ID: 922145617

View in Genome Browser
Species Human (GRCh38)
Location 1:222940785-222940807
Sequence ACTGAGGTACAGGTGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 1, 2: 1, 3: 55, 4: 632}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922145610_922145617 8 Left 922145610 1:222940754-222940776 CCAGCAGATTCCCATCAGCTGTG 0: 1
1: 0
2: 3
3: 20
4: 189
Right 922145617 1:222940785-222940807 ACTGAGGTACAGGTGGAGGTTGG 0: 1
1: 1
2: 1
3: 55
4: 632
922145612_922145617 -3 Left 922145612 1:222940765-222940787 CCATCAGCTGTGATAGTTTAACT 0: 1
1: 0
2: 0
3: 21
4: 184
Right 922145617 1:222940785-222940807 ACTGAGGTACAGGTGGAGGTTGG 0: 1
1: 1
2: 1
3: 55
4: 632
922145611_922145617 -2 Left 922145611 1:222940764-222940786 CCCATCAGCTGTGATAGTTTAAC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 922145617 1:222940785-222940807 ACTGAGGTACAGGTGGAGGTTGG 0: 1
1: 1
2: 1
3: 55
4: 632
922145607_922145617 18 Left 922145607 1:222940744-222940766 CCCATTTAGCCCAGCAGATTCCC 0: 1
1: 0
2: 0
3: 4
4: 125
Right 922145617 1:222940785-222940807 ACTGAGGTACAGGTGGAGGTTGG 0: 1
1: 1
2: 1
3: 55
4: 632
922145608_922145617 17 Left 922145608 1:222940745-222940767 CCATTTAGCCCAGCAGATTCCCA 0: 1
1: 0
2: 2
3: 13
4: 201
Right 922145617 1:222940785-222940807 ACTGAGGTACAGGTGGAGGTTGG 0: 1
1: 1
2: 1
3: 55
4: 632
922145609_922145617 9 Left 922145609 1:222940753-222940775 CCCAGCAGATTCCCATCAGCTGT 0: 1
1: 1
2: 1
3: 15
4: 172
Right 922145617 1:222940785-222940807 ACTGAGGTACAGGTGGAGGTTGG 0: 1
1: 1
2: 1
3: 55
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922145617 Original CRISPR ACTGAGGTACAGGTGGAGGT TGG Intronic
900135348 1:1114992-1115014 ACTGGGGTACAGGTGGTGTTTGG - Intronic
900421895 1:2559365-2559387 CTTCAGGTACTGGTGGAGGTGGG - Intronic
900507760 1:3038254-3038276 ACTGATGTGCAGACGGAGGTAGG - Intergenic
901143156 1:7048634-7048656 GCTCAGGGACAGGTGGTGGTGGG - Intronic
901594110 1:10371207-10371229 AGAGAGGGACAGGTGGAGGAGGG - Exonic
901780438 1:11590636-11590658 AATGAGGTGCAGGTGGAAGTGGG + Intergenic
902711629 1:18243896-18243918 ACAGAGGAAGAGGTGGAGGCAGG - Intronic
903195764 1:21686743-21686765 TCTGAGGTCCAGGTGGAGATGGG + Intronic
903283128 1:22261549-22261571 GCTGAGGGACAGGAGGTGGTGGG + Intergenic
905496296 1:38390724-38390746 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
906053402 1:42893989-42894011 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
906152929 1:43598449-43598471 ATGGGGGAACAGGTGGAGGTGGG - Intronic
906805398 1:48775740-48775762 ACTGAGGTTCAGTTGGTGATAGG - Intronic
907725276 1:57015005-57015027 TCTGAGGTACAGGTGAGGGAGGG + Exonic
908936662 1:69384342-69384364 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
909044273 1:70690341-70690363 ACTGAGTAACAGATAGAGGTTGG + Intergenic
909360705 1:74756252-74756274 ACTGGGTAACAGGTAGAGGTTGG + Intronic
909600835 1:77459407-77459429 ACTGGGGTAGTGGTGGTGGTGGG - Intronic
909718444 1:78738735-78738757 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
909834117 1:80231985-80232007 ACTGAGTAATAGGTGGAAGTTGG - Intergenic
910457119 1:87409938-87409960 ACTGAGGTACATTTGGAAGATGG + Intergenic
910628791 1:89336365-89336387 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
910728896 1:90369294-90369316 ACTGAGGTACAATGGAAGGTAGG + Intergenic
911081265 1:93933696-93933718 ACTGGGGTACAGGTGGTGTTTGG - Intergenic
911474928 1:98362702-98362724 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
912579241 1:110705350-110705372 ACTGGGTAACAGGCGGAGGTTGG - Intergenic
912735826 1:112148743-112148765 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
913101625 1:115572967-115572989 ACTGGGTAACAGGTGGAGGCTGG + Intergenic
913152524 1:116059072-116059094 ATTGAGGTACAGGTGGTATTTGG - Intronic
913295979 1:117320908-117320930 ACTGAGGGGCAGGAGAAGGTTGG - Intergenic
913313031 1:117522148-117522170 ACTGGGGTACAGGTGGTATTTGG - Intronic
913316714 1:117559798-117559820 ACTGCGTAACAGGTAGAGGTTGG - Intergenic
914196422 1:145450353-145450375 AATGATGAACAGGTGGAGGGAGG + Intergenic
914437955 1:147676891-147676913 ACAGAGGGACAGAGGGAGGTGGG + Intergenic
914910750 1:151784142-151784164 ATTTAGGCACAGGTGGAGGAAGG - Intronic
914986043 1:152457888-152457910 ACTGAGGTAGGGCTGGAGGGGGG + Intergenic
916027452 1:160846080-160846102 ATTGGGGTACAGGTGGTGTTTGG + Intronic
917261495 1:173174336-173174358 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
917396779 1:174602080-174602102 ACTGGGTAACAGGTAGAGGTTGG - Intronic
917897930 1:179510770-179510792 ACTGGGGTACAGGTGGTGTTTGG + Intronic
917900898 1:179542331-179542353 GCTGAGGGGCAGGTGGAGATAGG - Intronic
918012004 1:180595596-180595618 ACTGAGGCACAGGTGGGAATTGG + Intergenic
918287995 1:183077435-183077457 ATTGGGGTACAGGTGGTGTTTGG + Intronic
918450708 1:184655091-184655113 ACTGAGATGCAAGTGGAGGTGGG + Intergenic
918663061 1:187113647-187113669 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
919292028 1:195644471-195644493 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
919598678 1:199595840-199595862 ACTGGGGTACAGGTGGTATTTGG - Intergenic
920597831 1:207291058-207291080 ACTGGGTAACAGGCGGAGGTTGG + Intergenic
921424255 1:214984127-214984149 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
922145617 1:222940785-222940807 ACTGAGGTACAGGTGGAGGTTGG + Intronic
922199218 1:223387598-223387620 AGTGAGGAAAAAGTGGAGGTGGG + Intergenic
922610355 1:226922313-226922335 ACTGAGTAACAGGCAGAGGTTGG + Intronic
922658498 1:227407540-227407562 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
923627365 1:235625004-235625026 ACTGAGGTGCTGGTGGATGCGGG + Intronic
923996821 1:239505029-239505051 ATTGAGGTACAGGTGGTATTTGG - Intronic
924482630 1:244451300-244451322 ACTGAGGCCGGGGTGGAGGTGGG - Intronic
924676564 1:246184472-246184494 TCTGAGGTACAGATTGAGGATGG - Intronic
1062893743 10:1087014-1087036 ACAGAGGGACAGGTGTGGGTGGG + Intronic
1063650148 10:7927507-7927529 ACTGAGATACTGGTGGAGGAGGG - Intronic
1063661341 10:8036649-8036671 ACTGGGGTTCAGCTGGAGGTGGG + Intergenic
1063866044 10:10366831-10366853 AGTGAGGAGCAGGTGGAGGAAGG - Intergenic
1064902733 10:20312300-20312322 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
1065628803 10:27657212-27657234 ATTGAGGAACAGGTGGTGTTTGG - Intergenic
1065862822 10:29886057-29886079 CCTGAGATGCAGGTGGATGTGGG + Intergenic
1066347026 10:34597712-34597734 GCTGGGGTACACGTGGAGATCGG + Intronic
1066393179 10:34995191-34995213 ACTGAGGTAAGGGTGGTGCTCGG + Intergenic
1068073454 10:52224472-52224494 ACTGAGGTTCAGGTGGTATTTGG + Intronic
1068229936 10:54158093-54158115 ACTGAGTAACAGGCAGAGGTTGG - Intronic
1068760245 10:60699244-60699266 ACTGGGGTACAGATGGTGTTTGG - Intronic
1069663635 10:70140077-70140099 GCTGAAGTTCAGGTGGGGGTAGG + Exonic
1069698579 10:70405405-70405427 ACTGGGGTAGAGGTGAAGCTTGG + Intronic
1070484745 10:76919275-76919297 ATTGGGGTACAGGTGGTGTTTGG - Intronic
1071023685 10:81087164-81087186 ACTGGGGAACAGGTGGTGCTTGG + Intergenic
1072647491 10:97268373-97268395 ACTGAGTAACAGGCAGAGGTTGG - Intronic
1073930971 10:108576342-108576364 TCTGAGGTACATGAGGAGGATGG + Intergenic
1074876388 10:117616788-117616810 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
1076021852 10:127080416-127080438 CCTGGGGTACAGGAGGGGGTCGG - Intronic
1076239847 10:128896329-128896351 ACTGAGGTTCTGGTGGAAGGTGG - Intergenic
1076854438 10:133108989-133109011 ACTGATGGACGGGTGGAGCTGGG - Intronic
1077506121 11:2930706-2930728 CCTGAAGGGCAGGTGGAGGTAGG - Intergenic
1077919994 11:6634447-6634469 GGTGAGGTACAGGCTGAGGTTGG - Intronic
1078687328 11:13545706-13545728 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
1079114155 11:17630008-17630030 ACCGGGGTGCAGGTGGAGGATGG - Intronic
1079182044 11:18202321-18202343 ACTGGGTTACAGGCAGAGGTTGG - Intronic
1079269578 11:18971784-18971806 CCTGAGGTGAAGGTGGAGGGCGG - Intergenic
1080232615 11:30034889-30034911 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
1080341834 11:31273645-31273667 ACTGAGTAACAGTTAGAGGTTGG - Intronic
1080672025 11:34389032-34389054 ATTGAGGTACAGGTGGTATTTGG + Intergenic
1080717691 11:34819717-34819739 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
1081603986 11:44515385-44515407 ACAGAGGGACAGCTGGAGGGAGG - Intergenic
1081710307 11:45211857-45211879 ATTGGGGTACAGGTGGTGTTTGG - Intronic
1081747514 11:45483384-45483406 ACAGAGGGACAGGATGAGGTGGG + Intergenic
1083623164 11:64058897-64058919 ACCCAGGCACAGCTGGAGGTGGG + Intronic
1084087394 11:66860839-66860861 ACTAAGCAACAGGAGGAGGTGGG + Intronic
1084417532 11:69042040-69042062 ACAGAGGTACAGATGGGTGTGGG + Intergenic
1084880579 11:72168635-72168657 ACTGGGGAACAGGCAGAGGTTGG + Intergenic
1085024124 11:73226693-73226715 CCTGAGGTGCTGGTGGAGGGTGG + Intronic
1085471607 11:76761937-76761959 CCTGAGGTGCATGGGGAGGTAGG - Intergenic
1086185054 11:84003305-84003327 ACTGAGTAACAGGCAGAGGTTGG - Intronic
1087170834 11:95049135-95049157 ACAGAGCTGCAGGTGGAGCTGGG + Intergenic
1087474432 11:98618839-98618861 ACTGATGAACAGGCAGAGGTTGG - Intergenic
1087829667 11:102805741-102805763 ACTGGGGAACAGGTGGTGTTTGG - Intergenic
1087884772 11:103466572-103466594 AGTAAGGAAAAGGTGGAGGTGGG + Intronic
1088101987 11:106166035-106166057 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
1088916001 11:114228434-114228456 ACTGAATTTCAGTTGGAGGTTGG + Intronic
1089175804 11:116547972-116547994 AGGGAGGCACAGGTGGAGGGAGG - Intergenic
1089937531 11:122379669-122379691 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
1090243585 11:125200595-125200617 ACGGAGGGCCAGGGGGAGGTTGG - Intronic
1090276631 11:125424642-125424664 ACTGAGGTGCTGGTGGAGCGGGG - Intronic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1090727483 11:129540802-129540824 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
1092093717 12:5824642-5824664 ACTGGGTAACAGGTGGAGGTTGG - Intronic
1092436839 12:8454807-8454829 ATTGAGGTACAGGTGGTATTTGG - Intergenic
1092715331 12:11383437-11383459 ATTGAGGAACAGGTGGTGTTTGG + Intronic
1093952127 12:25175078-25175100 ATTGAGGTACAGGTGGTATTTGG - Intronic
1094133227 12:27097429-27097451 TTTGAAGTACAGGTGGAGCTGGG - Intergenic
1094773193 12:33690115-33690137 TCAGAGGTACACGTGTAGGTTGG - Intergenic
1096574442 12:52544056-52544078 ACTGAGCTAGATGTGGGGGTGGG + Exonic
1096709686 12:53446165-53446187 GGTGAGGCTCAGGTGGAGGTAGG - Exonic
1096749118 12:53747611-53747633 ACTGAGTTACTGGGGGTGGTGGG + Intergenic
1096886979 12:54727902-54727924 ACTGGGTAACAGGAGGAGGTTGG - Intergenic
1096888094 12:54737952-54737974 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1096960353 12:55570809-55570831 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
1097342192 12:58451646-58451668 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1098197125 12:68013814-68013836 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1098743261 12:74201368-74201390 ACTGGGTAACAGATGGAGGTTGG - Intergenic
1099014767 12:77331122-77331144 ACTGGGGAACAGGTGGTGTTTGG - Intergenic
1099687125 12:85904670-85904692 ATTGGGGTACAGGTGGCGTTTGG + Intergenic
1099858843 12:88204288-88204310 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
1100363146 12:93896107-93896129 ACTGAGCTATAGGTGGAGGCAGG + Intergenic
1100696746 12:97102295-97102317 ACTGGGGAACAGGTGGTGTTTGG + Intergenic
1101117928 12:101550051-101550073 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
1101576046 12:105997402-105997424 ATTGAGGTACAGGTGGTATTTGG - Intergenic
1101940022 12:109093002-109093024 TCTGATGCACAGGTGGACGTGGG - Intronic
1102482950 12:113236460-113236482 ACTTAGGAAGAGGTGGAGTTTGG + Intronic
1103984033 12:124755268-124755290 ACTGAGGTCCAGATGGACGTGGG - Intergenic
1104647406 12:130506984-130507006 ACTGAGGCTGTGGTGGAGGTGGG - Intronic
1104808154 12:131602736-131602758 ACTGGATGACAGGTGGAGGTTGG - Intergenic
1105416660 13:20219131-20219153 ATTGATGGGCAGGTGGAGGTGGG + Intergenic
1106038073 13:26063347-26063369 ACTGGGGGGCAGGTGGGGGTGGG + Intergenic
1107957539 13:45531154-45531176 ACTGGGGTACAGGTGGTATTTGG + Intronic
1108313624 13:49218476-49218498 ACTGAAGTGGAGGTGGAGGAAGG + Intergenic
1108547414 13:51509682-51509704 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1108906858 13:55486645-55486667 ATTGAGGAACAGGTGGTGTTTGG - Intergenic
1109416756 13:62050916-62050938 ACTGAGTCACAGGCAGAGGTTGG + Intergenic
1109494302 13:63147721-63147743 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
1109859460 13:68178773-68178795 ACTGGGTTACAGGCAGAGGTTGG + Intergenic
1110008714 13:70305257-70305279 ACTGGGTAACAGGTGGAGGTTGG + Intergenic
1110342068 13:74403323-74403345 ACTGGGTAACAGGTGGAGGTTGG - Intergenic
1110793734 13:79613428-79613450 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
1111988927 13:95095656-95095678 ACTGAGGTACAGGTGGTATTTGG - Intronic
1112443947 13:99446432-99446454 ACTGACCACCAGGTGGAGGTGGG - Intergenic
1113826271 13:113256524-113256546 AGCGAAGGACAGGTGGAGGTGGG - Intronic
1114347974 14:21817156-21817178 ACTGTGTAACAGTTGGAGGTTGG - Intergenic
1114942053 14:27624577-27624599 ACTGGGGAACAGGCAGAGGTTGG - Intergenic
1115007250 14:28500030-28500052 ACTGGGGAACAGGCAGAGGTCGG - Intergenic
1115762737 14:36591445-36591467 ACGGAGGCACAGAGGGAGGTTGG + Intergenic
1115959181 14:38815797-38815819 ATTGAGGTACAGGTGGTGTTTGG - Intergenic
1116048502 14:39774883-39774905 ACTGGGGTACAGGTGGTGTTTGG + Intergenic
1116223845 14:42122157-42122179 ACTGGGGTACAGGTGGTGTTTGG - Intergenic
1116303607 14:43218342-43218364 ACTGAGTAACAGGAAGAGGTTGG - Intergenic
1116539077 14:46075448-46075470 TCTGGGGTACAGGTGCAGGTTGG + Intergenic
1117113266 14:52481314-52481336 ACTGGGGAACAGGTGGTGTTTGG - Intronic
1117677531 14:58170141-58170163 CCTGTGGTGGAGGTGGAGGTGGG - Intronic
1117739713 14:58804420-58804442 ACTGAGGTGAATGTGGAGCTTGG + Intergenic
1118239500 14:64042892-64042914 ACTGGGTAACAGGTAGAGGTTGG + Intronic
1118527437 14:66661763-66661785 ACTGAGTTCGAGGGGGAGGTGGG + Intronic
1118816281 14:69316542-69316564 ACAGAGTTACATGTGGTGGTTGG + Intronic
1119379839 14:74221586-74221608 ACTGAGGGACAGATGGAGTTTGG - Intergenic
1119776055 14:77249484-77249506 ACAGTGGGGCAGGTGGAGGTGGG - Intronic
1120489962 14:85164927-85164949 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
1120692412 14:87607023-87607045 ACTGGGCAACAGGTAGAGGTTGG - Intergenic
1120979377 14:90277122-90277144 CCTGAGCTACAGGTGGCTGTAGG - Exonic
1121115457 14:91339763-91339785 GCTGAGGTTCTGGTGGGGGTGGG - Intronic
1121166416 14:91806331-91806353 ACTGAGTAACAGGCAGAGGTTGG + Intronic
1121635581 14:95451850-95451872 GCTGAGGGACACGTGGAGGCTGG + Intronic
1122056288 14:99100557-99100579 ACTCAGGTACAGGTGGTGCATGG - Intergenic
1124027641 15:25981713-25981735 ACTGAGGTACGGAAGGAGGGAGG + Intergenic
1124557633 15:30741970-30741992 ATTGGGGTACAGGTGGTGTTTGG - Intronic
1124671098 15:31640370-31640392 ATTGGGGTACAGGTGGTGTTTGG - Intronic
1124673610 15:31663697-31663719 ATTGGGGTACAGGTGGTGTTTGG + Intronic
1125477685 15:40058496-40058518 ACAGAGGGAGAGGTGGAGGAGGG + Intergenic
1126490737 15:49232972-49232994 ACTGGGTAACAGGTAGAGGTTGG - Intronic
1126543985 15:49852689-49852711 ACTGAGGAAAAGGTGGTGGTGGG - Intergenic
1126847172 15:52771681-52771703 ATTGAGGTACAGGTGGTGTTTGG + Intronic
1126849257 15:52787610-52787632 GCTGAGATGGAGGTGGAGGTGGG + Intronic
1127387463 15:58478051-58478073 ACTGAGCTATGGGGGGAGGTGGG - Intronic
1128415678 15:67443542-67443564 ACTGGGGTACAGGTGGTATTTGG - Intronic
1129389156 15:75211927-75211949 ACTCAGGGACTGGTGCAGGTAGG + Exonic
1129665260 15:77576071-77576093 ACTGAGGCACAGGGAGAGGAGGG - Intergenic
1130031270 15:80316720-80316742 ACTGAGGAACAGGTGGGTGAAGG - Intergenic
1130229616 15:82086770-82086792 AGTGTGGTGCAGGTGGTGGTGGG - Intergenic
1130386593 15:83417397-83417419 GCTGGGGAACAGGTGGAGGTGGG - Intergenic
1130748097 15:86677599-86677621 AGTGAGGGACAAATGGAGGTGGG - Intronic
1130780062 15:87027102-87027124 ATTGAGGAACAGGTGGTGTTTGG - Intronic
1130852291 15:87806332-87806354 ACTGGGGAACAGGTGGTGTTTGG + Intergenic
1132366649 15:101262541-101262563 CCTGAGCTGGAGGTGGAGGTGGG - Intergenic
1133027567 16:2995380-2995402 CCTGGGGGACAGATGGAGGTGGG - Intergenic
1133282284 16:4673577-4673599 ACAGAGGCACAGGTGGCGGCAGG - Exonic
1133653992 16:7841926-7841948 ACTAAGGTTCAGGTGGAAGAAGG - Intergenic
1133703696 16:8333306-8333328 ACTGAGTTATGGGTGGAGGGAGG - Intergenic
1135351417 16:21732360-21732382 ATTGGGGTACAGGTGGTGTTTGG + Intronic
1135449899 16:22548488-22548510 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1136642268 16:31576961-31576983 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
1137435366 16:48450202-48450224 TCTGAGGTACAGGTGGTTTTTGG - Intergenic
1137973439 16:53008970-53008992 ATTGAGGTACAGGTGGTGTTGGG - Intergenic
1138269808 16:55687457-55687479 AGTCAGGTGCAGGTAGAGGTGGG + Intronic
1138585020 16:57963954-57963976 AGTGAGCTTCAGGTGGAGGGCGG - Intronic
1138648362 16:58441858-58441880 ACTCAGGCACAGAGGGAGGTAGG + Intergenic
1139133763 16:64177577-64177599 ACTGGGTAACAGGCGGAGGTTGG + Intergenic
1140307143 16:73813743-73813765 TCTGAGGTACAGGAAGAGGAGGG - Intergenic
1141152698 16:81575214-81575236 ACTGAGGCACAGGAGAAGTTAGG + Intronic
1141272947 16:82557514-82557536 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
1141526093 16:84612898-84612920 ACTGAGGCACAGAGGGAGGGAGG + Intronic
1141556502 16:84839886-84839908 ACTGAGGTGGAGGTGGAGGTGGG + Intronic
1141596501 16:85100153-85100175 ACTGAAGAACAGATGGAGGGGGG + Exonic
1142754338 17:2006953-2006975 GCAGAGGTACAGGAAGAGGTTGG + Intronic
1142923188 17:3209058-3209080 ACTGGGGTACAGGTGGTATTTGG + Intergenic
1142927919 17:3257413-3257435 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1143082257 17:4390256-4390278 ACTGAGGTCCAGGGAGAGGGAGG + Intergenic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143943493 17:10568271-10568293 AGTGAGATACAGCTGGAAGTCGG - Intergenic
1146138281 17:30342389-30342411 CCAGAGGAACAGGTGTAGGTTGG - Intergenic
1146452847 17:32988410-32988432 ACTGAGTAACAGGCAGAGGTTGG - Intronic
1146512359 17:33461118-33461140 GCTGAGGAGCAGGTGGAAGTGGG - Intronic
1148804455 17:50257290-50257312 ACTGGGGCTCAGGTGGAGGAGGG + Intergenic
1148980058 17:51565659-51565681 AGTGAGGGACAGATGGAGATGGG - Intergenic
1149366616 17:55951776-55951798 ACTGGGCAACAGGTAGAGGTTGG + Intergenic
1149719089 17:58825139-58825161 ATTGAGGTACAGGTGGTATTTGG - Intronic
1150608509 17:66714402-66714424 CCTGAGGGCAAGGTGGAGGTAGG - Intronic
1150657007 17:67045817-67045839 ACAAAAGGACAGGTGGAGGTCGG - Intronic
1150987316 17:70213166-70213188 ACTGAGTAACAGGTAGAGATTGG + Intergenic
1151566983 17:74904228-74904250 ACTGAGGTTCAGGTGGGGGATGG - Intergenic
1151768551 17:76144957-76144979 ATTGATGTTCAGGTGGAGCTGGG - Exonic
1152501724 17:80715622-80715644 ATTGGGGTACAGGTGGTGTTTGG + Intronic
1152560365 17:81075637-81075659 GCTGGTGGACAGGTGGAGGTAGG - Intronic
1152574384 17:81133683-81133705 TCAGAGTTACAGCTGGAGGTGGG + Intronic
1152760692 17:82105696-82105718 AATGGGGTACAGGGGGAGGGAGG + Intronic
1153012090 18:548436-548458 ACTGGGTAACAGGCGGAGGTTGG - Intergenic
1155135463 18:22987280-22987302 AGTGGGGTACAGGGGAAGGTAGG + Intronic
1155724220 18:29059138-29059160 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
1155781103 18:29837234-29837256 ACTGAGTAACAGGTAGAGGCTGG + Intergenic
1155842984 18:30668964-30668986 ACTGGGTAACAGGTGGAGGTTGG - Intergenic
1156106082 18:33662902-33662924 TCTGAGGTACAGGAGAAGATAGG - Intronic
1156401161 18:36741844-36741866 ACTGAGGGCCAGATGGTGGTGGG + Intronic
1156892251 18:42204071-42204093 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
1157912138 18:51626223-51626245 ACTGAGGGACAGATGGATGGTGG + Intergenic
1157970850 18:52266896-52266918 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
1158206086 18:54994504-54994526 ATTGAGGTACAGGTGGTATTTGG + Intergenic
1158412517 18:57220796-57220818 ACTGAGCTCCAGGAGGAGGGAGG - Intergenic
1159555410 18:69940379-69940401 ACTGGGTAACAGGTAGAGGTTGG + Intronic
1159875316 18:73804184-73804206 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1159981552 18:74787258-74787280 ACTAAGGCACATGTGGAGATAGG + Intronic
1160203372 18:76813432-76813454 ACTGAGGGAGAGGCCGAGGTGGG - Intronic
1160279763 18:77477294-77477316 ATTGTGGTACAGGTGGTGTTTGG - Intergenic
1160599255 18:80000158-80000180 ACTGGGTAACAGGTAGAGGTCGG + Intronic
1160824412 19:1073026-1073048 ACTGAGGCAGAGGTGGAAGACGG - Intronic
1160935724 19:1593607-1593629 ACTAAGGTGCAGGGGGTGGTCGG - Intergenic
1161707486 19:5829004-5829026 AGTGAGGTCCAGGTGGACCTGGG + Intergenic
1161855586 19:6763021-6763043 ACTGAGTTTCAGATGGAGGTGGG + Intronic
1161877712 19:6924790-6924812 GCAGAGGTGCAGGTGGAGGTAGG - Exonic
1161974891 19:7602919-7602941 ATTGAGGGAGAGGTGGAGGGGGG + Intronic
1162495088 19:11019058-11019080 ACGGAGGTGCAGGCGGTGGTGGG + Intronic
1162600324 19:11663887-11663909 ACTGAAGTTGGGGTGGAGGTCGG + Intergenic
1163079081 19:14923609-14923631 ACTGGGGAACAGGTGGTGTTTGG + Intergenic
1164175058 19:22765450-22765472 ATTGAGGTACAAGTGGTGTTTGG - Intronic
1164298701 19:23938994-23939016 ATTGGGGTACAGGTGGTGTTTGG + Intronic
1164410500 19:28000841-28000863 AATGAGGTAGAGGAGGAGATTGG + Intergenic
1164782467 19:30904206-30904228 CCTGAGGGACAGGAGGAGGCCGG - Intergenic
1164865155 19:31598554-31598576 ACTGGGGTACAGGTGGTATTTGG + Intergenic
1164953918 19:32364359-32364381 GTTGAGGTACAGGTGGTGTTTGG + Intronic
1165259506 19:34599753-34599775 ACTGAGGAACAGGGGGAAGAGGG - Intronic
1165389431 19:35529785-35529807 ACTGAGAGAGGGGTGGAGGTGGG + Intergenic
1166011035 19:39943107-39943129 GGTGAGGCTCAGGTGGAGGTAGG + Intergenic
1166165032 19:40981459-40981481 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
1166170274 19:41023476-41023498 ACTGACATCCAGATGGAGGTGGG + Intergenic
1166318278 19:42001042-42001064 AGTTAGGTAAAGGGGGAGGTTGG - Intronic
1166718802 19:44985915-44985937 ACCGAGGTAGAGGTAGAGGCAGG - Intronic
1168469831 19:56630853-56630875 ATTGGGGTACAGGTGGAATTTGG - Intergenic
925239321 2:2309202-2309224 ACTGAAGTGCAGGTGGAGTATGG - Intronic
925239348 2:2309642-2309664 ACTGAAGTACAGGTGGAGTATGG - Intronic
925702793 2:6655605-6655627 ACTGAGGCCCAGATAGAGGTTGG + Intergenic
925822936 2:7818346-7818368 ATTGAGGAACAGGTGGTGTTTGG - Intergenic
926102816 2:10131227-10131249 TGTGAGGTACAGGCGGAAGTTGG + Exonic
926280693 2:11443375-11443397 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
926315044 2:11703415-11703437 ACTGAGGAACAGGTTAAGATTGG - Intronic
928175348 2:29029917-29029939 ATTGGGGAACAGGTGGTGGTTGG - Intronic
928418135 2:31113799-31113821 ACTCAGGCACAGAGGGAGGTGGG + Intronic
928927472 2:36594248-36594270 ACTGGGGAACAGGTAGAGATTGG - Intronic
929363824 2:41127218-41127240 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
930686333 2:54312472-54312494 ACTGAGGTACAGATGGAGGTAGG - Intergenic
931134247 2:59378306-59378328 ACATAGGTACAGGCGGTGGTGGG - Intergenic
931759062 2:65400521-65400543 ACTGGGGTACAGGTGGCATTTGG + Intronic
931801023 2:65757727-65757749 AATGGGTAACAGGTGGAGGTTGG - Intergenic
931949932 2:67350855-67350877 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
932132983 2:69204363-69204385 ACTGAGGGTCAGGTTGAGTTGGG - Intronic
932191788 2:69747117-69747139 AATGAGGTAGAGGTGGACATGGG - Intronic
932336975 2:70937231-70937253 ACAGAGGAACAGAGGGAGGTGGG - Intronic
932515587 2:72344927-72344949 ACAGAGGTTCAGATGGAGATGGG - Intronic
932750853 2:74370825-74370847 CCTGAGGAAGAAGTGGAGGTGGG + Exonic
935104451 2:100027046-100027068 ATTGGGGTACAGGTGGTGTTTGG - Intronic
935436758 2:103043971-103043993 ATTGGGGTACAGGTGGAATTTGG - Intergenic
935704152 2:105841412-105841434 ACAGATGTAGAGGTGTAGGTAGG + Intronic
935736594 2:106111321-106111343 ACTTAGTGACAGGGGGAGGTGGG + Intronic
936395083 2:112120546-112120568 TCTGAGGGACATGTGGAGGAGGG - Intergenic
936862461 2:117033645-117033667 ACTGGATAACAGGTGGAGGTTGG - Intergenic
936872262 2:117147003-117147025 ACTGGGGAACAGGCAGAGGTTGG - Intergenic
936897492 2:117445114-117445136 ACTGGGTTACAGGCAGAGGTTGG + Intergenic
937008826 2:118543367-118543389 ACTGGGTTACAGGCAGAGGTTGG + Intergenic
937025980 2:118697363-118697385 AGTGAGGCACAGGGGGAGGAAGG + Intergenic
939714384 2:145565393-145565415 CCTAAGACACAGGTGGAGGTAGG + Intergenic
939770047 2:146304392-146304414 ACTGGGGTACAGGTGGTATTTGG - Intergenic
940684768 2:156833183-156833205 TGTGTGGTGCAGGTGGAGGTGGG + Intergenic
940687034 2:156864671-156864693 ACTGAGGTCTGGGTGGAGGTGGG - Intergenic
940729885 2:157376403-157376425 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
941682725 2:168415930-168415952 ACTGGGTTACAGGCAGAGGTTGG - Intergenic
941697919 2:168573161-168573183 ACTGGGGTACAGGTGGTGTCTGG - Intronic
942283280 2:174389160-174389182 ACTGGGTAACAGGTGGAGGTTGG + Intronic
942380408 2:175385307-175385329 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
942434001 2:175951245-175951267 ACTGAGGAACAGGTGGTGTTCGG + Intronic
942444712 2:176070464-176070486 AATGAGGTGGAGGTGGGGGTGGG - Intergenic
942649908 2:178155473-178155495 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
943429724 2:187784160-187784182 ATTGAGGTACAGGTGGTATTTGG + Intergenic
943746992 2:191472332-191472354 ACGGAGGTACGGGTACAGGTAGG - Intergenic
943931247 2:193856445-193856467 ACTGGGGAACAGGTGGTGTTTGG - Intergenic
944863225 2:203835199-203835221 ACTGAGGTCCAGGATGAGGATGG - Intergenic
945077780 2:206057779-206057801 ATTGAGGTACAGGTGGTATTTGG - Intronic
945120896 2:206455968-206455990 ACTGGGTAACAGGCGGAGGTTGG - Intronic
945480686 2:210341939-210341961 ATTGAGGTACAAGTGGTGTTTGG + Intergenic
945643436 2:212460334-212460356 ACTGAGTTACAGGCAGAGGTTGG + Intronic
946133871 2:217629416-217629438 AATGAGGTCCAGGGGCAGGTGGG - Intronic
946285040 2:218696596-218696618 ACTGAGGTACAGATGGATCTTGG + Exonic
946715677 2:222552892-222552914 ATTGGGGAACAGGTGGTGGTTGG - Intronic
947881521 2:233518144-233518166 ATTGGGGTACAGGTGGTGTTTGG - Intronic
948205376 2:236160361-236160383 TCTGAGGTCCAGGTGGGGGTGGG + Intergenic
948677815 2:239609378-239609400 GCTGAGGGACAGGTGGATGAGGG + Intergenic
948842262 2:240658192-240658214 ACTGGGGAACAGGTGGTGTTTGG + Intergenic
1169119311 20:3085567-3085589 ACTAAGGTCCTGGTGGGGGTAGG - Intergenic
1169335535 20:4752875-4752897 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1169507231 20:6224554-6224576 AATGAGGTACAGGTGGTATTTGG - Intergenic
1170309973 20:14981902-14981924 ACTGGGTTACAGGCAGAGGTTGG + Intronic
1171159913 20:22912244-22912266 ATTGTGGTACAGGTGGTGTTGGG + Intergenic
1173177645 20:40776847-40776869 TCTGGGGCAGAGGTGGAGGTGGG - Intergenic
1173436296 20:43034911-43034933 GCTGAGGAAAAGGTGGGGGTGGG - Intronic
1174484992 20:50855512-50855534 CCAGAGATGCAGGTGGAGGTGGG - Intronic
1174950931 20:55040933-55040955 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
1175625607 20:60486215-60486237 ACTGGGGTACAGGTGGCGTTTGG + Intergenic
1175715131 20:61250500-61250522 ACTGGGGTCCAGGAGCAGGTGGG - Intergenic
1175867810 20:62190711-62190733 ACTGAGCTCCAGGTGGGGCTTGG - Intronic
1176672893 21:9751102-9751124 ACTGTGGAACTGGTGGAGCTGGG - Intergenic
1176699814 21:10032187-10032209 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
1177515583 21:22147421-22147443 ACTGGGTAACAGGAGGAGGTTGG + Intergenic
1177632667 21:23747241-23747263 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
1177998512 21:28132042-28132064 ATTGAGTAACAGGTAGAGGTTGG - Intergenic
1178173898 21:30075130-30075152 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
1178742728 21:35217668-35217690 CCTGAGGCACAAGTGCAGGTGGG + Intronic
1180153058 21:45962150-45962172 ACTGGGTTACAGGCAGAGGTTGG - Intergenic
1180251287 21:46591688-46591710 ACTGAGTAACAGGCTGAGGTTGG + Intergenic
1180823619 22:18848292-18848314 ACTGAGGTTCAGCTGGCAGTGGG - Exonic
1182641102 22:31768118-31768140 ACTGGGGAACAGGTGGTGTTTGG + Intronic
1182763218 22:32739652-32739674 CATGGGGTAGAGGTGGAGGTGGG - Intronic
1182887569 22:33788474-33788496 ACTGAGTAACAGGCAGAGGTTGG + Intronic
1182964180 22:34505982-34506004 ATTGAGGTACAGGTGGTATTTGG - Intergenic
1184311445 22:43647181-43647203 ACTGAGGTGGGGGTGGGGGTGGG + Intronic
1184338458 22:43870322-43870344 ACTGGGGAACAGGTGGTGTTTGG + Intergenic
1184440476 22:44509711-44509733 ACTGGGGAACAGGTGGTGTTTGG - Intergenic
1184802688 22:46771360-46771382 ACTGGGGAACAGGTGGTGTTTGG + Intronic
949547138 3:5081985-5082007 ACTGAGATAGGGCTGGAGGTGGG - Intergenic
950307243 3:11925417-11925439 ACTGAGGTACAGGGGGTGTGTGG + Intergenic
951053947 3:18125966-18125988 AATGAGGCAAAGGTGGAGGTGGG - Intronic
951146167 3:19229821-19229843 ACTGGGTTACAGGCAGAGGTTGG - Intronic
951446253 3:22783404-22783426 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
951772548 3:26274768-26274790 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
953389155 3:42524525-42524547 ACTGAGGGACAGCTAGGGGTGGG - Intronic
954436122 3:50497269-50497291 ACTGAGGCCCAGGGGGAGGAGGG + Intronic
954638332 3:52083712-52083734 ACTGAGCTCCAGGTGGAGTCAGG + Intronic
954654996 3:52188948-52188970 ATTGAGGTGCAGCTGCAGGTAGG + Intergenic
954660626 3:52224987-52225009 ACTGAGGCACTGATGGAGCTGGG - Intronic
954914379 3:54136320-54136342 ACTGAGGAAAAGGAGAAGGTTGG - Intronic
956062315 3:65360047-65360069 TCCGAGGTACAGGGGGAGGGTGG - Intronic
956817032 3:72917008-72917030 ACTGAGGTAAAGGATGAGGTGGG + Intronic
957160416 3:76602294-76602316 ACTGGGTAACAGGCGGAGGTTGG - Intronic
957759629 3:84538431-84538453 ACTGGGTTACAGGCAGAGGTTGG + Intergenic
958160932 3:89816163-89816185 CCTGAGTAACAGGTGGAGGTTGG - Intergenic
958637379 3:96762749-96762771 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
959004953 3:101009371-101009393 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
959222675 3:103541599-103541621 TTTGTGGGACAGGTGGAGGTGGG + Intergenic
959523473 3:107347449-107347471 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
959678756 3:109068232-109068254 ATTGGGGTACAGGTGGTGTTTGG + Intronic
960018825 3:112925647-112925669 ACTCTGGTGCAGGTGTAGGTGGG + Intronic
960255270 3:115505093-115505115 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
960334419 3:116398964-116398986 ACTGAGGAAAAGTTGGAGTTAGG + Intronic
960388459 3:117049943-117049965 ATTGGGGTACAGGTGGTGTTTGG - Intronic
961460161 3:127045122-127045144 GCTCAGGTGCAGGTGGAGGGTGG + Intergenic
962360515 3:134738734-134738756 ATTGGGGTACAGGTGGTGTTTGG - Intronic
962421688 3:135234472-135234494 ACTGAGTAACAGGCAGAGGTTGG - Intronic
962958729 3:140290512-140290534 AATGAGGAAAAGGAGGAGGTAGG + Intronic
963058211 3:141204861-141204883 AATGAGGTACAGGTACAGCTTGG - Intergenic
963418259 3:145026870-145026892 ACTGAGTAACAGGAAGAGGTTGG + Intergenic
963702027 3:148638445-148638467 ATTGGGGTACAGGTGGAATTTGG - Intergenic
963847643 3:150175811-150175833 ACTGGGGTACAGGTGGTGTTTGG - Intergenic
964275278 3:155003182-155003204 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
964418550 3:156476172-156476194 ATTGGGGTACAGGTGGTAGTTGG + Intronic
964427291 3:156567498-156567520 ACTGGGTAACAGGCGGAGGTTGG + Intergenic
964654458 3:159051356-159051378 ACTGGGTTACAGGCAGAGGTTGG + Intronic
965065942 3:163849064-163849086 ACTGGGGTACAGGTGGTATTTGG + Intergenic
965097042 3:164243408-164243430 ACTGGGGAACAGGTGGTGTTTGG + Intergenic
965931260 3:174045079-174045101 ACTGAGTAACAGGCAGAGGTTGG - Intronic
966991869 3:185240830-185240852 ATTGGGGTACAGGTGGTGTTTGG + Intronic
967505439 3:190247829-190247851 ATTGAGGTACAGGTGGTATTTGG + Intergenic
968755269 4:2412478-2412500 ACTGAGGCACAGGTGTGGGAGGG + Intronic
969237420 4:5875698-5875720 GGTGAGGAACAGGTGGGGGTTGG + Intronic
969523700 4:7693467-7693489 TCTGAGGAGCAGGTGGGGGTTGG - Intronic
969699364 4:8758503-8758525 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
969932137 4:10641156-10641178 CCTGAGGGACAGTTGGAGGGAGG + Intronic
970720182 4:18977904-18977926 ACTCAGTTACAGGTGGAAATTGG - Intergenic
970750520 4:19353793-19353815 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
970758240 4:19451712-19451734 ACTGGGTAACAGGTTGAGGTCGG - Intergenic
970773802 4:19648396-19648418 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
971022067 4:22546965-22546987 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
971119533 4:23688698-23688720 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
971260216 4:25050183-25050205 ATTCAGGTACATGTGCAGGTTGG - Intergenic
971643422 4:29164960-29164982 ACTCAGGTCCAGGTGGTAGTTGG + Intergenic
971649608 4:29255875-29255897 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
972013907 4:34220032-34220054 ACTGGGGTACAGGTGGTATTTGG - Intergenic
972100639 4:35410314-35410336 ACTATGTTACAGGTGGAAGTAGG - Intergenic
972220699 4:36950947-36950969 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
973552443 4:52049184-52049206 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
974083999 4:57240148-57240170 GCTGAGGTAAAGATGGGGGTTGG - Intergenic
974097488 4:57380382-57380404 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
974202128 4:58655978-58656000 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
974707531 4:65540821-65540843 TCTGAGGTAAAGGTGGGGATGGG - Intronic
975027444 4:69568580-69568602 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
975088565 4:70373133-70373155 ATTGGGGTACAGGTGGTGTTTGG + Intronic
975808775 4:78142100-78142122 ATTGAGGTACAGGTGGTATTTGG - Intronic
976011689 4:80496602-80496624 ACTGTGGAACAGGCAGAGGTTGG - Intronic
977033882 4:91924826-91924848 GCTGAGGGGCAGGTGGAGGGTGG + Intergenic
977549872 4:98429614-98429636 ACTGGGGAACAGGTGGTGTTTGG - Intronic
977953619 4:103001727-103001749 ACTGGGTAACAGGTAGAGGTGGG - Intronic
979146069 4:117250658-117250680 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
979327888 4:119400309-119400331 ACTGAGTAACAGGTAGAGGTTGG - Intergenic
979645382 4:123061230-123061252 ACTGAGTAACAGGTGAAGGTTGG - Intronic
980292347 4:130859667-130859689 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
980372226 4:131890797-131890819 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
981637839 4:146900488-146900510 ACTGAGGGAAAGGATGAGGTTGG - Intronic
981829552 4:148984614-148984636 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
981914250 4:150016311-150016333 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
982189252 4:152836813-152836835 ATTGAGGTACAGGTGGTATTTGG + Intronic
982218262 4:153101483-153101505 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
982750036 4:159149941-159149963 AAACAGGCACAGGTGGAGGTTGG + Intronic
982904385 4:161049360-161049382 ACTGAGAAACAGGCAGAGGTTGG - Intergenic
983245711 4:165284645-165284667 ACTGAGTAACAGGCAGAGGTTGG - Intronic
983544374 4:168947410-168947432 ACTGGGGTACAGGTGGTGTTTGG + Intronic
984517123 4:180754117-180754139 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
984638833 4:182142567-182142589 GTACAGGTACAGGTGGAGGTCGG + Intergenic
984882298 4:184420737-184420759 ACTGAGGTCCCTGTGGATGTGGG - Intronic
985401794 4:189600524-189600546 ACTGTGGAACTGGTGGAGCTGGG + Intergenic
986029350 5:3880874-3880896 ACAGAGGCACAGCTGGAGCTCGG + Intergenic
986537411 5:8805217-8805239 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
986852346 5:11828800-11828822 ACTGGGAAACAGGTAGAGGTTGG + Intronic
986867725 5:12009141-12009163 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
987509399 5:18816069-18816091 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
987642453 5:20629594-20629616 ACTGGGTAACAGGTGGAGGCTGG - Intergenic
987662357 5:20893821-20893843 ACTGGGTAACAGGCGGAGGTTGG + Intergenic
987984800 5:25133270-25133292 ACTGGGTAACAGGTGGAGGTTGG + Intergenic
988149869 5:27363920-27363942 ACTGGGAAACAGGTAGAGGTTGG + Intergenic
988772968 5:34450351-34450373 ACTGAGGATCAAGTGGAGTTTGG - Intergenic
989225465 5:39022616-39022638 GCTGGGGGACAGATGGAGGTGGG + Intronic
989515785 5:42340756-42340778 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
990647526 5:57861149-57861171 ACTGAGGCTAAGGTGGAGGTGGG + Intergenic
991515685 5:67432473-67432495 ACTGAAGTTCACATGGAGGTGGG - Intergenic
991528203 5:67587191-67587213 TCAGAGGTACATGTGCAGGTTGG + Intergenic
991552994 5:67863269-67863291 ACTGGGGAACAGGTGGTGTTTGG + Intergenic
991924379 5:71690020-71690042 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
991924585 5:71692375-71692397 ATTGGGGTACAGGTGGTGCTTGG - Intergenic
992125152 5:73632201-73632223 ACTGGGGTACAGGGGGAGGAGGG + Intronic
993575011 5:89590071-89590093 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
994325908 5:98444288-98444310 ACTGAGATACAGGTGCACTTTGG + Intergenic
994425818 5:99586017-99586039 TCTGAGGTACTGGGGTAGGTAGG - Intergenic
994489121 5:100419330-100419352 ACTGGGGCACAGAAGGAGGTGGG + Intergenic
994561285 5:101376474-101376496 ACTGGGGTACAGGTGGTATTTGG - Intergenic
994590482 5:101766420-101766442 TCTGAGGTACATGTGCAGGTTGG + Intergenic
994659011 5:102630956-102630978 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
995390875 5:111639293-111639315 ACTGAGTGTCAGGTAGAGGTTGG + Intergenic
995392508 5:111654191-111654213 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
995818260 5:116196462-116196484 ACTGGGGTACAGGTGGTATTCGG - Intronic
996032464 5:118721348-118721370 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
996101842 5:119452501-119452523 ACTGCGGGACAGGAGGAGGCGGG - Intronic
996229948 5:121050313-121050335 ACAGAGGTAGAAGTGGAGTTGGG - Intergenic
996246668 5:121272232-121272254 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
996774838 5:127121978-127122000 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
996909525 5:128639441-128639463 AATGAGGTAGAAGTGGAGGATGG + Intronic
997000669 5:129756349-129756371 ATTGAGGTACAGGTGGTATTTGG + Intronic
997030326 5:130120213-130120235 AATGAGGCACTGGAGGAGGTGGG - Intronic
997091641 5:130865164-130865186 AATGAAGTCCAGGTTGAGGTGGG - Intergenic
997623712 5:135317757-135317779 ATTGAGGGACAGGTGGGTGTGGG + Intronic
997778259 5:136630712-136630734 ACTGAGATCCATTTGGAGGTAGG + Intergenic
998093263 5:139383054-139383076 ACTGGGGGATGGGTGGAGGTGGG - Intronic
998776779 5:145612484-145612506 ATTGGGGTACAGGTGGTGTTTGG + Intronic
998813263 5:145987218-145987240 ATTGGGGTACAGGTGGTGTTTGG + Intronic
999051611 5:148529698-148529720 ACTGAGTAACAGGCAGAGGTTGG + Intronic
999446849 5:151646911-151646933 TCTGAGGGACAGATGGAAGTAGG + Intergenic
999484193 5:151978204-151978226 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
999526089 5:152407402-152407424 ACTGGGGTACAGGTGGTATTTGG + Intronic
1000575165 5:162967584-162967606 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
1000861645 5:166462863-166462885 ATTGGGGAACAGGTGGTGGTTGG + Intergenic
1002081247 5:176738899-176738921 ACTGTAGTACAGGCGGAGCTGGG + Intergenic
1002649246 5:180679681-180679703 GCTCGGGTACAGGGGGAGGTGGG + Intergenic
1003269486 6:4594698-4594720 ATTGAGGAACAGGTGGTGTTTGG + Intergenic
1003439938 6:6131028-6131050 TCTGAGGTACAGTAGAAGGTGGG + Intergenic
1003641672 6:7880412-7880434 ACGGAAGCACAGTTGGAGGTGGG + Exonic
1004195726 6:13502936-13502958 ACCCTGGTAGAGGTGGAGGTTGG + Intergenic
1004430130 6:15535726-15535748 ACTGGGTTACGGGTAGAGGTTGG + Intronic
1004620486 6:17326574-17326596 AGTGAGGGAGAGGTGGAGATGGG + Intergenic
1004711437 6:18174490-18174512 ATTGGGGTACAGGTGGTGTTTGG + Intronic
1004743081 6:18482081-18482103 ATAGAGGTACAGATGGAGGCAGG - Intergenic
1004791192 6:19028368-19028390 GGTGGGGGACAGGTGGAGGTGGG - Intergenic
1004853584 6:19726033-19726055 ATTGGGGTACAGGTGGAATTTGG - Intergenic
1005153497 6:22778666-22778688 ACTGGGTTACAGGTAGAGTTTGG + Intergenic
1005819413 6:29585263-29585285 CCTGATGTACAAGTGGAGGCTGG + Intronic
1005840553 6:29742331-29742353 ACTGAGCTGTAGGTGGAGGGCGG - Intergenic
1005869013 6:29959376-29959398 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
1007399179 6:41594031-41594053 ACTGAGGGACACGATGAGGTGGG + Intronic
1007775572 6:44222827-44222849 ACTGAGGCACAGGTGGGAATGGG - Intronic
1007891471 6:45297036-45297058 ATTGGGGTACAGGTGGTGTTTGG - Intronic
1008926019 6:56893028-56893050 ATTGAGGTACAGGTGGTATTTGG + Intronic
1009769244 6:68122930-68122952 ACTGAGTAACAGGAAGAGGTTGG - Intergenic
1010479389 6:76332360-76332382 ATTGAGGAACAGGTGGTGTTTGG + Intergenic
1011439273 6:87370108-87370130 ACTGGGGAACAGGCAGAGGTTGG - Intronic
1012225280 6:96696207-96696229 ACTGGGGAACAGGTGGTGTTTGG - Intergenic
1012343471 6:98156994-98157016 ACTGAGGTTGTGGTGGGGGTGGG - Intergenic
1012485815 6:99721839-99721861 AATGAGTAACAGGTAGAGGTTGG + Intergenic
1013213823 6:108009401-108009423 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
1014933494 6:127361231-127361253 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
1015662417 6:135590201-135590223 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
1016341034 6:143061302-143061324 ACTGGGGGACAAATGGAGGTGGG + Intronic
1016857599 6:148686692-148686714 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1016938767 6:149467791-149467813 CCTGAGGTATAGATGGAGTTGGG - Intronic
1017189978 6:151642738-151642760 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1017547647 6:155469070-155469092 ACTGGGTAACAGGTGGAGGCTGG - Intergenic
1018021770 6:159767794-159767816 GCTGAGGTTCAGGAGGAGGCAGG + Intronic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1019440289 7:1042516-1042538 ATTGTGGTTCAGGTGGAGGGTGG + Intronic
1020602025 7:10287876-10287898 ATTGAGGAACAGGTGGTGATAGG + Intergenic
1021044720 7:15908437-15908459 ACTGAAATACAGTTGGAAGTGGG - Intergenic
1021096235 7:16539052-16539074 ACTGAGTAACAGGCAGAGGTTGG + Intronic
1021753928 7:23832978-23833000 ACTGGGTAACAGGCGGAGGTTGG + Intergenic
1022657589 7:32334458-32334480 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1024111257 7:46148871-46148893 ACTGGGGTACAGGTGGTATTTGG + Intergenic
1024668772 7:51571560-51571582 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1024678102 7:51656114-51656136 ATCGAGGTCCAGGTGGAGGAAGG + Intergenic
1026443254 7:70461807-70461829 ACCTGGGGACAGGTGGAGGTGGG + Intronic
1026579338 7:71600787-71600809 ATTGGGGTACAGGTGGTGTTTGG + Intronic
1026739904 7:72972675-72972697 TCTGAGGTAAAGATGGAGGCTGG - Intergenic
1026797179 7:73373851-73373873 TCTGAGGTAAAGATGGAGGCTGG - Intergenic
1026833527 7:73623906-73623928 CCAGAGGTCCAGGTAGAGGTGGG + Intronic
1027103829 7:75392395-75392417 TCTGAGGTAAAGATGGAGGCTGG + Intergenic
1028770319 7:94612776-94612798 AAGGAGGAACAGGTGGAGGTGGG - Intronic
1028818827 7:95182137-95182159 ATTGGGGTACAGGTGGTGTTTGG - Intronic
1028835365 7:95368849-95368871 TTAGAGGTAGAGGTGGAGGTGGG - Intronic
1029976313 7:104837646-104837668 ATTGAGGAACAGGTGGTGTTTGG + Intronic
1030326270 7:108221834-108221856 ATTGGGGTACAGGTGGTGTTTGG - Intronic
1031282124 7:119818074-119818096 ACTGGGTAACAGGTGGAGGTTGG + Intergenic
1031787896 7:126058115-126058137 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
1031790226 7:126093221-126093243 ACTGGGTGACAGGTAGAGGTTGG - Intergenic
1032453943 7:132057638-132057660 ACTGGGTAACAGGTGGGGGTCGG + Intergenic
1033041689 7:137925093-137925115 CCTGGGGTTCAGGTGGAGGATGG + Intronic
1033760096 7:144428314-144428336 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
1034021016 7:147642199-147642221 CCTGGGGTAGGGGTGGAGGTGGG + Intronic
1034273994 7:149816183-149816205 ACTGGAGGACAGGTGGGGGTGGG - Intergenic
1034472090 7:151260622-151260644 ACTGAGGTCCAGGTAGGGGGCGG - Intronic
1034718469 7:153265224-153265246 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
1034921995 7:155091030-155091052 ACTGAGCTGAAGGTGGAGATGGG - Intergenic
1035675869 8:1455234-1455256 AGTCAGGTGCAGGTGCAGGTGGG + Intergenic
1035921025 8:3676320-3676342 TCTGAAGAGCAGGTGGAGGTGGG + Intronic
1036106562 8:5846893-5846915 ACTGAGTAACAGGAAGAGGTTGG - Intergenic
1037002641 8:13738950-13738972 ACTGAGGTAGAGGTAGAGTGAGG - Intergenic
1037315895 8:17599164-17599186 ATTGAGGTACAGGTGGCATTTGG + Intronic
1037642384 8:20758253-20758275 CCTGGGGAAAAGGTGGAGGTGGG - Intergenic
1037713265 8:21372971-21372993 ACTGAGGTACAGGTGGCATTTGG + Intergenic
1037957747 8:23071961-23071983 ACTGAGGTACAGGTAGGAGAAGG - Intergenic
1038014224 8:23499609-23499631 AGTCAGGGGCAGGTGGAGGTGGG + Intergenic
1038237576 8:25775145-25775167 ACTGAGGTACAGGTGGTATTTGG - Intergenic
1038547702 8:28438480-28438502 GCTGAGAGACAGGTGGAGGAGGG - Intronic
1039810008 8:41038390-41038412 ACTGGGGAACAGGTGGTGTTTGG + Intergenic
1040336561 8:46418995-46419017 ACTCAGGTTCAGGTTGAGGTGGG + Intergenic
1040899309 8:52402369-52402391 TCTGAGGCACAGGTGGATGCAGG + Intronic
1041756987 8:61324573-61324595 ACTGAGTAGCAGGTAGAGGTTGG + Intronic
1041985471 8:63917497-63917519 ATTGAGGAACAGGTGGTGTTTGG + Intergenic
1043336387 8:79181529-79181551 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
1043627984 8:82288357-82288379 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1043644255 8:82498080-82498102 ACTGAGTAACAGGCGTAGGTTGG + Intergenic
1044066668 8:87707094-87707116 ACTGGGGAACAGGCAGAGGTTGG - Intergenic
1044258079 8:90089580-90089602 ATTGGGGTACAGGTGGTAGTTGG + Intronic
1044760816 8:95515301-95515323 ACTGGGTTACAGGGAGAGGTTGG - Intergenic
1044907747 8:97023442-97023464 ATTGGGGTACAGGTGGTGTTTGG - Intronic
1044912227 8:97072439-97072461 ATTGAGGAACAGGTGGTGTTTGG - Intronic
1045780420 8:105856133-105856155 ACTGGGGTACAGGTGGTATTTGG - Intergenic
1045784383 8:105903483-105903505 ACTGGGTAACAGGTGGAGTTTGG - Intergenic
1046788322 8:118292261-118292283 ATTGGGGTACAGGTGGTGTTTGG - Intronic
1047844910 8:128794983-128795005 TTTGAGTTACAGGAGGAGGTGGG + Intergenic
1048069696 8:131008684-131008706 ACTGGGTTACAGGCAGAGGTTGG + Intronic
1048404489 8:134106101-134106123 ACTGAGTAACAGGAAGAGGTTGG + Intergenic
1048485066 8:134839997-134840019 ATTGGGGTACAGGTGGTGCTTGG - Intergenic
1048806436 8:138245747-138245769 ACTGAGTAACAGGCAGAGGTTGG + Intronic
1048964329 8:139604406-139604428 ACTGTGGGACGGGAGGAGGTGGG + Intronic
1048998563 8:139809749-139809771 ACTGGGGTTGAGGTGGGGGTTGG - Intronic
1049553390 8:143270905-143270927 ACTGACGCCCAGGTGGAGGGTGG + Intronic
1049606797 8:143533286-143533308 TCTGAGGCCGAGGTGGAGGTGGG - Intronic
1049717512 8:144099912-144099934 AGAGAGGTACAGGTGGGGGGAGG - Exonic
1049751950 8:144289090-144289112 ACTGAGGAGCAGGTGCAGGTGGG - Exonic
1049913250 9:290774-290796 ACTGAGGTATAGGAGGAGTGAGG - Intronic
1050147899 9:2589621-2589643 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
1051444831 9:17129159-17129181 AGTGGAGTACAGGAGGAGGTGGG + Intergenic
1051893004 9:21962162-21962184 ATTGGGGTACAGGTGGTGTTTGG + Intronic
1051914936 9:22197412-22197434 ACTGAGAAACAGGCAGAGGTTGG + Intergenic
1052187892 9:25620879-25620901 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
1052577868 9:30312960-30312982 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
1052666158 9:31497619-31497641 ACTGAGTAACAGGGAGAGGTTGG - Intergenic
1053182858 9:35988941-35988963 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1053357392 9:37457791-37457813 ACAGAGGTAAAGGTGGAGAAGGG + Intronic
1053476610 9:38386450-38386472 ACTGAGGCCCAGAGGGAGGTAGG + Intergenic
1053636963 9:40018656-40018678 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
1053769066 9:41446246-41446268 TGTGAGGTACAGGTGGAGCAAGG - Intergenic
1054317792 9:63615449-63615471 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
1054547737 9:66357747-66357769 TGTGAGGTACAGGTGGAGCAAGG - Intergenic
1055393399 9:75847465-75847487 AGTGAAGTGCGGGTGGAGGTGGG + Intergenic
1056501002 9:87209369-87209391 ACTGAGGAAGATGTGGAGGGTGG + Intergenic
1057043410 9:91864366-91864388 CCTGAGGGACAGGTGGACTTGGG - Intronic
1058145882 9:101410889-101410911 ACTGAGGTACAGGAGAAGGAGGG - Intergenic
1059482452 9:114601919-114601941 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
1059778525 9:117501525-117501547 TCAGAGGTACATGTGCAGGTTGG + Intergenic
1060295853 9:122342653-122342675 CCTGCGGTACATGTGGAGGTAGG - Intergenic
1060420756 9:123468035-123468057 ACCTGGGTACAGGTGGTGGTTGG - Intronic
1061202108 9:129143856-129143878 ACTGTGGGACAGGCGGGGGTGGG - Intronic
1061680167 9:132239030-132239052 ACTGAGGGACAGGGCGAGGAAGG - Intronic
1061759657 9:132841660-132841682 ACTGAGGCCCAGATGGAGGAAGG - Intronic
1062150230 9:135014373-135014395 TTTGAGGTGCAGGTGGAGGCAGG - Intergenic
1062159299 9:135070879-135070901 GCTGAGGTTCAGGTAGAGGGAGG - Intergenic
1062313358 9:135952086-135952108 ACTCAGGGACAGGCGGAGGCAGG + Intronic
1062698310 9:137886482-137886504 AATGATGAACAGGTGGAGGGAGG - Intronic
1202784827 9_KI270719v1_random:2246-2268 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
1186212840 X:7268386-7268408 ACTGGGGTCCAGCTGGAAGTGGG - Intronic
1186340888 X:8645210-8645232 ACTGAGGCAGAGGTGAAGCTAGG + Intronic
1186797751 X:13063100-13063122 ACTGGGTTACAGGCAGAGGTTGG - Intergenic
1186980866 X:14956048-14956070 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
1187218650 X:17301835-17301857 ACTGGGGTACAGGTGGTATTTGG + Intergenic
1188124603 X:26352126-26352148 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
1188196302 X:27239652-27239674 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
1188215803 X:27475579-27475601 ACTGAGGTAAAAGAGGAGTTAGG - Intergenic
1188758726 X:33998688-33998710 ACTGGGGAACAGGTGGTGTTTGG + Intergenic
1188794503 X:34445084-34445106 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
1188862009 X:35269288-35269310 ATTGGGGTACAGGTGGTGTTTGG - Intergenic
1189088153 X:38048381-38048403 ACTGGGGAACAGGCAGAGGTCGG - Intronic
1189638089 X:43034264-43034286 TCTGAGGTACAGTGGGAGTTGGG - Intergenic
1189895960 X:45657071-45657093 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
1190993080 X:55572636-55572658 TCTGGGGTACAGGTGCAGGATGG - Intergenic
1191202796 X:57802782-57802804 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
1191934048 X:66407294-66407316 ACTGGGTAACAGGTAGAGGTTGG - Intergenic
1192311554 X:70019865-70019887 TCTGGGGTACATGTGCAGGTTGG - Intronic
1193279275 X:79627906-79627928 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
1193678315 X:84484149-84484171 ACTGAGTAACAGGAAGAGGTTGG - Intronic
1193825997 X:86227991-86228013 ATTGAGGTACAGGTGGTATTTGG + Intronic
1194216152 X:91132757-91132779 ACTGTGTAACAGGTAGAGGTTGG + Intergenic
1194427426 X:93756812-93756834 ATTTAGGTTCAGGTGGAGGTGGG + Intergenic
1194462973 X:94196030-94196052 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
1194956132 X:100182792-100182814 ACTGGGGTACAGGTGGTATTTGG - Intergenic
1195463297 X:105152115-105152137 ATTGGGGTACAGGTGGTGTTTGG - Intronic
1195636159 X:107118374-107118396 TCTCAGGTGGAGGTGGAGGTAGG + Intronic
1195796274 X:108650894-108650916 ATTGGGGTACAGGTGGTAGTTGG - Intronic
1195912905 X:109906474-109906496 ATTGGGGTACAGGTGGTGTTTGG + Intergenic
1196204993 X:112929326-112929348 ACTGGGGAACAGGTGGTGTTTGG - Intergenic
1196285106 X:113870901-113870923 ACTGGGTAACAGGTAGAGGTTGG + Intergenic
1196531224 X:116788962-116788984 ACTGGGGAACAGGTGGTGTTTGG - Intergenic
1196570351 X:117259681-117259703 ACTTAGATACAGCTGGAGTTTGG - Intergenic
1196934291 X:120714223-120714245 ATTGAGGAACAGGTGGTGTTTGG + Intergenic
1197074846 X:122341809-122341831 ACTGAGTAACAGGCAGAGGTTGG - Intergenic
1197202248 X:123758353-123758375 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
1197301810 X:124789822-124789844 ACTGAGTAACAGGCAGAGGTTGG - Intronic
1198919459 X:141709112-141709134 ACTGAGTAACAGGAAGAGGTTGG - Intergenic
1198991120 X:142515747-142515769 ACTGGGGAACAGGCAGAGGTTGG - Intergenic
1199619318 X:149685335-149685357 ACTGAGTAACAGGCAGAGGTTGG + Intergenic
1199844160 X:151678763-151678785 AGTGAGGTAGAGGCGGGGGTAGG - Intergenic
1201714267 Y:17027024-17027046 ACTGGGGTACAGGTGGCTTTTGG - Intergenic