ID: 922149537

View in Genome Browser
Species Human (GRCh38)
Location 1:222986387-222986409
Sequence CTCAAGTGACATTAAAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922149537 Original CRISPR CTCAAGTGACATTAAAATGG GGG (reversed) Intronic
901437261 1:9255176-9255198 CTCAAGAGAAATAAAAATGCAGG - Intronic
906865593 1:49415527-49415549 CTGAAGTGACATTAAAATGTAGG + Intronic
909843907 1:80365900-80365922 CTAAATTGACATTTAAATGGTGG - Intergenic
911598875 1:99826457-99826479 CCCAACTGACATTTAAATGCTGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
913940410 1:125098554-125098576 TTCAAGTGAAATTAAGATTGCGG + Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914402182 1:147332176-147332198 CTCAAGTCATCTTAAAATGCAGG + Intergenic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
919198802 1:194324541-194324563 GTCAAGTGACATCAAAAAGCTGG + Intergenic
920527869 1:206681668-206681690 CTCAAATCACCTTAAAAGGGAGG - Intronic
922149537 1:222986387-222986409 CTCAAGTGACATTAAAATGGGGG - Intronic
924602031 1:245499626-245499648 CTCAAATTACTTTAAAGTGGAGG - Intronic
1063421879 10:5918870-5918892 TTCAAGTGAAATTAAAATGTTGG + Intronic
1063745233 10:8871747-8871769 CGAAAGTGACATTGCAATGGGGG + Intergenic
1063991041 10:11563529-11563551 CTAAAGTTACATAAAAATGGAGG + Intronic
1065415129 10:25476759-25476781 CTCAAATGACATCAAACGGGAGG + Intronic
1066697967 10:38095126-38095148 CTCAAGTGACAGGAAGATGTAGG + Intronic
1067905268 10:50284289-50284311 CTCATGTGAAAAAAAAATGGTGG - Intergenic
1070357719 10:75656991-75657013 CCCGAGAGACAATAAAATGGAGG + Intronic
1071877409 10:89856135-89856157 CTCAACTGCCAATAAAAAGGAGG - Intergenic
1072767217 10:98105253-98105275 CTTAAGGGACATTCTAATGGAGG - Intergenic
1077677367 11:4206967-4206989 CTCAAGAGGAATGAAAATGGGGG - Intergenic
1077908600 11:6555268-6555290 CTCAGGTGACATGAGGATGGAGG + Intronic
1079721500 11:23819986-23820008 ATTAAGAGACATTAATATGGAGG + Intergenic
1079798044 11:24831400-24831422 CTTAAGTGACATTAACATTTTGG + Intronic
1079993055 11:27266767-27266789 CTCATGGGACATTAAAAGGAGGG - Intergenic
1080389233 11:31828601-31828623 CTCAACTGACATTAACAGGGAGG - Intronic
1080854454 11:36100201-36100223 CTCAGGTGACTGTAGAATGGTGG - Intronic
1081129129 11:39355287-39355309 ATTAAGAGACATTTAAATGGAGG + Intergenic
1081193215 11:40129655-40129677 AGCAAATGACTTTAAAATGGAGG + Intronic
1081335441 11:41859982-41860004 TTCAGGTGATATTGAAATGGAGG + Intergenic
1085910361 11:80817431-80817453 CACAAGTGACAGTGAAATAGGGG - Intergenic
1086768740 11:90733359-90733381 TAGAAGTGACATAAAAATGGTGG - Intergenic
1087788973 11:102387133-102387155 CTCCAGTGACTGTAAGATGGTGG + Intergenic
1087885698 11:103479805-103479827 TTCAGGTGACATAATAATGGAGG + Intronic
1088817306 11:113430444-113430466 TTTCAGAGACATTAAAATGGTGG + Intronic
1091412881 12:255742-255764 CTCTAGTGACATTCAGATGCAGG - Intronic
1092804729 12:12210141-12210163 CTCCAGTGACAATAACATTGAGG + Intronic
1093685732 12:22051950-22051972 CTCAATTTTCAGTAAAATGGAGG - Intronic
1093702943 12:22243441-22243463 CTCATGGCACAGTAAAATGGAGG - Intronic
1093954078 12:25196408-25196430 CCCAAGTTACCTTAAAATAGTGG + Intronic
1094268971 12:28590250-28590272 CTAAACTGACACCAAAATGGAGG + Intergenic
1096000922 12:48129623-48129645 CTCAAGTGACACAAAAAAGGGGG + Intronic
1096401402 12:51309735-51309757 CTTAAGTGATGTTTAAATGGTGG + Intronic
1097532966 12:60828978-60829000 CACAATTGACTTAAAAATGGTGG - Intergenic
1098647479 12:72921153-72921175 ATAAAGTGAAACTAAAATGGTGG + Intergenic
1100093126 12:90996719-90996741 CTCCAGTGATCTTAAAATTGAGG - Intronic
1102932317 12:116872017-116872039 CTCAAGTGACTTCACAATGATGG + Intronic
1103168577 12:118792892-118792914 CACAACAGACAGTAAAATGGTGG - Intergenic
1110757404 13:79191759-79191781 GTCAAGTGACACCAAAATGTGGG + Intergenic
1112678691 13:101736110-101736132 CTGAAGTGTCCTTAAAATAGAGG - Intronic
1113054816 13:106256787-106256809 CTAAAATGACATTAAAATTAAGG + Intergenic
1115375265 14:32668393-32668415 CTCATCTGTCATTAAAATGGAGG + Intronic
1116827769 14:49688647-49688669 CTCAAGTTAAATAAAAATCGGGG - Intergenic
1123885873 15:24727934-24727956 CCCACGTAACATTAAAAGGGAGG + Intergenic
1124578547 15:30930659-30930681 CTCAACTGACCTTAAAGTGACGG - Exonic
1125001719 15:34777897-34777919 CTCAAGTGAAATAAAAATTCTGG + Intergenic
1126110723 15:45173323-45173345 CCAAAGTGAATTTAAAATGGTGG + Intronic
1126701875 15:51375306-51375328 CTCAAGTGAGGGGAAAATGGAGG - Intronic
1127552790 15:60057766-60057788 CTGAAGTGACACAAAAATGATGG - Intronic
1128845971 15:70894983-70895005 CTCTAGAAACATTATAATGGTGG - Intronic
1137868728 16:51929135-51929157 GTCCAATGACATTGAAATGGTGG + Intergenic
1138765462 16:59597312-59597334 CTCAAGTGACATCAGAAGGAAGG - Intergenic
1138959427 16:62010972-62010994 ATCCAGGGACATGAAAATGGGGG - Intronic
1141449214 16:84086192-84086214 CTCAAATGCCATTAAAAAGCTGG + Intronic
1143601078 17:7946492-7946514 CACAGGTGACATTAAACTAGGGG - Intronic
1146194523 17:30800186-30800208 CTCAAATGACTTTTAAATGTTGG + Intronic
1149782814 17:59411553-59411575 CCCAAGAGAAATGAAAATGGAGG - Intergenic
1153383012 18:4459021-4459043 CTCTAGTTACATCAAAATGGCGG + Intergenic
1153467755 18:5408227-5408249 CTCAAGAAACTTTAAAATGTGGG - Intronic
1156004735 18:32426667-32426689 GTCAAGTCATATTAAATTGGTGG - Intronic
1157606926 18:48931822-48931844 CTCTAGTGACAGGAAAGTGGAGG + Intronic
1163153125 19:15426374-15426396 AGCAAGTGACATTACAATGATGG + Intronic
926935436 2:18083057-18083079 ATTAAGGGACATTAGAATGGAGG + Intronic
931147929 2:59540477-59540499 GTCAAGAGACATTAAAATCTAGG + Intergenic
935443736 2:103134972-103134994 CACAAGTGACATGAAATTAGAGG - Intergenic
937392499 2:121502622-121502644 TTCAAATGACATCAGAATGGCGG + Intronic
937553785 2:123129300-123129322 CTAATGTGACAGTAAAATGCAGG - Intergenic
938670266 2:133579833-133579855 CCAGAGGGACATTAAAATGGGGG - Intergenic
939225215 2:139355461-139355483 CTCAAGTGAAAATAAAATGTAGG - Intergenic
941771877 2:169353607-169353629 TTCTAGTGAGATTAAAATGTGGG + Intronic
942286510 2:174422928-174422950 ACCAAGTGGCATTAATATGGAGG + Exonic
943469643 2:188277787-188277809 GTCAAGAGACATTAAATTAGAGG - Intergenic
944181593 2:196901293-196901315 CTCTAGTTACATGAAAATGGTGG + Intronic
948312741 2:237001048-237001070 TTGAAGTGACAATAACATGGAGG - Intergenic
948685722 2:239668470-239668492 CTCAAGAGACATTCAAATGCTGG - Intergenic
1168973767 20:1948943-1948965 CTCAAGTGTGATTCAACTGGAGG + Intergenic
1183417701 22:37691932-37691954 CTCAACTGACACTGAAGTGGTGG + Exonic
1184835448 22:47018405-47018427 CTCAGATTGCATTAAAATGGGGG - Intronic
949181022 3:1131552-1131574 CTCAAGTGAAGTTAACATGCAGG + Intronic
954927363 3:54248162-54248184 GTAAAGTGAGATTAAAAGGGTGG + Intronic
955459298 3:59163190-59163212 CTGAAGTGGCATTTAGATGGAGG + Intergenic
956016489 3:64889248-64889270 CTCAAGTGGCATTGAAAAGGCGG + Intergenic
956266966 3:67407285-67407307 ATCAAGTGACATGAAGAAGGAGG - Intronic
960402299 3:117216252-117216274 CTAAATTGACATTCAAATGAAGG - Intergenic
962397818 3:135032852-135032874 CTCCAGAGACATGAAAATTGTGG + Intronic
964895041 3:161585891-161585913 CTAATGTGACATAAAAATGTAGG - Intergenic
967368559 3:188716366-188716388 CTCAATTAAGATGAAAATGGAGG + Intronic
967389547 3:188941926-188941948 CTCATTTTACATTAAATTGGAGG - Intergenic
970127726 4:12833071-12833093 CTCAAAAGACAGGAAAATGGGGG - Intergenic
972659663 4:41103743-41103765 CACATGTGACGTTAAAGTGGGGG - Intronic
974586281 4:63882942-63882964 CTCAAATGCCATTACATTGGGGG - Intergenic
975350249 4:73338371-73338393 CTCATGGGACTGTAAAATGGTGG - Intergenic
975536280 4:75454522-75454544 CTCAAGTGACCATCAAATGGTGG + Intergenic
975721587 4:77253678-77253700 CCTAAGTGACAGTAAAATTGAGG + Intronic
976705468 4:88014990-88015012 GTCAAATGACATTAAACTGAGGG - Intronic
979718938 4:123875658-123875680 CTCAAGTGGAAGTAAAATGTTGG - Intergenic
980842695 4:138285091-138285113 CTAAAGTGGAATTAAAAAGGAGG + Intergenic
981649096 4:147035972-147035994 TTCTAGTAACTTTAAAATGGGGG + Intergenic
983444388 4:167830931-167830953 TTCAAGAGACATCAAAATGAAGG + Intergenic
983702667 4:170616759-170616781 CACTGGTGACATTAAAATAGAGG - Intergenic
984877501 4:184382475-184382497 GTCGAGAGACATTAAAGTGGTGG + Intergenic
985067201 4:186134164-186134186 CTCTAATGAGTTTAAAATGGAGG + Intronic
986419583 5:7565442-7565464 CCCTATTGATATTAAAATGGAGG - Intronic
987768568 5:22269390-22269412 ATAAAATGACATTAATATGGGGG - Intronic
991328995 5:65471339-65471361 CACAAGTAATATTAAAATGATGG - Intronic
991411963 5:66354592-66354614 TACTAGTGACATTAAACTGGTGG - Intergenic
992406112 5:76459346-76459368 CTGGAGTCACATTAAAAAGGCGG - Intronic
993025363 5:82639153-82639175 CTTAAGTGACATGAAGATGAAGG + Intergenic
993140554 5:84027815-84027837 CTGAAGTGAAATAAAAAGGGTGG + Intronic
994827764 5:104737344-104737366 TTCAAGGGAAATAAAAATGGTGG - Intergenic
996078380 5:119225833-119225855 CTCACCTGACATTAAACTTGTGG - Intronic
997627339 5:135339927-135339949 CTCAAGAGACCTTTGAATGGGGG - Intronic
998059275 5:139106300-139106322 CACACGTGACTTTAAAAAGGTGG - Intronic
999457301 5:151728113-151728135 CTCAAGTTCCTGTAAAATGGTGG - Intergenic
999649909 5:153755355-153755377 CTCAAGTGACATCAACAAGATGG + Intronic
1001723700 5:173878078-173878100 CTCAAGTGACATTAATGAGTTGG - Intergenic
1003192373 6:3885934-3885956 CTCAGGTGACATTCAAACAGAGG - Intergenic
1003577971 6:7315104-7315126 CTCAAGTGCCACCAAAGTGGGGG - Intronic
1004778713 6:18880531-18880553 CTCATGTGACTTTCAAATGTTGG + Intergenic
1007500942 6:42296327-42296349 ATAAAATGAGATTAAAATGGAGG - Intronic
1008609656 6:53173983-53174005 CTCAATTGACAACAAATTGGAGG - Intergenic
1009292261 6:61897150-61897172 CTCAAGTAACTTTAACATGCAGG - Intronic
1009450770 6:63797915-63797937 CTCAAGAGATATAAAAATGTGGG - Intronic
1011638593 6:89398925-89398947 GTCAAGTAACATTCAAACGGAGG + Intronic
1011698324 6:89932983-89933005 CTTGAGTTACATTATAATGGAGG - Intronic
1012720759 6:102740556-102740578 CTCAAGTTAAATTAAAATTTAGG + Intergenic
1013797416 6:113903148-113903170 TTCAAGTGACATTAAAACCTGGG - Intergenic
1015599909 6:134902027-134902049 CTCAGGTCACATAAGAATGGAGG - Intergenic
1016760703 6:147733479-147733501 CTGAAGTGAAATTAGAATGGTGG - Intronic
1019122363 6:169813347-169813369 CTAAAGTGAGATAAAGATGGGGG - Intergenic
1021480346 7:21108370-21108392 CTAAAGTGCCAATAAAAAGGAGG - Intergenic
1024713104 7:52040163-52040185 CTCTACTGACATCAAAGTGGAGG - Intergenic
1025239594 7:57260026-57260048 AACAAGTGACATAAAAATAGAGG + Intergenic
1025481207 7:60985334-60985356 CTCCAGTAACATCAAAAAGGAGG + Intergenic
1026358711 7:69583097-69583119 CTCAAGTGACCTTAAAAGCAAGG - Intergenic
1028067432 7:86404854-86404876 TTCATTTGACACTAAAATGGAGG + Intergenic
1028229762 7:88292543-88292565 CTCTAGTGGCATAAAACTGGAGG - Intronic
1028920077 7:96301124-96301146 CTGAATTGACTTTAAAAGGGTGG - Intronic
1028982816 7:96985502-96985524 CTCAAGTGACATTAGCCTTGGGG - Intergenic
1029998523 7:105033290-105033312 TTAAAATGACATTAAAATTGTGG - Intronic
1034186785 7:149184179-149184201 CTCAAGTTAGATCAAATTGGTGG + Intergenic
1041895091 8:62915284-62915306 ATCATGTGACCTTAACATGGAGG + Intronic
1045773223 8:105769924-105769946 TTTAAATCACATTAAAATGGAGG - Intronic
1046516213 8:115264950-115264972 AACAAATGACATTAAAATGAAGG - Intergenic
1047076477 8:121409733-121409755 CTTAAGTGAAAAAAAAATGGAGG + Intergenic
1048322938 8:133415716-133415738 TTCTAGTGTCATAAAAATGGAGG + Intergenic
1048559650 8:135519972-135519994 CTGATATGACATAAAAATGGTGG + Intronic
1051586265 9:18730325-18730347 TTTAAGTGACATAAAAATGAGGG + Intronic
1052067009 9:24034494-24034516 TTCCAGTGAAATAAAAATGGTGG + Intergenic
1057963627 9:99481129-99481151 CTGATGGGACATTCAAATGGAGG - Intergenic
1060741437 9:126100238-126100260 CCCAAGTGACTTTAAAATATAGG + Intergenic
1062154928 9:135042327-135042349 CTCTAGTGAAGATAAAATGGAGG - Intergenic
1186222039 X:7359630-7359652 TTAAAGTGACATTAAAATGCAGG - Intergenic
1188385113 X:29546957-29546979 TTTCAGTGACATTGAAATGGAGG + Intronic
1193730078 X:85092333-85092355 CTCAGGTGACAGTCAAATGTTGG + Exonic
1194491253 X:94552325-94552347 ATCAAGTGACAACAAACTGGAGG + Intergenic
1194573829 X:95586577-95586599 CTCATGGGACATGAATATGGTGG + Intergenic
1194653884 X:96548177-96548199 CTTAAGCCACATTAAAATGAGGG + Intergenic
1196617437 X:117783488-117783510 CTCAAGAAACATTAAAATCAAGG - Intergenic
1197219536 X:123898199-123898221 CTGAAGCAACATTAAAAAGGTGG - Intronic
1199806976 X:151309776-151309798 CTGAAGTGTCATTTAACTGGGGG - Intergenic
1201256918 Y:12116971-12116993 CGCAAGTGACCTCAAAATGTTGG + Intergenic
1201590396 Y:15608743-15608765 CATAAGTGACATTAAAAGGCAGG - Intergenic