCAGAAGG - Intronic
1092807523 12:12238770-12238792 AAAAGGAAGCTGAATCCAAATGG + Intronic
1093257844 12:16893208-16893230 AACAGGAAACTGAATCAAGAAGG + Intergenic
1093365115 12:18285376-18285398 ACAAGGAAAATGACACCAGATGG + Intronic
1093679326 12:21982858-21982880 AGAAAGAAATTGACCTCAGAAGG + Intergenic
1093737394 12:22637152-22637174 AAAGGGAAAGAGAATCCAGATGG - Intronic
1093789571 12:23232481-23232503 TGAAGGAAAATGAAACCAGATGG + Intergenic
1094228624 12:28076607-28076629 AAAAGAAAACTTAACCAAGAAGG + Intergenic
1095055729 12:37595941-37595963 AAAATGAAATGGAAACCATATGG + Intergenic
1095249024 12:39957209-39957231 AAGAGGAAACTAAACACAGAAGG + Intronic
1095363899 12:41378507-41378529 AAAAAAAAATTGAAGACAGAAGG - Intronic
1095989304 12:48023364-48023386 AAATGGAATTTCAACCCTGAAGG + Intronic
1096035149 12:48460455-48460477 AGAAGGAAAATGACACCAGATGG + Intergenic
1096212893 12:49779990-49780012 AGGAGGAACTTGAAGCCAGATGG - Intergenic
1096802390 12:54119791-54119813 AAAGATAAATTGACCCCAGATGG + Intergenic
1097017557 12:55998083-55998105 TAAAAAAAATTGAACCCAGCTGG - Intronic
1097369816 12:58764221-58764243 AAAAGAAAATTGAAACTAGGAGG + Intronic
1097648619 12:62266616-62266638 AAAAGTAAATTGAAACCATTGGG + Intronic
1098488234 12:71046451-71046473 AAATGGAAATGGAATTCAGATGG - Intergenic
1098607483 12:72409718-72409740 TGAAGGAAAATGATCCCAGAGGG + Intronic
1098734410 12:74080899-74080921 AAGAGGAAATGGAAGCCAAAGGG - Intergenic
1098872846 12:75836069-75836091 AGAAGGAAATTGAGTCCAGGAGG - Intergenic
1098951784 12:76646820-76646842 AAACTGGATTTGAACCCAGATGG + Intergenic
1099427531 12:82542185-82542207 AGAAATAAATTTAACCCAGAAGG - Intergenic
1099481832 12:83176749-83176771 AAAAGGAAACTAATTCCAGAAGG + Intergenic
1099566374 12:84253020-84253042 AAAAGGTCATAGAAGCCAGATGG - Intergenic
1100690048 12:97030045-97030067 AAAAGGAAAGTGACCTGAGAGGG + Intergenic
1100883863 12:99047837-99047859 AGAAGGAAAATGACACCAGATGG + Intronic
1100906574 12:99306750-99306772 AATAGGAAATTTAACCAAGCTGG - Intronic
1101147030 12:101850855-101850877 AAAAGGAGATTGATCTCAAAGGG - Intergenic
1101227762 12:102707082-102707104 AAAAAGAAATTGTACCCTGATGG - Intergenic
1101276500 12:103207541-103207563 AAGAGAAAATAAAACCCAGAAGG + Intergenic
1101572964 12:105972003-105972025 AAATGGAATTTGAACACAAATGG - Intergenic
1102048836 12:109847661-109847683 AGAAGGAAATTGAACCCCAAAGG - Intergenic
1102290712 12:111697247-111697269 AAAAAAAAATTGAATTCAGAGGG + Intronic
1102439728 12:112952624-112952646 AGAAGGAAAATGAATCCAGAAGG - Intronic
1102446583 12:113007708-113007730 GAAAGGAAACTGAAGCCAAAGGG + Exonic
1102507290 12:113391745-113391767 AAAAATAACTTGAACCCAGGAGG - Intergenic
1102710493 12:114921952-114921974 TACAGGAAATTGAATCCATATGG + Intergenic
1103040624 12:117692231-117692253 AAATGAAAATTAAAACCAGAAGG + Intronic
1106065254 13:26341915-26341937 AAAAAAAAATTGAAAACAGAAGG - Intronic
1106421028 13:29586468-29586490 CATGGGAAATTGCACCCAGATGG + Intronic
1106638972 13:31562848-31562870 AAAAGGAAAATGATTCCAGAAGG - Intergenic
1108985426 13:56580475-56580497 AAATGGAAAAAGAACACAGAGGG - Intergenic
1109144136 13:58756546-58756568 AGAAGTAAATTTAACCAAGAAGG - Intergenic
1109155229 13:58901345-58901367 AAAAGGGAAGAGAAGCCAGAGGG + Intergenic
1109232569 13:59776857-59776879 AAAAAGAAAAAGAACCAAGAAGG + Intronic
1109579466 13:64307985-64308007 GGAAGGAAAATGAACTCAGAAGG + Intergenic
1109859318 13:68176893-68176915 ACAAGAAAATTGAACTCAGTGGG + Intergenic
1110041923 13:70772369-70772391 AAAAGGAATGTGAAACCAGAGGG + Intergenic
1110118875 13:71856147-71856169 AAAATCAAATTTGACCCAGAAGG + Intronic
1110500979 13:76227905-76227927 AAAAGGAGAAGGAACACAGATGG + Intergenic
1110508735 13:76323113-76323135 AAAAGGAAAGAGAATCCATATGG + Intergenic
1110750135 13:79104145-79104167 AAAAAGAAATTAAATTCAGAAGG + Intergenic
1112102273 13:96202353-96202375 AAAAGGAAGTGGAATGCAGAAGG - Intronic
1112643360 13:101302054-101302076 CAAAGGAAATTGAAGCAAAAGGG + Intronic
1112682051 13:101777970-101777992 AAAATAAAATAAAACCCAGAGGG + Intronic
1112782856 13:102920745-102920767 AGAAGGAAACTGAACTCAGAAGG + Intergenic
1113023024 13:105909789-105909811 AAAAGGACATTTCACCCAGTTGG + Intergenic
1114245512 14:20909797-20909819 AAATGGAAATAGAGCTCAGATGG - Intergenic
1114686247 14:24534487-24534509 GAAAGGAAAGTGACTCCAGATGG - Intergenic
1114716552 14:24832079-24832101 AAAGGGAAAATGAGCACAGATGG - Intronic
1114930705 14:27464653-27464675 AGAAGGAGAATGAACACAGAAGG - Intergenic
1115115496 14:29876845-29876867 AAATGGAAATTAAAACCACAAGG + Intronic
1115150991 14:30285498-30285520 AGAAGGACATTCAACCCATAGGG - Intergenic
1115272609 14:31570997-31571019 AAAGGTAGATTGAAGCCAGATGG - Intronic
1115476387 14:33817947-33817969 AAAAGAGAAATGACCCCAGATGG + Intergenic
1115733228 14:36295055-36295077 AAAAGGAAATGGAACATTGATGG - Intergenic
1115807460 14:37067557-37067579 GGAAGGAAAGTGATCCCAGATGG + Intronic
1115870825 14:37800940-37800962 AAAAGGAAAAAGGACCCAGAAGG + Intronic
1116387692 14:44351959-44351981 GAGAGAAAATTGAAGCCAGAGGG - Intergenic
1117108549 14:52424644-52424666 GGAAGGAAAATGATCCCAGATGG - Intergenic
1117136058 14:52735065-52735087 AAAAAGTAATTAAATCCAGAAGG + Intronic
1117512656 14:56469774-56469796 AAAAGCAAATTTAACCAAGGTGG + Intergenic
1117522516 14:56564999-56565021 AAAAGGAAAATGAGCTCATAAGG + Intronic
1117749680 14:58908063-58908085 AAATGCAAATTGAAACCACAAGG + Intergenic
1118593052 14:67415379-67415401 AAAAGGAAATTCAACCTACATGG - Intergenic
1119012931 14:71015216-71015238 AGAAGGAAAGTGATCTCAGATGG + Intronic
1119684330 14:76619417-76619439 TAAAGGAAAATGATACCAGAAGG + Intergenic
1121399912 14:93665875-93665897 AGAAGGAAAGTGAACCAAGAAGG + Intronic
1122218417 14:100219652-100219674 AAAAGGAAACTGATACCACAAGG - Intergenic
1122390962 14:101383683-101383705 AAAATGAAAATGATACCAGATGG - Intergenic
1122404457 14:101491768-101491790 AGAAAGAAAGTGATCCCAGACGG + Intergenic
1122818841 14:104330096-104330118 AAAAGAAAATAAAACTCAGAGGG + Intergenic
1122897018 14:104763673-104763695 AGAAGGAAAATGACACCAGATGG + Intronic
1124800804 15:32831078-32831100 AGGAGGAAATTGAACTCAGATGG - Intronic
1125423913 15:39531102-39531124 AAAAGCAAATGAAAGCCAGAGGG + Intergenic
1125886623 15:43234466-43234488 ATAAGGAAAGTGAGCACAGATGG - Intronic
1126487087 15:49193815-49193837 AAGAGTCACTTGAACCCAGAAGG - Intronic
1126991442 15:54381666-54381688 AAGAGTTAATTTAACCCAGAAGG - Intronic
1127181727 15:56426733-56426755 AAAAGGAAAATGATACCAGAAGG - Intronic
1128114524 15:65096948-65096970 AGAAGGAATCTGAACCCAAAGGG + Intronic
1128540075 15:68521547-68521569 AAGAGTAAAATGACCCCAGATGG - Intergenic
1129145729 15:73645499-73645521 AGAAGGAAAATGATACCAGATGG - Intergenic
1129289849 15:74556729-74556751 AAAAGGAAAGTGAGCCCAGAGGG - Intronic
1129493821 15:75957242-75957264 AAAAGGAAGTTGATCCTATACGG - Intronic
1129496703 15:75989283-75989305 AAAAGTAAACTGAAACCAGATGG - Intronic
1129623290 15:77169554-77169576 AGAAGGAAACTGAACCCAGAAGG + Intronic
1129940459 15:79491939-79491961 AGAAGGAAATTAATCCCAAATGG - Intergenic
1130290939 15:82600416-82600438 AGAAGGAAAGTGAACCCACATGG + Intronic
1130387987 15:83429056-83429078 AGAAGGAAAATGACACCAGATGG + Intergenic
1130439361 15:83936020-83936042 AGAAGGAAAATGATCCCAGAAGG + Intronic
1131079470 15:89522778-89522800 ATAAGGCAACTGAAGCCAGAAGG + Intergenic
1131162907 15:90120009-90120031 ATTAGGAAATTGAACCCAGGAGG - Intergenic
1131849985 15:96529095-96529117 AAAAGGCAATTAAATCAAGAGGG - Intergenic
1131965955 15:97842462-97842484 AAAAGGCGATTGAACCCAACAGG + Intergenic
1132159564 15:99526073-99526095 AAAAGGAAAATGATACCAGATGG - Intergenic
1132923953 16:2417510-2417532 AGAAGGAAAATGATCCCAGATGG + Intergenic
1133251144 16:4482234-4482256 AAAAGGCAAGTGGACCCAGAAGG + Intronic
1133454897 16:5933478-5933500 ACAAGGAGATTCAACCCTGACGG - Intergenic
1133752831 16:8737836-8737858 AAGAAGCACTTGAACCCAGAAGG + Intronic
1133933559 16:10251506-10251528 AAAAGGAAACTGAACCCTCTGGG + Intergenic
1134068470 16:11245678-11245700 AAATGTACATTGAAGCCAGATGG + Intergenic
1134760703 16:16711897-16711919 AAAAGGATATTGTTCTCAGAAGG - Intergenic
1134985356 16:18647276-18647298 AAAAGGATATTGTTCTCAGAAGG + Intergenic
1135118884 16:19748055-19748077 AAAAAGAATTTGAGCCCAGATGG - Intronic
1135126408 16:19813652-19813674 AGAAGGAAACTGAACCCACAAGG + Intronic
1135476152 16:22777423-22777445 AAAAGGATATTGAACACAGAAGG + Intergenic
1135634784 16:24065635-24065657 AGAAAGAAAATGATCCCAGATGG - Intronic
1135888454 16:26335244-26335266 AGAAGAAAATTGAATCCAGAAGG - Intergenic
1138322726 16:56130932-56130954 AGAAGAAAAATGAACCCAGAAGG + Intergenic
1138802123 16:60045992-60046014 AAAAGAAACTTGATCCAAGATGG - Intergenic
1139774063 16:69302863-69302885 AAAAGAAAATTTATCTCAGATGG - Exonic
1140018519 16:71213197-71213219 AAAACGAAAGTGATCCCAAATGG + Intronic
1140087613 16:71810597-71810619 AAAAAAAAATTGAACCAAGTAGG + Intergenic
1140341141 16:74163797-74163819 AAAAGGAAAATAATACCAGATGG + Intergenic
1140445199 16:75021465-75021487 AGAAGGAAATTTAACTCAAAAGG - Intronic
1140585558 16:76287597-76287619 AAAAGGAAAATGATCACAGGAGG - Intronic
1140808172 16:78552754-78552776 AAAAGGAAAATGAATGAAGAAGG - Intronic
1141181283 16:81754497-81754519 AAAAGGAAATGGAAAGGAGATGG - Intronic
1141908411 16:87042463-87042485 AAAAGCAAAGGGAACCCAGGAGG + Intergenic
1142418704 16:89957379-89957401 AGAAGGAAACTCAACCCAGAGGG - Intronic
1142504570 17:354681-354703 AAAAGAGACTTGAACCCAGCAGG + Intronic
1142701305 17:1662739-1662761 ATACAGAAATTGAACCCAGGAGG + Intronic
1143143070 17:4753864-4753886 GAAAGGAGAGTGAACCCAAATGG - Intergenic
1143319495 17:6059023-6059045 ACAAATAAATTGAACACAGATGG + Intronic
1143371399 17:6442942-6442964 ATAAGCAAATTGTAGCCAGATGG - Intergenic
1143746754 17:9000634-9000656 GAAAGGAAATTAAAGCCAGATGG + Intergenic
1144386532 17:14753412-14753434 AGAATCAACTTGAACCCAGAAGG + Intergenic
1144653230 17:17019810-17019832 AGAAGGAAATTGAACCAGGGAGG + Intergenic
1146026717 17:29327768-29327790 AAAAAAAAATTGAGCCCAGGAGG + Intergenic
1146072883 17:29700567-29700589 GACTGGAAATTCAACCCAGAAGG - Intronic
1146463920 17:33070718-33070740 AAAAGGAAATTGACATCAGATGG - Intronic
1146665198 17:34697092-34697114 AAAAAGAAAATGATTCCAGAAGG + Intergenic
1146697681 17:34922583-34922605 AGAAAGAAAGTGAATCCAGAAGG + Intergenic
1147060849 17:37877011-37877033 AATAGGAAAATGATTCCAGAAGG + Intergenic
1147229693 17:39008340-39008362 AGCAGGAATTTGAACCCAGAGGG - Intergenic
1147813288 17:43189181-43189203 AATAGAAAACTGAACCCAGGTGG + Intronic
1148016722 17:44527130-44527152 AGAAGGAAAGGGATCCCAGATGG + Intergenic
1148291938 17:46459829-46459851 TGAAGGAAGTTGAACCCAGAAGG + Intergenic
1148314128 17:46677520-46677542 TGAAGGAAGTTGAACCCAGAAGG + Intronic
1148410195 17:47459792-47459814 AATAGGAAAATGACTCCAGAAGG + Intergenic
1148424992 17:47586805-47586827 AAAAGGCAATTGAAAGTAGAAGG - Intronic
1148522703 17:48296378-48296400 AAAAGGAAAATGAAGCAAGGTGG + Intronic
1149227845 17:54496447-54496469 AAAAGGAAACTAAACCCTGAAGG - Intergenic
1149442616 17:56687592-56687614 AAAAGGAAAAGGGACTCAGAGGG + Intergenic
1149444873 17:56705612-56705634 AGAAGGAAATTGGACCCCAAGGG - Intergenic
1150029473 17:61717361-61717383 AGAAGGAAAATGATACCAGATGG - Intronic
1150748752 17:67839996-67840018 ACAAGCAAATTAAAACCAGAAGG - Intronic
1150905988 17:69338052-69338074 AGAAGGAAATTGAATCCAAAAGG + Intergenic
1151079530 17:71312631-71312653 ACAAGGAAATGGAGCTCAGAGGG - Intergenic
1151437122 17:74104779-74104801 AAAAAGAACTTAAACCCAGCAGG + Intergenic
1151500430 17:74484642-74484664 ACAAGGAAACTGAGGCCAGAGGG + Exonic
1152051228 17:77980080-77980102 AAAAGGAAAATTATCCCAGCTGG + Intergenic
1152247732 17:79194058-79194080 CCAAGGAAAATGAACCCACAGGG - Intronic
1152309975 17:79544144-79544166 GAGAGGAAACTGAGCCCAGAGGG + Intergenic
1152938973 17:83155804-83155826 ACAAGGAAATTGCTTCCAGATGG - Intergenic
1152963571 18:95849-95871 AAAGGAAAACTGGACCCAGATGG + Intergenic
1153391508 18:4566613-4566635 AAAAGGAAAAGTATCCCAGATGG + Intergenic
1153663237 18:7344805-7344827 AGAAGGAAAATGATGCCAGATGG + Intergenic
1153793751 18:8603845-8603867 AAAAGGGAAATGAAACCAGATGG + Intergenic
1155020242 18:21889644-21889666 AGAAGGAAAATGATCTCAGATGG - Intergenic
1156129323 18:33951146-33951168 AGAAGGAAACTGAATCCAAAAGG - Intronic
1156279603 18:35623180-35623202 AAAAGGGAAATGACACCAGATGG - Intronic
1156594226 18:38528244-38528266 AAAAGTAAAATGAAACTAGATGG + Intergenic
1156601742 18:38615321-38615343 ATAAGGAAATTGAACATGGAAGG - Intergenic
1156692878 18:39729494-39729516 ATTAGGAAAATGAACCCTGAAGG - Intergenic
1156864201 18:41870492-41870514 AAAAGGAAGTTGAGCCCTGGTGG - Intergenic
1156954075 18:42940121-42940143 GAAAGGAAATTTAAGGCAGAGGG - Intronic
1157307409 18:46527146-46527168 AAACGGAATCTGAACGCAGAGGG + Intronic
1158223920 18:55180832-55180854 AAAGGAAAATTAGACCCAGAAGG - Intergenic
1158530258 18:58254683-58254705 AAAGAGAAAATGAACCCAGCTGG - Intronic
1159047081 18:63379092-63379114 AAAATGAAAGTGAACGCAGGAGG + Intergenic
1159652701 18:70996526-70996548 AAGAGGAAATTGAATCCCGGGGG + Intergenic
1160038776 18:75324657-75324679 AGAAGGAAAGTAAACCCAGAAGG - Intergenic
1160062017 18:75538955-75538977 AGAAGGAAAATGATCCCAGATGG - Intergenic
1160091508 18:75831517-75831539 AAAAGGAAATTCAACCTTCAGGG + Intergenic
1162729086 19:12706798-12706820 ACAAGGAAAGGGAACCAAGAGGG + Intronic
1163269645 19:16244361-16244383 ACAAGGAAAGTGATCTCAGACGG + Intronic
1164068466 19:21742891-21742913 GAGAGGAAATTTAACCAAGAAGG + Intronic
1164551352 19:29215052-29215074 AAACTAAAATTGAACCCAGGAGG - Intergenic
1165183301 19:33992417-33992439 TAAAGGAAAATGATACCAGATGG + Intergenic
1165229892 19:34380371-34380393 AAAAATTACTTGAACCCAGAAGG - Intronic
1165592736 19:36984624-36984646 TAAAGGAAAGTGATCCCAGATGG - Intronic
1165849498 19:38840956-38840978 AAGAGGAAAATAACCCCAGAGGG + Intronic
1165977508 19:39689575-39689597 AAGAATAACTTGAACCCAGAAGG + Intergenic
1166200484 19:41234231-41234253 GAAAAGAAATTGACCCCATAGGG + Intronic
1166519055 19:43467461-43467483 AAAAGGAAAATGACTCTAGAAGG + Intergenic
1166550278 19:43661256-43661278 GAAGGGAAATAGAGCCCAGACGG - Intronic
1166579832 19:43886079-43886101 TAAAGGAAAGTAATCCCAGATGG + Intronic
1167683219 19:50938727-50938749 AAAAAAAAATTGAGGCCAGATGG + Intergenic
1168198354 19:54792955-54792977 ATAAAGAAAGTGAAACCAGATGG - Intronic
925468268 2:4131450-4131472 CAATAGAAATTAAACCCAGAAGG - Intergenic
925582795 2:5429061-5429083 AAAAGCAAATTAAAATCAGAAGG - Intergenic
925844916 2:8026483-8026505 GAATGGAAAGTGAGCCCAGATGG + Intergenic
925951368 2:8915309-8915331 AAAAGGAAAACGGACCCAGCTGG + Intronic
926244195 2:11110557-11110579 AGAAGAAAATTGAACGCAGAAGG + Intergenic
926654937 2:15392053-15392075 AAAAAGAAAATGCAACCAGATGG + Intronic
926860939 2:17308029-17308051 AAAAGGAAATAGAACTCAAGGGG + Intergenic
926973597 2:18491169-18491191 AGAAGAAAAATAAACCCAGAAGG - Intergenic
927727966 2:25442692-25442714 GAATGGAAAGTGATCCCAGAAGG + Intronic
927738931 2:25549687-25549709 AGAAAGAAAATGAACCCAGAAGG - Intronic
928111325 2:28511497-28511519 AAAAGGAAAATGATCCCAGTTGG - Intronic
928444831 2:31324335-31324357 AGAAGGAAATTGAAGCCAGAAGG + Intergenic
928643900 2:33331020-33331042 AAAACGAAATTTTACCCAAATGG - Intronic
928894631 2:36246475-36246497 CAAAAGAAATTCTACCCAGAAGG + Intergenic
928956509 2:36874880-36874902 GAAAAGAAAGTGATCCCAGATGG + Intronic
929162984 2:38852175-38852197 AAAAAGGAATTGAACAGAGAAGG - Intronic
929449618 2:42028033-42028055 AACAGGAATGTAAACCCAGATGG + Intergenic
929497831 2:42461752-42461774 AAAAGGGAATAGAACCCATGTGG - Intronic
929839202 2:45439239-45439261 TAAAGGAAATTGACACCAGCTGG + Intronic
930583414 2:53241420-53241442 AAGAAGAAAATGAACCCAGAAGG - Intergenic
930792546 2:55349530-55349552 AAATGGAAATAGAACTCAAAAGG - Exonic
931191584 2:60005889-60005911 AAAAGGAAAATGATCCTAGATGG - Intergenic
931271120 2:60703749-60703771 AGAAGAAAAGTGCACCCAGAGGG - Intergenic
931384960 2:61790231-61790253 AAAAAGAAATTGAACCCTCAAGG + Intergenic
931924685 2:67058632-67058654 TAAAGGAAAGTGCACCCAGTGGG + Intergenic
931971993 2:67598576-67598598 AAAGGGAAAGTGATCTCAGATGG - Intergenic
932871589 2:75405420-75405442 AAAAGCTATTTGAACCCAGAGGG - Intergenic
933502239 2:83128387-83128409 AAAAATAAATAAAACCCAGAGGG - Intergenic
933652856 2:84863199-84863221 AAAAGCAAATTGCTCCCAAAAGG + Intronic
935381840 2:102460673-102460695 AAATGGAAATTAAAGCCACAAGG + Intergenic
935456396 2:103272956-103272978 AGAAGGAAAATGAACCTAGGTGG - Intergenic
935534951 2:104283366-104283388 AAAAGAAAATTGTACCTGGAGGG - Intergenic
935688502 2:105709181-105709203 AAATAGAATTTGAAACCAGATGG - Intergenic
936482985 2:112902445-112902467 AGAAGGAAAATGATCCCAGAGGG + Intergenic
936488312 2:112946495-112946517 AAGAGAAAATTGAAGCCAGCAGG + Intergenic
936679673 2:114755964-114755986 AAAAAGAAATTAAAACCTGATGG + Intronic
936826851 2:116592002-116592024 AACAGAAAACTGAAACCAGACGG + Intergenic
937101036 2:119269478-119269500 AGAAAGAAAATGATCCCAGAGGG + Intergenic
937327203 2:120997385-120997407 AGAAGGGAAGTGATCCCAGAAGG + Intergenic
938024277 2:127932048-127932070 AAAAGGAATTTAAACCCGCAAGG + Intergenic
938148311 2:128858066-128858088 AAAAGGAGAATGATACCAGATGG - Intergenic
938395455 2:130943917-130943939 AAAAGGAAAATGATACCAGAGGG - Intronic
938942169 2:136178905-136178927 TCAAGGCAATTGAACCAAGATGG + Intergenic
939237160 2:139510103-139510125 AGAAGGAAAATGACACCAGATGG - Intergenic
939248874 2:139661194-139661216 AAAAGGTCAATGAACCCTGAAGG + Intergenic
939858796 2:147393142-147393164 AAGAGGGAATTCAACCTAGAGGG - Intergenic
940221426 2:151355863-151355885 AAAATGCAAATGAACACAGAAGG + Intergenic
941543066 2:166811340-166811362 AGAACAAAACTGAACCCAGAAGG + Intergenic
942048377 2:172114823-172114845 AAAAGTAACCTGGACCCAGATGG + Intergenic
942944573 2:181658249-181658271 AAAAGGAAATTAAATTCATAGGG + Intronic
943957927 2:194216949-194216971 AAAATAAAAGAGAACCCAGAAGG + Intergenic
944380447 2:199103240-199103262 AAGAGGAGTTTGAACCTAGAAGG - Intergenic
945456070 2:210054014-210054036 AAATGTAAATTGAAACTAGACGG + Intronic
945465365 2:210163458-210163480 AAAAGGAAAGAGAACAAAGATGG + Intronic
945498872 2:210543385-210543407 AGAAGGATATTGAACCAAGCAGG - Intronic
945957092 2:216096452-216096474 GAAAGTCACTTGAACCCAGAAGG - Intronic
946182611 2:217957657-217957679 TAGAGAAAATTGAACACAGATGG + Intronic
947432827 2:230045637-230045659 AAAAGGAAAATGTACACAAATGG + Intronic
947970134 2:234316638-234316660 AAAATGATATAGAACCCAGGTGG + Intergenic
948890325 2:240904297-240904319 AAAATAAAATTAAACACAGATGG + Intergenic
1168812500 20:714035-714057 AGAAGGAAAATGATACCAGATGG - Intergenic
1168847254 20:953805-953827 AAAAAGAAAATGAAACCACAGGG - Intergenic
1168891752 20:1299552-1299574 AGAAGGAATTTCCACCCAGAGGG - Intronic
1169484985 20:6022098-6022120 AAAAGGAAAATGATCTCAGATGG - Intronic
1169746194 20:8945543-8945565 ACTAGGAAATTCAACCCTGAAGG + Intronic
1169966782 20:11226657-11226679 AGATGGAAAGTGAAGCCAGAGGG + Intergenic
1170196706 20:13696323-13696345 ATGAGGAAACTGAGCCCAGATGG + Intergenic
1170514119 20:17110234-17110256 AAATGGAAATCAAACCCACAAGG - Intergenic
1170966619 20:21078272-21078294 AAAAAGAAATAAAACCCACATGG - Intergenic
1171087503 20:22251351-22251373 AAAAGAAAATTGAACACATCTGG + Intergenic
1171526507 20:25816398-25816420 AAAATGAAATGGAAACCATATGG - Intronic
1171550320 20:26039487-26039509 AAAATGAAATGGAAACCATATGG + Intergenic
1171794351 20:29554795-29554817 AAAGATAAATTGACCCCAGAAGG - Intergenic
1171854121 20:30329596-30329618 AAAGATAAATTGACCCCAGAAGG + Intergenic
1171903197 20:30876270-30876292 AGAGGGAAAGTGAAACCAGATGG - Intergenic
1172070953 20:32256652-32256674 AACAGTAAGTTGAAACCAGAGGG + Intergenic
1172389502 20:34557589-34557611 ACAAGGACATGGAACCCAAAAGG - Intronic
1172826676 20:37794197-37794219 AGAAGGAAACTGACCCCGGATGG - Intronic
1173581935 20:44153323-44153345 AACAGGAAAGTGAGCCCAGAGGG + Intronic
1173789646 20:45819660-45819682 AGAAGGAAATTGAGCCCTGAGGG + Intergenic
1174770236 20:53292672-53292694 AAAAGGAAATTGTAGCCAGAAGG - Intronic
1175340380 20:58225616-58225638 ATTAGGAAACTGAGCCCAGAAGG + Intronic
1175739187 20:61408698-61408720 AAAATGAAATGGAACCAGGAAGG - Intronic
1175848948 20:62076797-62076819 TGAAGGAAAATGATCCCAGATGG + Intergenic
1177316692 21:19471457-19471479 AAAAGGAAAAATGACCCAGAAGG + Intergenic
1178173006 21:30062918-30062940 CAAAGGAAATGAGACCCAGATGG + Intergenic
1178329359 21:31674047-31674069 AAAAGGAAAGTGATTCCTGAAGG + Intronic
1178335926 21:31743361-31743383 AAAAGAAAATTGACAACAGATGG - Intergenic
1178966687 21:37126831-37126853 AAAAGAAAAGAGACCCCAGAGGG - Intronic
1179059402 21:37965642-37965664 AAGAGGAAAATGAAGCCAGGAGG - Intronic
1179633897 21:42695291-42695313 GAAAGGAAAATGACACCAGATGG - Intronic
1180106626 21:45622995-45623017 AGAAGGAAACTGAACCCAGAAGG - Intergenic
1180118838 21:45732002-45732024 AAAAGGAAAATAATACCAGAAGG - Intronic
1180336593 22:11582242-11582264 AGAGGGAAAGTGAAACCAGATGG - Intergenic
1180574808 22:16763063-16763085 AAAATGAAATGGAAACCATATGG - Intergenic
1180723803 22:17929525-17929547 AAAATGAAATAGAGCACAGATGG - Intronic
1180856748 22:19051847-19051869 AAATGCAAATTGAAACCATAAGG + Intronic
1181098085 22:20519892-20519914 AAAAGGAAACGAAGCCCAGAAGG - Intronic
1181897240 22:26121333-26121355 AAAAGGACATTGAGGCCAGAGGG - Intergenic
1182522976 22:30894977-30894999 AGGAGGAAACTGACCCCAGAGGG + Intronic
1183083068 22:35469584-35469606 AGACAGAAGTTGAACCCAGACGG + Intergenic
1183210610 22:36449116-36449138 AAAAGGAAATTGAACTGAGAAGG + Intergenic
1184318732 22:43722172-43722194 AAATGCAAATTGAAGCCACAAGG + Intronic
1184699503 22:46161083-46161105 AAAAGAAACAAGAACCCAGAGGG + Intronic
1185408116 22:50667682-50667704 AAAAGAAAATTGAACCTAGAAGG + Intergenic
949897211 3:8776839-8776861 AAAAGGCATTTCATCCCAGAAGG + Intronic
950327383 3:12124091-12124113 AACAGGAAATTGAATCCAAAAGG + Intronic
950571868 3:13805848-13805870 AAAAGGAAAATGACACCAGCTGG - Intergenic
950699921 3:14736195-14736217 AGAAGGAAAATGATCCCAAATGG - Intronic
951142486 3:19181211-19181233 AGAGGAAAATTGAGCCCAGAAGG + Intronic
951905760 3:27705474-27705496 AGAAGGAAAATGATACCAGATGG - Intergenic
952750246 3:36819106-36819128 AGAAATAAATTGAACCAAGAAGG + Intergenic
952944275 3:38466855-38466877 AGAAGGAAAATAAATCCAGATGG + Intronic
953330524 3:42049293-42049315 AAAAGGAAGAGGAACCAAGATGG - Intronic
953416941 3:42727480-42727502 AGAAGGAAAGTGAACCTAGAAGG + Intronic
953559687 3:43977318-43977340 GAGAGTAACTTGAACCCAGAAGG - Intergenic
953826342 3:46254465-46254487 AAAAGAACTTTGAACCCAGGGGG - Intronic
953934768 3:47031552-47031574 TAAAGGAAAATGATTCCAGATGG + Intronic
954792002 3:53140182-53140204 AAAAATAAATAGAACCAAGAGGG + Intergenic
955187929 3:56732771-56732793 AAAGGGAAATAGAATCAAGAAGG + Intronic
955900390 3:63747486-63747508 AAGAGGAAGTGGAACCCAGAAGG + Intergenic
956140864 3:66145714-66145736 AAAAGAAAATTGAAATAAGATGG - Intronic
956284274 3:67592168-67592190 AAAAGTATTTAGAACCCAGAAGG + Intronic
957305616 3:78455168-78455190 GAAATGAAATTAACCCCAGAAGG + Intergenic
957828941 3:85490200-85490222 AAGAAGAAACTGAACCCAAATGG + Intronic
958459803 3:94380344-94380366 AAAAAGAAAATGATGCCAGATGG + Intergenic
958705645 3:97651402-97651424 AAAAGCATATTGAACACAAAAGG + Intronic
958981263 3:100722875-100722897 AGAAGGAAATTTAGTCCAGAAGG + Intronic
959011234 3:101078837-101078859 ACAAAGGAATTGATCCCAGAAGG + Intergenic
959735613 3:109654719-109654741 AGAAGGAAAATGATCCCAGATGG - Intergenic
960822277 3:121747822-121747844 AAAAGGAAATTTAATACAGAAGG - Intronic
961493095 3:127269102-127269124 AAAAGAAAATTGAATACATATGG + Intergenic
961953172 3:130771849-130771871 TAAAGCAAATTGAACAAAGAGGG + Intergenic
962248087 3:133814526-133814548 AAGAGTTACTTGAACCCAGAAGG - Intronic
962321228 3:134392248-134392270 AAAAGGAAAATGACCCCAAATGG - Intergenic
962570311 3:136706497-136706519 AAAAACAAATTTAACCAAGAAGG + Intronic
962811746 3:138964497-138964519 AGAAGGAAATTGAACTCTGAAGG - Intergenic
963539055 3:146563452-146563474 GAAAGGAGAATGAACCCAGGAGG + Intergenic
964027458 3:152094572-152094594 AGAAGGAAATTGATACCAGATGG - Intergenic
964144620 3:153444001-153444023 AAAAAGTAACTGCACCCAGAAGG + Intergenic
964448307 3:156784247-156784269 AACAGGAAATTGATGCCACAGGG - Intergenic
965104292 3:164338845-164338867 AAAAGGGAAATAAACCAAGAAGG + Intergenic
965148442 3:164938141-164938163 AAAAGGAAATTTAAATCATATGG - Intergenic
965555380 3:170013074-170013096 ATAAGTAAAATGAACACAGAAGG - Intergenic
966374463 3:179281216-179281238 AAAAAAAAAGTGAACCCAAAAGG + Intergenic
966783639 3:183606699-183606721 AAAAGGAAAATTATACCAGATGG + Intergenic
966792791 3:183689250-183689272 AAATGGATATTTATCCCAGAAGG - Intergenic
966798221 3:183736762-183736784 AAAATGAACTTGAACTCTGACGG - Exonic
966995972 3:185281030-185281052 AACAGGAAATTAAGGCCAGAGGG + Intronic
967246860 3:187496251-187496273 AAATGCAAATTGAACCGAAATGG + Intergenic
967462811 3:189765859-189765881 ATAAGGAAACTAAGCCCAGAGGG - Intronic
967535078 3:190592808-190592830 GAAAGGAAAGTGAACCCTGACGG - Intronic
968743776 4:2346386-2346408 AAAAAGAAAATGACACCAGATGG + Intronic
969563212 4:7962546-7962568 AAAAAAAAAAAGAACCCAGAGGG + Intergenic
970075278 4:12211565-12211587 AAAAACAAATTAAACGCAGATGG + Intergenic
970352911 4:15222750-15222772 AGAAGGAAAATGGTCCCAGATGG + Intergenic
970553969 4:17213024-17213046 GAAAGGAAAATGATTCCAGAAGG + Intergenic
970617106 4:17778447-17778469 AGAAGAAAAGTGAACCCAAAGGG + Intronic
971141576 4:23930668-23930690 AAAAGTACATTGAACCCTGAAGG - Intergenic
971383304 4:26119612-26119634 AAAATAAAATTGAACACGGAAGG - Intergenic
971460990 4:26896274-26896296 AAAAGGAAATTTATCCCAGGTGG - Intronic
971735687 4:30447521-30447543 AGAAGGAAAATAATCCCAGAAGG + Intergenic
971964165 4:33530048-33530070 AAAAGGCAATAAATCCCAGAAGG + Intergenic
972600802 4:40570622-40570644 AGAAGGAAAATGGACCAAGATGG + Intronic
972705378 4:41537847-41537869 ATAAGGAAACTGAGACCAGAAGG + Intronic
973126043 4:46585991-46586013 AAATGCAAATTGAAACCACAAGG - Intergenic
973779750 4:54277217-54277239 AAAAAGGAATTGAGCCCACAGGG - Intronic
973886317 4:55325554-55325576 GAAAGGAAATTGAAACCATAAGG + Intergenic
975415847 4:74103390-74103412 AAAAAAAAATTGAAGGCAGATGG + Intergenic
975551910 4:75621817-75621839 ATAAGGAAATTGACCCCAGATGG + Intronic
975836440 4:78427102-78427124 ACAAGGTAATTGAAACCTGAAGG + Intronic
976011939 4:80499741-80499763 AAGAGGAAATTGAACTAAAATGG - Intronic
976477207 4:85497938-85497960 AGAAGGAAATTGAACACCGAGGG - Intronic
976575087 4:86660002-86660024 AGAAGGAAATATAACCCAGAAGG + Intronic
977650708 4:99465509-99465531 AAAAATAAATTTAACCAAGATGG - Intergenic
977669808 4:99683014-99683036 AAAAGGAAATTCTAGGCAGAGGG - Intergenic
978582625 4:110247643-110247665 AAAAGGAAATAGACCTCAGGTGG - Intergenic
979232194 4:118358507-118358529 AACAGGGATTTGAACCCAGGTGG - Intergenic
979684111 4:123492711-123492733 AAGAAGATATTTAACCCAGAAGG - Intergenic
980143223 4:128947316-128947338 AAATGGAAATTGTACGCAGATGG + Intronic
981087886 4:140702424-140702446 AAAAGGAAATTAAGAGCAGAAGG + Intronic
981256924 4:142672474-142672496 AAAAGCAAATTGAAACCACAAGG - Intronic
982223897 4:153148298-153148320 AAAAGGAGAATGATCCCAGAAGG + Intergenic
982264762 4:153528024-153528046 ACAAGGAAATTCAGACCAGACGG - Intronic
982446439 4:155496005-155496027 TAAAGGAAATTGAAATAAGAGGG + Intergenic
983135871 4:164079348-164079370 AAATGGAAATGGAAATCAGATGG + Intronic
983163791 4:164450199-164450221 AAAAGGAAATTAAATCAATATGG + Intergenic
983328691 4:166294611-166294633 AGTACGAAAATGAACCCAGAGGG + Intergenic
983932472 4:173467889-173467911 AAGTGGAAATTGCACCCAAATGG + Intergenic
984233394 4:177127863-177127885 AAAAGAACATTGAAACCAAAGGG + Intergenic
984674073 4:182526418-182526440 AAAAGGAAAGTGAAAAAAGAAGG - Intronic
984731473 4:183072041-183072063 AAAAGAAAAATGATCCCATATGG + Intergenic
984848976 4:184136462-184136484 AGAAGGAAAATGATCACAGATGG - Intronic
985025911 4:185738942-185738964 AATAGAGAATGGAACCCAGAGGG - Intronic
985384244 4:189428646-189428668 AAAAAAAAAGTAAACCCAGAGGG - Intergenic
985952460 5:3233708-3233730 CAAAGGAAAGGGAACCCATATGG - Intergenic
986268724 5:6212865-6212887 AAAAGGAAACTGAGACCAGAGGG - Intergenic
986451035 5:7865844-7865866 AAAAGGAAACTGCACCCATGGGG + Intronic
986888264 5:12266997-12267019 AAAAGGAAAATGATACCAGATGG - Intergenic
987109876 5:14675749-14675771 AGAAAGACAATGAACCCAGAAGG - Intronic
987200957 5:15577706-15577728 TTAAGAAAAATGAACCCAGAGGG + Intronic
987477326 5:18407347-18407369 AAAAGGAAATCAAATCCACAAGG + Intergenic
987566741 5:19598422-19598444 AAAAGGAAATTGAAACTATTTGG + Intronic
987627779 5:20424768-20424790 AAAAAGGAAGTGAACCAAGATGG + Intronic
987912620 5:24168758-24168780 AAAAGGAAAATTAATCCATATGG - Intronic
989358567 5:40573051-40573073 ATAAGGAAATTGCAAGCAGATGG + Intergenic
989976525 5:50594135-50594157 AAAAGTAAATTTAAACCACAAGG - Intergenic
990237427 5:53783166-53783188 CAAAGGAATATTAACCCAGAAGG - Intergenic
990294414 5:54386061-54386083 AACAGGAAATCCAACCCTGAGGG + Intergenic
990688682 5:58337474-58337496 AGAAGGAAAATGATACCAGATGG + Intergenic
990773873 5:59283525-59283547 AATAGCAGATTGAACCCAAATGG - Intronic
991127916 5:63088428-63088450 AGAAGAGAATTGAACACAGATGG - Intergenic
991426947 5:66501933-66501955 ACAAGGAAATTGAACCCAGAAGG - Intergenic
991779123 5:70115235-70115257 AAAAGGAAAATGATAGCAGATGG + Intergenic
991858415 5:70990708-70990730 AAAAGGAAAATGATAGCAGATGG + Intronic
991871572 5:71115590-71115612 AAAAGGAAAATGATAGCAGATGG + Intergenic
992559857 5:77940318-77940340 ATAAGAAAATTGAATCCAGAAGG - Intergenic
992720202 5:79553127-79553149 ACCAGGAAATTGAAAACAGATGG + Intergenic
992872105 5:81017496-81017518 TAAAGGGAATTGAACCAATAGGG + Intronic
993141527 5:84040121-84040143 AGAAGGGGTTTGAACCCAGAAGG + Intronic
994008586 5:94872643-94872665 AAAAGGAAAATTAACTCATAGGG + Intronic
994441153 5:99804887-99804909 ATAAGAAAAATGAACCCAGAGGG + Intergenic
994951866 5:106473686-106473708 AAGAGGAAATTGACCACAGAGGG - Intergenic
995257230 5:110060734-110060756 AAAAGGACATTGAAACTACAAGG - Intergenic
996167895 5:120248027-120248049 AGAAGGAAATTGGACTCAGAAGG + Intergenic
996418202 5:123232947-123232969 AGAAGAAAATTGAATGCAGAAGG - Intergenic
996637722 5:125714598-125714620 GAGAGGAAATTGAACTCTGATGG + Intergenic
996793629 5:127320165-127320187 AAAAGGAAATAAAACAGAGAGGG + Intronic
996894825 5:128468339-128468361 AAAAGTAAAAACAACCCAGATGG - Intronic
996977543 5:129452969-129452991 AAGTGCAAATTGAACCCACAAGG - Intergenic
997430499 5:133836603-133836625 AGAAGGATGTTGATCCCAGATGG - Intergenic
997506185 5:134419282-134419304 AGAAGGAAAATGAAACCAGATGG - Intergenic
997741120 5:136255848-136255870 ATCTGGAATTTGAACCCAGAAGG + Intronic
998223276 5:140305692-140305714 AAAAGGAAATTAAACTCATGAGG - Intergenic
998701436 5:144704754-144704776 AAAAAAAAATTGAATCCAGTGGG + Intergenic
998913108 5:146983081-146983103 AAAAAGAAAATGAACCAAAAAGG - Intronic
999118815 5:149190807-149190829 AGAAGAAAAATGATCCCAGATGG + Intronic
999545798 5:152627026-152627048 AAATGGACTTTGAACGCAGATGG - Intergenic
999575821 5:152975321-152975343 AATTGGGATTTGAACCCAGATGG - Intergenic
1000151589 5:158507109-158507131 TGAAGGAAAATGAACCCAGGTGG + Intergenic
1001913169 5:175537718-175537740 CACAGGAAATTGTACCCAGCAGG - Intergenic
1002293224 5:178213761-178213783 GACAGGAAAATGAAACCAGAAGG - Intronic
1002872610 6:1180530-1180552 ACAAAGAAATTGAAACCAGAAGG + Intergenic
1003907352 6:10714233-10714255 AAAATGAAATTGAAAACAGAAGG - Intergenic
1003926483 6:10882198-10882220 AAATGGAAACTGCAGCCAGAGGG + Intronic
1003983745 6:11415557-11415579 AAAAGAAAAGTCGACCCAGAGGG - Intergenic
1004018305 6:11752531-11752553 TAAAGGAAATTTCAACCAGATGG + Intronic
1004138803 6:12994991-12995013 AGAAGAAAATTGAACCAAGAAGG + Intronic
1004771473 6:18787196-18787218 ACAAGGAAATAGAACCTAGAAGG - Intergenic
1004887394 6:20064576-20064598 AAAAAGAGATCGAACTCAGATGG + Intergenic
1007007578 6:38380313-38380335 AGAAGAAAAATGATCCCAGAAGG + Intronic
1007561652 6:42813906-42813928 AGAAGGAAAATGATACCAGATGG + Intronic
1008374073 6:50771464-50771486 AAAAGGAGAATGAAGTCAGAGGG + Intronic
1008539669 6:52535690-52535712 AAAAAAAAATTGTACACAGATGG + Intronic
1008667816 6:53733713-53733735 AAAACAAAGTTGAACTCAGAAGG - Intergenic
1009307130 6:62103982-62104004 AAAAGAAAAATGATACCAGAGGG + Intronic
1010447302 6:75962521-75962543 AACAGGAGAATAAACCCAGAGGG + Intronic
1010857557 6:80860148-80860170 AAAAGAAATGAGAACCCAGAAGG + Intergenic
1011187232 6:84691091-84691113 AAAAGGAGACTGATCTCAGAAGG - Intronic
1011492361 6:87905472-87905494 AAATGCAAATTGAGCCCAGCTGG - Intergenic
1012504598 6:99930772-99930794 AAGAGGAAATTCAAACCAAAGGG - Intronic
1013429029 6:110039660-110039682 AAGAGGAAATTGAACCTGCAAGG - Intergenic
1013435137 6:110097068-110097090 AAAAGGAACTTGAACCCAGGAGG + Intergenic
1013700286 6:112759778-112759800 AGAAGGAAAATGATGCCAGATGG - Intergenic
1014541498 6:122681522-122681544 AAAAGAAAATTGACTTCAGAAGG - Intronic
1014637175 6:123861818-123861840 TAAAGGAAAATTAAACCAGAGGG - Intronic
1015364300 6:132379908-132379930 GAAATAAAATTGAACCCAGGAGG - Intronic
1015426420 6:133074189-133074211 AGAAGAAAATTTAACACAGAAGG - Intergenic
1015841897 6:137486384-137486406 AGAAAGAAATTCAACACAGAAGG + Intergenic
1015878306 6:137846075-137846097 AAAAGGAAACTGAAAAGAGAGGG + Intergenic
1016919145 6:149273797-149273819 GAAAGGACATTGAACACGGAAGG - Intronic
1016922259 6:149307275-149307297 AAGATGAAATTCAACCAAGATGG + Intronic
1017115415 6:150971576-150971598 AGAATGAAATTAAACCCTGATGG - Intronic
1017402312 6:154078432-154078454 AAAGGGAAAAAGAACCCACAGGG + Intronic
1017497158 6:154993138-154993160 AAAAATATATAGAACCCAGATGG - Intronic
1017627254 6:156361034-156361056 AAAAGCAAAATGGACTCAGATGG - Intergenic
1017695551 6:157012174-157012196 CAAAGGAAAATTATCCCAGAAGG + Intronic
1017772687 6:157655173-157655195 AAAAGGAAACTGAGAACAGAGGG + Intronic
1017943100 6:159070339-159070361 AGAAGGAAGTTGAATCCAAAGGG - Intergenic
1018007316 6:159634383-159634405 AGAAGAAAATTTAGCCCAGAAGG + Intergenic
1018375610 6:163208945-163208967 TAAAGAAAATTTAACACAGAGGG - Intronic
1018559761 6:165089379-165089401 AGAAGAAGATTGAATCCAGAAGG - Intergenic
1018972756 6:168539927-168539949 ACAAGGAAAGTGAGACCAGAGGG - Intronic
1019302321 7:312236-312258 AGAAGGAAATCTATCCCAGAAGG - Intergenic
1019368641 7:648690-648712 AAGAGTCACTTGAACCCAGAAGG + Intronic
1019832213 7:3342957-3342979 AAATGGAAATTAAAGCCATAGGG + Intronic
1020251228 7:6470119-6470141 TAACTGAAATTGGACCCAGAAGG - Intronic
1020406146 7:7837323-7837345 TGAAGGAAAATGATCCCAGATGG + Intronic
1020520972 7:9186612-9186634 AAAAGTCGAGTGAACCCAGAAGG + Intergenic
1021806721 7:24364413-24364435 CAAAGGAAAATGATACCAGATGG - Intergenic
1021809553 7:24390121-24390143 AAGAGGAAATTGAAGCCATAGGG - Intergenic
1022330865 7:29377454-29377476 AAGAGGACATTAAAACCAGAAGG - Intronic
1022554399 7:31277869-31277891 AGAAAGAAAATGAACCCAGAAGG + Intergenic
1022601894 7:31768757-31768779 AGAAGAAAAGTGAACCCACAAGG - Intronic
1022754177 7:33267833-33267855 TGAAGGAAAATGAAACCAGATGG - Intronic
1022826203 7:34016957-34016979 AACTTGATATTGAACCCAGAAGG + Intronic
1024087457 7:45907321-45907343 ATGAGGAAATGGGACCCAGAAGG + Intergenic
1024099987 7:46021364-46021386 AGAAGCAGCTTGAACCCAGAAGG + Intergenic
1025299158 7:57803533-57803555 AAAATGAAATGGAAACCATATGG + Intergenic
1026138943 7:67688110-67688132 AAAATGAAATTGAACTCAGAAGG - Intergenic
1026475515 7:70731763-70731785 AAACGGAAATAGAAACCAAATGG - Intronic
1026591328 7:71698291-71698313 AAAAGGAAAATGACTGCAGAAGG + Intronic
1027503167 7:78980753-78980775 AAAACGAAACTGAACCAAGAAGG - Intronic
1028026433 7:85847281-85847303 AAAAGGAAAATATTCCCAGATGG - Intergenic
1028160437 7:87478379-87478401 GAAAGGAAAATGATCCAAGAGGG - Intronic
1028213679 7:88106170-88106192 TACAGGGAATGGAACCCAGAAGG - Intronic
1028555842 7:92123898-92123920 AAAATGAATTTGATCCTAGAAGG - Intronic
1028936636 7:96472054-96472076 AACTGGAAATTGACCCCAAAAGG - Intergenic
1029789091 7:102823671-102823693 AATAAGAAATTGAATCCAGTTGG - Intronic
1029882004 7:103823792-103823814 AAAATGAAAACAAACCCAGAAGG - Intronic
1030336148 7:108328876-108328898 AAAAGGAATAAAAACCCAGATGG - Intronic
1030428767 7:109415421-109415443 AGAAGGAAAATGAACCCACAAGG - Intergenic
1030633552 7:111922575-111922597 AAAAAAGAACTGAACCCAGAAGG - Intronic
1030656283 7:112171980-112172002 AAGAGGAAATTGGACACACAAGG - Intronic
1031357325 7:120802613-120802635 AAGAGCAAATGGAACCCAGTAGG + Intronic
1031412859 7:121460607-121460629 AAACTGAAATTAAACACAGATGG - Intergenic
1031770501 7:125835084-125835106 ACAAGGAAAATGATCCTAGAAGG - Intergenic
1031829561 7:126609545-126609567 AAAAGAAAAATAAACCCAGTGGG - Intronic
1032026914 7:128450327-128450349 ACAAGAAAACTGAACCCAAAAGG - Intergenic
1032043922 7:128586498-128586520 AGAAGGAAAGTGACCCCAGGTGG - Intergenic
1032687195 7:134246964-134246986 AGGAGGAAATAAAACCCAGATGG - Intronic
1032848732 7:135774103-135774125 AAAAGGAAAAGGGACCCACAGGG - Intergenic
1032867920 7:135947194-135947216 AGAAGCAAATTAAACCCAAAAGG - Intronic
1033136774 7:138791826-138791848 AGAAGGAAAATGATCACAGATGG + Intronic
1033199519 7:139356855-139356877 AAAAAGGAAATGATCCCAGATGG + Intronic
1033381608 7:140825558-140825580 TAAAGGAAATTGAACACAGAAGG - Intronic
1034045407 7:147922163-147922185 GAAAGGAAAATGAAGACAGAAGG + Intronic
1034102612 7:148463770-148463792 ACAAGGACATTCAAACCAGAAGG - Intergenic
1034253465 7:149711187-149711209 GGAAGAACATTGAACCCAGAAGG + Intergenic
1034477539 7:151294858-151294880 AGAAGGAAAATGATACCAGATGG - Intergenic
1034533043 7:151708560-151708582 AAAGGGAATTTGGAGCCAGAGGG + Intronic
1034842497 7:154412317-154412339 CAAAGGCAAATGAACCCAGCAGG + Intronic
1035005785 7:155659246-155659268 AAAAAGAAATAGAAACCACAAGG + Intronic
1035563438 8:626100-626122 CAAAGAAAATTCAACACAGAAGG - Intronic
1035793658 8:2332723-2332745 AGAAGGAAAATGATCCCAGGAGG + Intergenic
1035799145 8:2388982-2389004 AGAAGGAAAATGATCCCAGGAGG - Intergenic
1036435114 8:8725852-8725874 CAGAGGAACTTGAACCCAGGAGG + Intergenic
1037070450 8:14640204-14640226 AGAAGAAAAATGAATCCAGAAGG - Intronic
1037450291 8:19010114-19010136 AAAGGGAATTTCAAACCAGATGG + Intronic
1037991463 8:23324252-23324274 ACAAGGAGACTGACCCCAGATGG - Intronic
1038042470 8:23736283-23736305 ACAAGGAAAGTTATCCCAGAAGG + Intergenic
1038122890 8:24638172-24638194 AAAAGGAGATTGGACCTAGAGGG - Intergenic
1038544269 8:28413133-28413155 AAAATGAAATTGAGCAGAGACGG + Intronic
1038880135 8:31601212-31601234 AAAAGGAAAATAATGCCAGATGG - Intergenic
1039727630 8:40236805-40236827 AAGAGGAAATTGAAAAAAGAAGG - Intergenic
1040936444 8:52786891-52786913 AGGAGGATCTTGAACCCAGAAGG - Intergenic
1041554962 8:59143156-59143178 AGAAGGAAAATGATCTCAGAAGG + Intergenic
1041700098 8:60779195-60779217 AAAAAGAAACTAACCCCAGATGG + Intronic
1042129494 8:65573399-65573421 AAAAGTAAATTTAACCAAGAAGG - Intergenic
1042204170 8:66311616-66311638 AAATGAAAATAGAAGCCAGAAGG + Intergenic
1042214734 8:66418844-66418866 AGAAGGAAAATGAACCAAAAAGG + Intergenic
1042334461 8:67615521-67615543 AAAAGGAAATAAAAACCAGAGGG + Intronic
1042736633 8:71996668-71996690 AAAAAGAAATTCAGCTCAGAGGG - Intronic
1043215095 8:77575354-77575376 ACAAGCAAATTTAACCCAAATGG + Intergenic
1043264272 8:78243506-78243528 AAAAGAAAATTGAGTTCAGAAGG + Intergenic
1043274817 8:78379610-78379632 AAGAATAACTTGAACCCAGAAGG + Intergenic
1043536141 8:81206701-81206723 AAAAGGAAATGGATCTCTGAAGG + Intergenic
1043830488 8:84982712-84982734 AAAAGGAAGGTGAACACAGAGGG + Intergenic
1043991493 8:86761181-86761203 AAAAGAAAATAGAACACAGCAGG - Intergenic
1044225630 8:89714929-89714951 AGAAGGAAAATGATGCCAGATGG - Intergenic
1044776742 8:95697300-95697322 CAAAAGAAAATGACCCCAGAAGG + Intergenic
1044805136 8:95999505-95999527 AAAAGGAAAATAATACCAGAAGG + Intergenic
1044973446 8:97642251-97642273 GAAAATAACTTGAACCCAGAAGG - Intergenic
1046330470 8:112708294-112708316 AAAAGTAAATTATACCCAGATGG + Intronic
1046600361 8:116309844-116309866 AAAAGGAACATGATCCTAGAAGG - Intergenic
1046885171 8:119358880-119358902 AGAAAGGAAGTGAACCCAGAAGG - Intergenic
1046988702 8:120423755-120423777 AAAAGGAAATTGATACCAGAAGG + Intronic
1047575372 8:126148537-126148559 AAAAGAAAAATGATACCAGATGG - Intergenic
1047706121 8:127501495-127501517 AAAAAGAATTTAAGCCCAGAAGG + Intergenic
1047852299 8:128870234-128870256 AGAAGGAAACTGGACACAGACGG - Intergenic
1047870702 8:129078395-129078417 ATAAAGAAATTGAAGCCAGGTGG - Intergenic
1047888833 8:129283961-129283983 AAATGCAAATTGAAGCCACAAGG + Intergenic
1047911325 8:129533135-129533157 AGAAGGAAAATTATCCCAGATGG + Intergenic
1048984352 8:139726038-139726060 AGAAGGAAATTGATAGCAGATGG - Intergenic
1050058760 9:1683053-1683075 AGAAGGAAAATGATCCCAGAAGG - Intergenic
1050418292 9:5437057-5437079 AAAGGGAAAATGAAGACAGAGGG - Intronic
1050480182 9:6080416-6080438 AAACGGAAATGGGAACCAGAGGG - Intergenic
1050520862 9:6498476-6498498 AAAAGGACATTTATCCTAGAGGG + Intronic
1050626564 9:7510357-7510379 TGAAGGAAATTGAAACCATATGG - Intergenic
1050846071 9:10220969-10220991 AAAACGAAATGGTACACAGAAGG + Intronic
1050984109 9:12060162-12060184 AAAACGAAACAGAAGCCAGAGGG - Intergenic
1051432540 9:16994746-16994768 AAAAGAAAATTTAGTCCAGATGG - Intergenic
1051728241 9:20111077-20111099 AAAGGGAAAGTGAAGCTAGAAGG - Intergenic
1052752404 9:32505203-32505225 AAAAAGGAGTTGAACCCAAAAGG + Intronic
1052803539 9:32991879-32991901 AAAAGGAAAGTGAAGAGAGAAGG + Intronic
1052973312 9:34393354-34393376 AGAAGGAAAATGATCACAGAAGG - Intronic
1053257509 9:36630741-36630763 AAAAAGCACTTGAACCCAGAAGG - Intronic
1053454058 9:38217805-38217827 AGAAGGAAAATGACACCAGATGG + Intergenic
1053791929 9:41692877-41692899 AAAGATAAATTGACCCCAGAAGG + Intergenic
1053794425 9:41712498-41712520 AAAATGAAATGGAAACCATATGG - Intergenic
1054150750 9:61602328-61602350 AAAATGAAATGGAAACCATATGG + Intergenic
1054153223 9:61621888-61621910 AAAGATAAATTGACCCCAGAAGG - Intergenic
1054182831 9:61924542-61924564 AAAATGAAATGGAAACCATATGG - Intergenic
1054470524 9:65533436-65533458 AAAATGAAATGGAAACCATATGG + Intergenic
1054473019 9:65553092-65553114 AAAGATAAATTGACCCCAGAAGG - Intergenic
1054655674 9:67663933-67663955 AAAATGAAATGGAAACCATATGG + Intergenic
1054762108 9:69013000-69013022 AAAAGGAAAGAAAACCCACAGGG + Exonic
1055077558 9:72231574-72231596 AAAAGGAAATTGTATGCAAAGGG + Intronic
1056310629 9:85337492-85337514 AAAAGGAAATAGAAACCTGAAGG + Intergenic
1056697543 9:88872587-88872609 AAAAGGAAAATGCACATAGATGG - Intergenic
1056784853 9:89583457-89583479 AGAAGGAAAATGACCCCAGATGG + Intergenic
1057121719 9:92581706-92581728 AGAAGGAAAATGATCCAAGAAGG + Intronic
1057238161 9:93383023-93383045 TGAAGGAAATTGATCCCAGAAGG + Intergenic
1057404196 9:94753209-94753231 AGAATAAAATTGGACCCAGAAGG + Intronic
1057660918 9:97001928-97001950 AAAAATAAATTTAACCCAGGAGG + Intronic
1058360134 9:104135914-104135936 AAAAGGAAAATGATACCAGATGG + Intronic
1058657456 9:107236462-107236484 ATAAGGAATTCTAACCCAGAGGG - Intergenic
1059085117 9:111293142-111293164 AGAAGGAAAGTGATTCCAGATGG + Intergenic
1059306709 9:113359361-113359383 GAATGGCAAGTGAACCCAGAAGG - Intronic
1059816876 9:117926643-117926665 AAGAGAAAATTGCACCCAGCTGG + Intergenic
1059885728 9:118742680-118742702 AAAAGGAAAACAAACCCAGCGGG + Intergenic
1060018486 9:120107916-120107938 GAAAGGACATTGAAACCAGCTGG - Intergenic
1060616712 9:125023213-125023235 AGAAGAAAATTGAAACTAGAAGG - Intronic
1060746860 9:126142347-126142369 AGAATGAAATTGAACACAGAAGG - Intergenic
1061641389 9:131959550-131959572 AAGAGGAAACCGAAGCCAGAGGG - Intronic
1062074513 9:134577893-134577915 AGAAGGAAAATTAACCCAGATGG + Intergenic
1062196111 9:135275129-135275151 CAGAGGAAAATGAACCAAGACGG - Intergenic
1062734525 9:138127877-138127899 AAAGGAAAACTGGACCCAGATGG - Intergenic
1186271935 X:7898284-7898306 ATAAGGAAATTGCCCCCACAGGG + Exonic
1186501132 X:10051485-10051507 CAAAGGAAACCAAACCCAGAGGG - Intronic
1186631139 X:11350119-11350141 AAAGGGAACTGGAGCCCAGAGGG - Intronic
1186647029 X:11518120-11518142 AAAAGAAAATTGAAGACAGGAGG - Intronic
1186951460 X:14630067-14630089 AAAAGAAAAATGATACCAGATGG - Intronic
1187166388 X:16807904-16807926 ACATGGAAATTAAAACCAGAAGG - Intronic
1187323465 X:18263440-18263462 TAAAGGAAAATGAGACCAGATGG - Intronic
1187599914 X:20817280-20817302 ATCAGGAAATTTAACCCTGATGG - Intergenic
1188426364 X:30051946-30051968 GCAATGAAATTGAACCCTGAAGG - Intergenic
1188440359 X:30209971-30209993 AAAAGGCAATTGAACCAATGAGG + Intergenic
1188578463 X:31681537-31681559 AGAAGGAAATTGAAGACAGGAGG - Intronic
1188764239 X:34072706-34072728 AAAAGTAAAATGAACCTATAAGG - Intergenic
1188975355 X:36666401-36666423 AGAAGTAAATTTAACCAAGAAGG - Intergenic
1189153981 X:38736643-38736665 ACAAGGGTACTGAACCCAGAAGG + Intergenic
1189655758 X:43243726-43243748 AAAAGGATATGGAAACCACAAGG - Intergenic
1190796586 X:53750462-53750484 AGAAGGAAAGTGATCCCAGATGG - Intergenic
1190930366 X:54943813-54943835 AGACGGAAAATGAACTCAGAGGG + Intronic
1191149865 X:57209150-57209172 AAAAGGAAAAAGTACCAAGAGGG - Intergenic
1191790304 X:64964681-64964703 AAAAGGAAAATGATAGCAGAGGG + Intronic
1192297015 X:69861123-69861145 AAGAAGAAAATGATCCCAGAAGG + Intronic
1193435148 X:81465733-81465755 AGAAGGAAAATGATCTCAGATGG - Intergenic
1193607164 X:83583211-83583233 AAAGGAAATTTGAACCCACAGGG - Intergenic
1194490501 X:94540951-94540973 AAAAGTAAATTTAACCAAGATGG + Intergenic
1194928138 X:99852633-99852655 TGAAGGAAAGTGATCCCAGAAGG - Intergenic
1195098599 X:101530808-101530830 TAAAGGAAAATGATACCAGAGGG + Intronic
1196491909 X:116277519-116277541 AAAAGGAAATGCAATCCATATGG - Intergenic
1197041595 X:121943162-121943184 AAAAGCAAAGTAAACCCAAAAGG - Intergenic
1197929870 X:131683141-131683163 AAATGCAAATTGAAACCATAAGG - Intergenic
1199194505 X:145011829-145011851 AGAAGGAAATTAAATACAGAAGG + Intergenic
1199229909 X:145424661-145424683 AAATGCAAATTGAAACCACAAGG + Intergenic
1199836254 X:151594768-151594790 AGAAGGAAAATGATCCCAGGTGG - Intronic
1199916242 X:152344229-152344251 AAAAGGAAACAGAAGCCAAATGG + Intronic
1202127569 Y:21581899-21581921 AAAAGGAAATGGCTCCCAGCAGG - Intergenic