ID: 922143784

View in Genome Browser
Species Human (GRCh38)
Location 1:222917874-222917896
Sequence CCTATTTGGTAGTTGATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922143784 Original CRISPR CCTATTTGGTAGTTGATCCA AGG Intronic
904469688 1:30728684-30728706 CTTATTTGGGAGGTGATCCCAGG - Intergenic
906884728 1:49631945-49631967 CGAATGTGGTAGTGGATCCAGGG + Intronic
907881783 1:58556341-58556363 CTTATTTGGGAGGTGATCCTAGG + Intergenic
910465979 1:87500523-87500545 TCTATTTGGAAGGTGATCCCAGG - Intergenic
911392133 1:97258556-97258578 CCTATTTGGGAGTTGATCTTGGG - Intronic
917022677 1:170607274-170607296 CATTTATGGTAATTGATCCATGG + Intergenic
922143784 1:222917874-222917896 CCTATTTGGTAGTTGATCCAAGG + Intronic
1063109316 10:3020823-3020845 CCTCTTTGGAAGGTGATCCTGGG - Intergenic
1070453570 10:76586623-76586645 CCTATTTGTTTGTTGGTCCTTGG + Intergenic
1078306473 11:10192964-10192986 TCTATCTGGTGGTGGATCCATGG - Intronic
1079246220 11:18754197-18754219 CCGAGTTGGAAGTTGAGCCAAGG + Intronic
1093635518 12:21462559-21462581 CTTAGTTGGAATTTGATCCATGG + Intronic
1094102035 12:26775083-26775105 TCTATTTGGGAGGTGATCCCAGG - Intronic
1098361836 12:69661833-69661855 CCTATCTGGTCATTGAACCAAGG + Intronic
1101046710 12:100814104-100814126 CCTATTTGGTAGAGGAATCATGG - Intronic
1104252093 12:127104828-127104850 TCTATTTTGTTGATGATCCAAGG - Intergenic
1107927583 13:45278225-45278247 CCAATTAGGATGTTGATCCATGG + Intronic
1112917497 13:104569565-104569587 CCTACATGGTAGTGGGTCCATGG - Intergenic
1114658333 14:24329401-24329423 CCTATCTGGTCATCGATCCACGG - Exonic
1116839793 14:49808345-49808367 CATATTTTTTAGTTGATACAGGG + Intronic
1120853928 14:89196584-89196606 CCCATTTGGTAGGTGTTCCTTGG - Intronic
1120927968 14:89816985-89817007 CCTACTTGGTAATTAAACCAAGG + Intronic
1121467142 14:94123252-94123274 CTTATTTGGGAGGTGATCCCAGG + Intergenic
1127600599 15:60532707-60532729 TCTATTTAATAGTTGATCTAAGG - Intronic
1141865722 16:86748642-86748664 CATATTTGGGAGGTGATCCCTGG + Intergenic
1146560445 17:33864415-33864437 CCTATTTGGCAGGTGAAACAGGG + Intronic
1147056859 17:37841417-37841439 CTTATTTGGGAGGTGATCCCCGG + Intergenic
1150969229 17:70008923-70008945 GCTATTTTTTATTTGATCCATGG + Intergenic
1157148467 18:45190569-45190591 CCAATTTGGTTTTTGATTCAGGG - Intergenic
1157414890 18:47493983-47494005 TTTATTTGGGAGGTGATCCAAGG - Intergenic
925600317 2:5602327-5602349 CTTATTTGGGAGTTGATCCCAGG + Intergenic
927482537 2:23465642-23465664 TTTCTTTGGGAGTTGATCCAAGG - Intronic
928853271 2:35774224-35774246 CCCATATGGTAGTTGACCAATGG - Intergenic
933087308 2:78071659-78071681 CTTATTTTGTAGCTGATTCAGGG - Intergenic
940404052 2:153280830-153280852 TATATTTGGTAGTTGATGGATGG + Intergenic
942067399 2:172284610-172284632 CCTATTTGGCAGTTGACCATTGG + Intergenic
943075977 2:183195686-183195708 CCTAGTTCCAAGTTGATCCAAGG + Intergenic
947029263 2:225774506-225774528 CCTATATGGTAGAAGAACCAAGG + Intergenic
947766234 2:232639566-232639588 CCTATATACTAGTTGGTCCAGGG - Intronic
1168845274 20:940267-940289 CCTCTTTGGTATTTGGTGCATGG + Intergenic
1170010286 20:11715207-11715229 GATATTTGGTATTTCATCCAAGG - Intergenic
1170957079 20:20991364-20991386 CTTACTTGGTAGGTGATCCCAGG + Intergenic
1172234512 20:33361501-33361523 TCTATTTGGTAGTGGATTCCAGG - Intronic
1172636099 20:36410944-36410966 TCTATTTGGGAGGTGATCCCAGG - Intronic
1173025958 20:39307625-39307647 CCTATTTGGTATTTATACCAAGG - Intergenic
1185013037 22:48326715-48326737 TCTATTTGGACTTTGATCCAAGG - Intergenic
950940064 3:16883974-16883996 CCTACTTGGTAGTTGCCCCTCGG + Intronic
951703476 3:25520823-25520845 CCTTTTTGGTAGTTTATTAAAGG - Intronic
951950806 3:28198559-28198581 CTTATTTGGGAGGTGATCCCGGG - Intergenic
956136248 3:66101824-66101846 CCTAATTGGTACTTCCTCCAAGG + Intergenic
956453636 3:69399194-69399216 CCTATTTGGTACTTCGTTCATGG + Intronic
960239221 3:115320628-115320650 CTTATTTGGGAGTTGATCAGAGG + Intergenic
966252657 3:177884101-177884123 CACATTTGGTAGTTGATGAAAGG - Intergenic
967371813 3:188755322-188755344 CCATTTTGGGAGTTGATGCATGG - Intronic
967495515 3:190140097-190140119 CATATTTGGAAGGTGATCCCAGG - Intergenic
969709824 4:8836288-8836310 CTTATTTGGCAGATGATCCCAGG - Intergenic
973005690 4:45003330-45003352 CTTCTTTGGTGGTGGATCCATGG + Intergenic
975202160 4:71604338-71604360 TCTATTTAATAGTTGAACCAAGG - Intergenic
983797073 4:171877399-171877421 CCTATGTGGTAGCTGATTTATGG - Intronic
985418487 4:189760428-189760450 CTGATTTGGTAGCTGATCCTTGG - Intergenic
986296707 5:6445514-6445536 CCTTTTTAAGAGTTGATCCAAGG + Intergenic
987787539 5:22521472-22521494 CTTATCTGGAAGTTGATTCAGGG - Intronic
988331584 5:29848693-29848715 CCTCTTTGGTGGTTCATCCTTGG + Intergenic
989115523 5:37948895-37948917 TTTATTTGGTAGGTGATCCCAGG + Intergenic
1006574808 6:35037434-35037456 CTTATTTGGGAGGTGATCCCAGG + Intronic
1009616043 6:66008901-66008923 CCTATTTTGTATTTTATTCATGG + Intergenic
1012260181 6:97079498-97079520 CGTATTTGGTAGTTAATCTGGGG + Intronic
1012770938 6:103434968-103434990 ACCATTTAGTAGTTGATCTATGG + Intergenic
1014649164 6:124014241-124014263 CCTAGGTGGTAGTATATCCATGG - Intronic
1016096159 6:140040332-140040354 CCTATTTTGTAGTTAATTCATGG + Intergenic
1016685989 6:146882858-146882880 TTTATTTGGAAGTTGACCCAGGG - Intergenic
1022417748 7:30192373-30192395 TCTATTTGGGAGGTGATCCCAGG - Intergenic
1023395529 7:39748387-39748409 CTTATTGGGCACTTGATCCAAGG - Intergenic
1023461165 7:40398568-40398590 CCTATTTGATACATGATCCCGGG - Intronic
1024093979 7:45969951-45969973 ACTATTTGGTGATTGATACAAGG - Intergenic
1026534375 7:71228036-71228058 CCAGTTTGGTGTTTGATCCAGGG + Intronic
1028500689 7:91515982-91516004 ACTATTTGGGGTTTGATCCATGG - Intergenic
1033238147 7:139654821-139654843 AATATTGGGTAGGTGATCCAAGG - Intronic
1035844165 8:2845187-2845209 CCTATTTTATAGTCGATGCATGG + Intergenic
1047282936 8:123461360-123461382 TTTATTTGGTAGGTGATCCTAGG - Intronic
1049741959 8:144245165-144245187 CCTCTTGGGGACTTGATCCATGG - Exonic
1050030952 9:1384772-1384794 CCTCTTTGGAAGGTGATACACGG + Intergenic
1052546472 9:29887214-29887236 CCTTTTTGGTGTATGATCCAAGG + Intergenic
1053462553 9:38281858-38281880 CCTATTTTGTAGCTGAAGCACGG + Intergenic
1055857683 9:80710371-80710393 TTTATTTGGGAGTTGATCCCAGG - Intergenic
1056179901 9:84072556-84072578 TCTTTTTAGTAGTTGATCTAGGG + Intergenic
1057372904 9:94490159-94490181 CCTATTAGGTAGTAGATTCCTGG + Intergenic
1059807637 9:117820941-117820963 CCTATTTAGTACTTGTTACATGG - Intergenic
1187283425 X:17880556-17880578 CCTATTTGGGAGGTGATTCCAGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1189604934 X:42667027-42667049 CCTGTTTGGGAGTTTATCAAAGG - Intergenic
1189662615 X:43318098-43318120 TTTATTTGGGAGTTGATCCCTGG - Intergenic
1194512984 X:94818186-94818208 CCTATTGAGAACTTGATCCAAGG - Intergenic
1201477579 Y:14399779-14399801 TATATTTGTTAGTTGACCCATGG - Intergenic
1201955653 Y:19619574-19619596 CCTATTTGCCAGTTGTCCCAGGG - Intergenic