ID: 922148178

View in Genome Browser
Species Human (GRCh38)
Location 1:222970027-222970049
Sequence TCTCATTTACTATCTCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922148178_922148181 -1 Left 922148178 1:222970027-222970049 CCTTTCTGAGATAGTAAATGAGA 0: 1
1: 0
2: 2
3: 21
4: 243
Right 922148181 1:222970049-222970071 AAACTCAGGAAAAGTACTTTGGG 0: 1
1: 0
2: 1
3: 23
4: 339
922148178_922148180 -2 Left 922148178 1:222970027-222970049 CCTTTCTGAGATAGTAAATGAGA 0: 1
1: 0
2: 2
3: 21
4: 243
Right 922148180 1:222970048-222970070 GAAACTCAGGAAAAGTACTTTGG 0: 1
1: 1
2: 1
3: 19
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922148178 Original CRISPR TCTCATTTACTATCTCAGAA AGG (reversed) Intronic
901557281 1:10041657-10041679 TTCCACTTCCTATCTCAGAAGGG - Intronic
909464946 1:75963110-75963132 TCTCATTTTCTATCTAACACAGG + Intergenic
911245959 1:95517693-95517715 TCCCATTTACATTCCCAGAAGGG - Intergenic
911364784 1:96924787-96924809 TCTGATTTACTATGTCTGGATGG + Intergenic
915039189 1:152953654-152953676 TCTCATTTTTTAGCTTAGAAAGG - Intergenic
915371867 1:155358097-155358119 TCTCATTTACTAGCTTAAAGAGG + Intronic
918584166 1:186166524-186166546 TCTCACTCAAGATCTCAGAAAGG + Intronic
918833534 1:189429988-189430010 TCTGATTTATTATCTTGGAAAGG - Intergenic
921465893 1:215487245-215487267 TCTCAGTTAGGATCTCAGCAGGG + Intergenic
921972193 1:221162256-221162278 TCTGATTTGATGTCTCAGAAAGG - Intergenic
922148178 1:222970027-222970049 TCTCATTTACTATCTCAGAAAGG - Intronic
923291029 1:232546358-232546380 TTTCATCTACTTTCACAGAAGGG + Intronic
1064378117 10:14815341-14815363 TGCAATTTACTATTTCAGAAGGG - Intergenic
1064559228 10:16579368-16579390 TTTCATTAATTATCTCAGAAAGG - Intergenic
1064579698 10:16781612-16781634 TAGCATTTACTATCTCTGAATGG + Intronic
1068939569 10:62667605-62667627 TTTCATTTACTATCTGAGGAGGG + Intronic
1070322402 10:75364171-75364193 CCCCATTTACTATCTCAGAATGG - Intergenic
1074067298 10:110028222-110028244 TCTCTTTTCCTGTCTCATAAGGG - Intronic
1074877846 10:117628167-117628189 TCTGATTTATTTTCTCAAAATGG + Intergenic
1077605179 11:3605353-3605375 TCTCATTTTCCATCTCAGATAGG + Intergenic
1079012808 11:16843585-16843607 TATCATTCACTATCACAGGAAGG + Intronic
1079692729 11:23440443-23440465 TTTGTTTTACCATCTCAGAAAGG + Intergenic
1081260638 11:40955940-40955962 TCTCATTCACATTCTCCGAAGGG + Intronic
1081318233 11:41658133-41658155 TGTCATTTACTATCTCTCCATGG - Intergenic
1085684142 11:78606248-78606270 TATGATTTACTATATCATAAAGG - Intergenic
1085897898 11:80661784-80661806 TCTCATTGTTTATCTCAGCATGG + Intergenic
1086521905 11:87678402-87678424 TCTCACTTAATATCTCAAATCGG - Intergenic
1088121700 11:106377729-106377751 TTTCCTTTGCTATCTCACAAGGG - Intergenic
1091316011 11:134614573-134614595 TGTCCTTTTCTATGTCAGAAGGG - Intergenic
1093637249 12:21486010-21486032 TCTCCCTTACTATTTTAGAATGG + Intronic
1094279021 12:28714242-28714264 AATCATTTGCTATCCCAGAATGG + Intergenic
1095297284 12:40541400-40541422 TCTCTTTCACTATGTCACAAGGG - Intronic
1095734373 12:45540450-45540472 TCCCATTTCCTATCTCTGCAGGG - Intergenic
1095837627 12:46655636-46655658 CCTCATTTCCTACCACAGAATGG - Intergenic
1098435580 12:70465106-70465128 TCTCATTATCTATTGCAGAAAGG - Intergenic
1098817948 12:75191874-75191896 TTTCATCTACTATCTTACAATGG + Intronic
1099591048 12:84590943-84590965 TCTAATTTTCTCTCTGAGAATGG + Intergenic
1099697731 12:86043064-86043086 TCTTATGTAGTATCTCACAAGGG + Intronic
1100112864 12:91266876-91266898 TCTCATTTTCTCTCTCAGTTAGG + Intergenic
1100182095 12:92096820-92096842 TGTCACTTACTATACCAGAATGG - Intronic
1104424804 12:128667313-128667335 TTACATTTTCTCTCTCAGAATGG - Intronic
1106141737 13:27017610-27017632 TCTGCTTAACAATCTCAGAAAGG + Intergenic
1109965595 13:69690266-69690288 TCTCATTTAGTAGCTCTGATTGG + Intergenic
1110292304 13:73821277-73821299 TTTCAATTGCTATCTCAGAAGGG + Intronic
1110725465 13:78817519-78817541 TCTCCTTATCTGTCTCAGAAAGG - Intergenic
1110843149 13:80165593-80165615 CTCCAGTTACTATCTCAGAAGGG + Intergenic
1111903526 13:94229260-94229282 GTTCTTTTATTATCTCAGAAAGG + Intronic
1111937339 13:94570683-94570705 TTTGATTTACTATCTCAGCCAGG - Intergenic
1112376407 13:98845865-98845887 TCTCATGTGCCATCTCAGAGGGG - Intronic
1112689431 13:101873837-101873859 TCTCTTTTCCTATATCAAAAAGG + Intronic
1114901298 14:27063009-27063031 TCTCATTCCCAATCTCAGAGAGG + Intergenic
1115458308 14:33631005-33631027 TCTTATTTACATTTTCAGAAGGG + Intronic
1115514658 14:34173510-34173532 TCTCATGTATTACCTCAGATGGG + Intronic
1117368742 14:55056357-55056379 AATCATTTTCTATTTCAGAAAGG + Intronic
1118530301 14:66697370-66697392 TCCCATTGGCTTTCTCAGAAAGG - Intronic
1119986258 14:79141684-79141706 TCTCCTTTATTTTCTCAGGATGG - Intronic
1120882348 14:89423706-89423728 TCTCATTTCATCTATCAGAATGG + Intronic
1123214252 14:106791794-106791816 ACTCATTTACTATCATAGCAAGG - Intergenic
1123957934 15:25359292-25359314 TATAATTTTCTATCTCAAAAAGG + Intronic
1124116025 15:26843320-26843342 TCTAATCTAATATTTCAGAATGG + Intronic
1124523858 15:30429580-30429602 TCTCATTTACTTTTCCAGGAAGG + Intergenic
1124534808 15:30536635-30536657 TCTCATTTACTTTTCCAGGAAGG - Intergenic
1124763841 15:32470972-32470994 TCTCATTTACTTTTCCAGGAAGG + Intergenic
1124774786 15:32578079-32578101 TCTCATTTACTTTTCCAGGAAGG - Intergenic
1125553771 15:40567521-40567543 TCTCATTTAGTAGGTCAGAAGGG + Intergenic
1126524971 15:49643446-49643468 TCTCTTTTAATATATCAGTATGG - Exonic
1126604962 15:50467018-50467040 TCTGCTTAACAATCTCAGAAAGG - Intronic
1126972406 15:54131506-54131528 TTTCATTACCTATCTCAGAAGGG - Intronic
1127126451 15:55817197-55817219 TCTCATTTGATAGCTCAGAAAGG - Intergenic
1127804249 15:62504270-62504292 TCTCATTCAGAATCCCAGAAGGG + Intronic
1129773377 15:78217048-78217070 TCTCATTTTCTATCTGTGACTGG + Intronic
1129978213 15:79840895-79840917 GGCCATTTACAATCTCAGAAAGG - Intronic
1130374524 15:83316840-83316862 TCTCATTTACAAACTCAGTGTGG + Intergenic
1135168569 16:20163121-20163143 TATTATTTACTATCTCAATAAGG - Intergenic
1135541849 16:23336080-23336102 TCTCACCTACTAGCTCAGACGGG - Intronic
1138874314 16:60930581-60930603 TTTCAGTTACTTTCTCAGGAGGG + Intergenic
1140558492 16:75948723-75948745 TGTTATTTATTATCACAGAATGG + Intergenic
1141070447 16:80949473-80949495 TTTCATTTACTTTCTCACAGGGG - Intergenic
1141183594 16:81771569-81771591 AGGCATTTACTATCACAGAATGG - Intronic
1141350346 16:83289020-83289042 TCACATTTTCTATTTCAAAAAGG - Intronic
1141870449 16:86781852-86781874 TCTCATTTAATCTCTCTGAAGGG + Intergenic
1144334744 17:14258631-14258653 ACACATTTATTATCTCACAATGG + Intergenic
1146690801 17:34874536-34874558 TCTGTTTTCCCATCTCAGAATGG + Intergenic
1147410816 17:40250680-40250702 TCTAATTTAATAGATCAGAAAGG + Intronic
1147435180 17:40407790-40407812 TATAATTTACTACATCAGAAAGG + Intronic
1149311779 17:55401501-55401523 ACTCTTTTTCTATCTCACAATGG - Exonic
1153450021 18:5216777-5216799 TCTCACTTACAAACTCATAAAGG - Intergenic
1154261381 18:12836199-12836221 TCTCTCCTACTATCTCAGAATGG + Intronic
1155084676 18:22446468-22446490 TGTCATTCACTATCACAGAATGG - Intergenic
1156022773 18:32618763-32618785 TTTCATTTAGCATCTCAAAATGG - Intergenic
1156287735 18:35715360-35715382 TCTCATTTACTACCTGGAAAAGG - Intergenic
1158010979 18:52727336-52727358 TCTAATTTATTAGCCCAGAATGG - Intronic
1158370081 18:56791559-56791581 TCTCATTTAGTTTCTCTGACTGG - Intronic
1158774274 18:60557097-60557119 TCTCTTTTACTTTCTGAGAAAGG - Intergenic
1160605629 18:80047578-80047600 TCTTATTTCCTATATCAGGATGG + Intronic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
1162755533 19:12857059-12857081 TCTCACTTACAATAACAGAAAGG - Intronic
1163045839 19:14641266-14641288 TCCCAGCTACGATCTCAGAAGGG + Intronic
1164718515 19:30413617-30413639 TCTAATTTCCTATCTGAGGAAGG + Intronic
1166205920 19:41268926-41268948 TCTTATTTAGAATCTTAGAATGG + Intronic
1166449236 19:42883998-42884020 TCTTATTTGCAATCTCACAAAGG - Intronic
1166582334 19:43913362-43913384 TATGTTTTACTATCTCAGATGGG - Exonic
1168228583 19:55014417-55014439 TCTCCTTTCGTCTCTCAGAACGG - Exonic
926256119 2:11201647-11201669 TCTCATTTAATAGCACAGATAGG + Intronic
926415012 2:12641139-12641161 TAACATTAACTATCACAGAAGGG + Intergenic
926575834 2:14579927-14579949 TCTAATTTACCACCTCACAATGG + Intergenic
927254336 2:21026960-21026982 TCTGATTTTCTTTCTCAGATTGG - Exonic
929689603 2:44063349-44063371 TCTCAGCTACTATCTTGGAAGGG + Intergenic
931371866 2:61670573-61670595 GCACATTTAGTATCTAAGAATGG + Intergenic
935569375 2:104642771-104642793 CCTCATTTAGTCACTCAGAAGGG - Intergenic
936091124 2:109501995-109502017 TCTCATTTACCACCTAAGCAGGG + Intronic
939515104 2:143156556-143156578 TCTCATTTAATAACTCAGTTAGG - Intronic
940893922 2:159062387-159062409 TCTGAATTACTGTGTCAGAAAGG + Intronic
941321387 2:164059598-164059620 TCTCATTTATTATCTCAGGTGGG + Intergenic
941685609 2:168445443-168445465 TTTCATTAACCATCTCAAAAGGG - Intergenic
941750700 2:169132609-169132631 TCTCTGGAACTATCTCAGAAGGG + Exonic
944430301 2:199626054-199626076 TCTCGTTTACTATAGAAGAAGGG + Intergenic
945010602 2:205458969-205458991 TCTCAGTTAGAATCACAGAAAGG - Intronic
945365082 2:208942653-208942675 TCTCATTTCATATTTCAGGAAGG - Intergenic
945387644 2:209222619-209222641 TCTCATTTACAATTTCAGTATGG + Intergenic
946934907 2:224709915-224709937 TCTCAGTAACCATCTCAGTATGG + Intergenic
946944255 2:224803293-224803315 TTTCATTTACTTTCTCACAAGGG + Intronic
947754734 2:232553763-232553785 TCCCATTTACTGTCTTAGAAAGG + Intronic
1169037496 20:2465574-2465596 TTTCATTTATTATCTGAAAAAGG + Intronic
1169725927 20:8731042-8731064 CCTCATTTAATACCTGAGAACGG - Intronic
1170081635 20:12483092-12483114 TCTCAAATAATATTTCAGAATGG - Intergenic
1170369304 20:15631495-15631517 TCTCATTTACTTTCTCACAATGG - Intronic
1171089716 20:22272375-22272397 ACTTATTTACAATTTCAGAAAGG + Intergenic
1177004710 21:15657194-15657216 CCTCATTTTATATCTCAAAAGGG + Intergenic
1177019472 21:15836372-15836394 CATCATTTATTATCTCAGTAGGG - Intronic
1178027443 21:28484276-28484298 TCTCATTTACTCTCAAAGTAGGG - Intergenic
1178392946 21:32214229-32214251 TCTCATGTCCCATCTGAGAATGG - Intergenic
1181120703 22:20667139-20667161 TCTCATTTCTTATCTCATGAGGG + Intergenic
1181907461 22:26210657-26210679 TCTCATCTCCATTCTCAGAATGG + Intronic
1185395496 22:50584991-50585013 TCTGACTTACTATCTTGGAAAGG - Intronic
951948293 3:28167411-28167433 TCACATTTTCTATCACAAAAAGG + Intergenic
951988397 3:28647331-28647353 TCTCAGTCACTATCTAAGACTGG + Intergenic
952562787 3:34614815-34614837 TCTCCTTTTTTTTCTCAGAAGGG - Intergenic
952656994 3:35798748-35798770 TCTCTTTTACAATCACATAAAGG - Intergenic
953831310 3:46299724-46299746 TCTCATTTACTGGCAGAGAAGGG + Intergenic
954786233 3:53094644-53094666 TTTCAGAAACTATCTCAGAAAGG + Intronic
955429843 3:58831534-58831556 TCTCAAACACTATTTCAGAATGG + Intronic
955506788 3:59640451-59640473 TCTCATTTACCCCCTCAGCAAGG - Intergenic
955643580 3:61112487-61112509 TGTCATTGAATAACTCAGAAAGG - Intronic
956981182 3:74640444-74640466 TTTCATTTAGTACCTGAGAATGG + Intergenic
957307269 3:78473759-78473781 TCTTATATAGTATCTCACAAGGG - Intergenic
957379676 3:79410502-79410524 AATCATTTATTATTTCAGAATGG + Intronic
958426241 3:93980968-93980990 TCTCATTTAATATTTAAGAAAGG - Intronic
959502630 3:107124102-107124124 TCTCATATACTATCTTGGGATGG - Intergenic
960370732 3:116835055-116835077 TCACATTTAATGTCACAGAAGGG + Intronic
961523079 3:127479187-127479209 CCTCATTTACTTTGTGAGAAGGG - Intergenic
963293947 3:143524274-143524296 TCTCCTCTTCTATCTCAGCAGGG - Intronic
963924955 3:150941887-150941909 TCTCACTTACTAACTTATAAGGG + Intronic
964655299 3:159060278-159060300 TTTTTTTTACTATCTGAGAATGG + Intronic
966947563 3:184787885-184787907 CATCATTTAATATCTTAGAAAGG - Intergenic
968710213 4:2109448-2109470 TCTCATTGCTTTTCTCAGAAGGG - Intronic
968824789 4:2887234-2887256 TCTTATTTACTATCTAGGTATGG + Intronic
969332318 4:6482428-6482450 TCTCCTATACTACCTCCGAAAGG + Intronic
969851497 4:9960639-9960661 TCTCATTTCCATTTTCAGAAGGG + Intronic
970362068 4:15320175-15320197 TCTCATTTAAAAGCTCAGAGAGG + Intergenic
970455821 4:16223494-16223516 TTTTATTTGCTCTCTCAGAATGG - Intronic
971719493 4:30227295-30227317 TCTCATTAACTGTTGCAGAAAGG - Intergenic
974207017 4:58718414-58718436 CCTCATTTAATAGCACAGAAAGG - Intergenic
975242513 4:72078012-72078034 ACTCATTTTTTATTTCAGAATGG - Intronic
976172279 4:82317011-82317033 ACTTATTCACTATCACAGAATGG - Intergenic
977254326 4:94724172-94724194 TCTCATTTATCACCTCTGAAAGG + Intergenic
977537694 4:98274969-98274991 TCTCATTTATTATCCAAGCAAGG - Intronic
980324903 4:131330474-131330496 TTTTTTTTACTATCTCAGACTGG + Intergenic
980685175 4:136218663-136218685 TCTTATATAGTATCTCACAAGGG + Intergenic
980755406 4:137152339-137152361 TCTCATTTAGTTACTAAGAAGGG + Intergenic
980954100 4:139410714-139410736 TCTCATTTTCTAACTCAGAGAGG - Intronic
981701243 4:147609459-147609481 ACTCTTTTACTATGACAGAAAGG + Intergenic
981864536 4:149399882-149399904 TTTCATATACTCTCTCAAAAAGG - Intergenic
981951251 4:150410487-150410509 TCTCCTCTACTATTTCATAATGG - Intronic
981995656 4:150971741-150971763 TTTTATTTACTATTTCACAAGGG + Intronic
982942921 4:161581348-161581370 TCTCATTTATTAACTCACAGTGG + Intronic
984105894 4:175545277-175545299 TTTTATTTACCATATCAGAAGGG + Intergenic
984256012 4:177390981-177391003 TTACACTTACTATCTCAAAATGG + Intergenic
985189628 4:187358158-187358180 TCTCATTTACTCTCCCAGGGCGG - Intergenic
986306292 5:6519372-6519394 TCACATTTCCTATCTCAGGCAGG + Intergenic
986783209 5:11085933-11085955 TCTCCTGTACCATCCCAGAATGG + Intronic
987687361 5:21222167-21222189 TCTCATTTAAAATATTAGAAGGG + Intergenic
987802784 5:22720203-22720225 ACTCACTTACTATCACAAAAAGG - Intronic
988578671 5:32450060-32450082 TCACTTTTACTATCTCTAAATGG - Intergenic
991519797 5:67483385-67483407 TATCAATTATTATCTCTGAAAGG - Intergenic
993325151 5:86525164-86525186 TCTGAATTACAATCTCTGAATGG + Intergenic
993555171 5:89328073-89328095 CCTCTTTTCCTATCTTAGAAAGG - Intergenic
994653309 5:102557243-102557265 TCTCATTTTCAATATCTGAAAGG + Intergenic
994834997 5:104839570-104839592 TCTCATTTATTATCCTTGAATGG - Intergenic
997008015 5:129842926-129842948 ACTCATTTAATATCTAACAATGG - Intergenic
997605429 5:135172638-135172660 TCCCATTTACTACCTATGAAAGG + Intronic
998650428 5:144114003-144114025 TCTTGTTTGCAATCTCAGAAGGG - Intergenic
1002344733 5:178540616-178540638 TCTCATTCAAAATCTCAGCAGGG + Intronic
1002654727 5:180736463-180736485 TCTCACTTCCTCTCTCAGATGGG + Intergenic
1002867606 6:1136525-1136547 TCTCATTGACTTTGGCAGAAAGG + Intergenic
1003090565 6:3098936-3098958 TCTCAGTCACTGGCTCAGAAGGG + Intronic
1005843091 6:29757404-29757426 TCTGATTTACTATCCTAGAGAGG - Intergenic
1005987436 6:30883768-30883790 TCTCAGTTCCTCTCTCTGAAGGG - Intronic
1009246502 6:61244756-61244778 TCAAATCTACTATCTTAGAATGG - Intergenic
1009295989 6:61948142-61948164 TGTCATTTGCTTTCTCGGAATGG - Intronic
1011479835 6:87783037-87783059 TCTCATTTTTTATCTTGGAAGGG - Intergenic
1013884137 6:114941264-114941286 TCTCATTTACCACCTCAGCAGGG + Intergenic
1014937312 6:127399625-127399647 TCAAATTTAATAGCTCAGAAAGG + Intergenic
1016033842 6:139364928-139364950 TATTATTTACTTTCTCAGAGAGG - Intergenic
1018271467 6:162082857-162082879 TTTCATTTACCATCTCATATGGG + Intronic
1020606146 7:10339170-10339192 TCTCTTTTCCTATAACAGAATGG + Intergenic
1021072589 7:16260095-16260117 TCAAACTTACTATCGCAGAATGG - Intronic
1021372314 7:19863796-19863818 TCTGATTCACTATGTCAGGATGG - Intergenic
1022055041 7:26721871-26721893 TCTCATTTTGAATCTCAAAAGGG - Intronic
1023344924 7:39261680-39261702 TGTCATTTCCCATCTAAGAATGG + Intronic
1026166893 7:67918294-67918316 TCTCACTTCCTGTTTCAGAATGG - Intergenic
1026166899 7:67918327-67918349 TCTCACTTCCTGTTTCAGAATGG - Intergenic
1026166905 7:67918360-67918382 TCTCACTTCCTGTTTCAGAACGG - Intergenic
1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG + Exonic
1028138594 7:87247429-87247451 TCTCTTCTACTGTCTCAAAATGG + Intergenic
1029604321 7:101589578-101589600 TCTCCCTTACTATCTGAGGATGG + Intergenic
1031006737 7:116482080-116482102 TACCATTTTCTTTCTCAGAATGG - Intronic
1031046968 7:116901732-116901754 TTTAATTTTCTATCTAAGAATGG - Intronic
1031381941 7:121097445-121097467 TTTCATTTTCTTGCTCAGAAGGG - Intronic
1032831846 7:135635265-135635287 TCTAAATTACTTTCTCATAAAGG - Intronic
1034570285 7:151950289-151950311 TCTGATTTACTGTCTTGGAAGGG - Intergenic
1035589664 8:802821-802843 TCCCATTCACTTTCTCAGAGGGG - Intergenic
1036118957 8:5993497-5993519 TCACATTTTCTATCTCCTAAAGG - Intergenic
1036589000 8:10150894-10150916 TCTCATTTTATATATCAGTAAGG + Intronic
1037649755 8:20825596-20825618 TCTCATTTTCTATCCCCTAATGG + Intergenic
1038523307 8:28252217-28252239 TCTCATTTCCAGTCTCAGACTGG + Intergenic
1039715886 8:40108697-40108719 ACTCATTTATTTTCTCAGTAGGG + Intergenic
1040775626 8:51039812-51039834 TATCAATTACTATCCCAGGAGGG - Intergenic
1041857337 8:62472598-62472620 TCTCAAGCACTGTCTCAGAAGGG + Intronic
1042078057 8:65017566-65017588 TCTCATTTTCTTTCTTAGATAGG - Intergenic
1042443387 8:68853834-68853856 TCGCATTTACTTTCACACAATGG + Intergenic
1044248490 8:89978788-89978810 TTTTATTTACTTTCTCAAAAAGG - Intronic
1044699449 8:94952672-94952694 TGCCAGTTACCATCTCAGAAAGG + Intronic
1044787475 8:95809834-95809856 TCTCAGCTACTATCTGAGCATGG + Intergenic
1047957312 8:129985532-129985554 TCTCATTTACTATTTCTGGGGGG - Intronic
1050820548 9:9873699-9873721 GCTCATTTATTATCTCAGTTTGG - Intronic
1050851426 9:10291660-10291682 TCTCCTCTACAGTCTCAGAAGGG + Intronic
1051579064 9:18650927-18650949 TCTCATTTAATCCCTCAAAAAGG - Intronic
1052224439 9:26068152-26068174 TCCCATTTACCATATCAAAAAGG - Intergenic
1052680241 9:31682059-31682081 TCTCACTTCCTATCTCATAACGG + Intergenic
1053330115 9:37197886-37197908 TCTCATTTAATATATGAGCAGGG + Intronic
1053876297 9:42550185-42550207 TTTCATTTACTATTTCATCATGG + Intergenic
1053896371 9:42744517-42744539 TTTCATTTACTATTTCATCATGG - Intergenic
1054235400 9:62551536-62551558 TTTCATTTACTATTTCATCATGG - Intergenic
1056468735 9:86884656-86884678 CCTCATTTTCTACATCAGAATGG - Intergenic
1057872543 9:98729196-98729218 TCTCATTTCCTGTCTCAGCGTGG - Intergenic
1058838198 9:108878437-108878459 TCTCAGTTACCAGCTAAGAAGGG + Intronic
1059139139 9:111835495-111835517 TCTCATTTAATACCTTACAAAGG + Intergenic
1060407521 9:123380142-123380164 TCTCATTTCCTATTTGTGAAGGG - Exonic
1060506924 9:124204770-124204792 TCTGATTTACTATCTTAGCCAGG + Intergenic
1185810781 X:3108335-3108357 TCTCAATCACAATTTCAGAAAGG - Intronic
1186166464 X:6831773-6831795 TCTCTTTTACTATTTCAAGAAGG - Intergenic
1186527842 X:10265884-10265906 TCTCATTTTCTATCTTAGTAGGG + Intergenic
1186747174 X:12582262-12582284 TTACATTTTCTGTCTCAGAAAGG - Intronic
1186993802 X:15097928-15097950 TCCCATTTCCTATTTGAGAAAGG - Intergenic
1187207964 X:17200933-17200955 TCTTATTTCCTGTCTTAGAAAGG - Intergenic
1187983972 X:24790390-24790412 TTTCATTTACTATCCCTTAAGGG + Intronic
1191725156 X:64271640-64271662 TCCCAGCTTCTATCTCAGAATGG + Intronic
1191735970 X:64388060-64388082 TCTCATTTTCTTTCTAGGAAGGG + Intronic
1193615369 X:83681498-83681520 TCTCTTTTAGAATCTGAGAATGG - Intergenic
1196935638 X:120727972-120727994 CCTAAATTACTAACTCAGAAAGG - Intergenic
1197010993 X:121563295-121563317 TTTCATTTACAATTTCAAAATGG - Intergenic
1197381508 X:125747928-125747950 TCTCATTTTCTATGTAAAAAAGG - Intergenic
1199187784 X:144937773-144937795 TTTCAATTACTTTCTAAGAAAGG - Intergenic
1201626978 Y:16025277-16025299 TGTCATCTACTAGCTAAGAAGGG - Intergenic
1201636268 Y:16126488-16126510 TCTCATTGTCTATTGCAGAAAGG + Intergenic
1202049808 Y:20768625-20768647 TCTCAATTACTAAATCAGTATGG + Intronic