ID: 922150523

View in Genome Browser
Species Human (GRCh38)
Location 1:222999243-222999265
Sequence GTGAATAACTAGAATTAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 309}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922150516_922150523 30 Left 922150516 1:222999190-222999212 CCAAGAGATGTTATAACCACATA 0: 1
1: 0
2: 0
3: 10
4: 169
Right 922150523 1:222999243-222999265 GTGAATAACTAGAATTAGAAGGG 0: 1
1: 0
2: 1
3: 45
4: 309
922150520_922150523 -7 Left 922150520 1:222999227-222999249 CCTAAACATCCATTTTGTGAATA No data
Right 922150523 1:222999243-222999265 GTGAATAACTAGAATTAGAAGGG 0: 1
1: 0
2: 1
3: 45
4: 309
922150519_922150523 -6 Left 922150519 1:222999226-222999248 CCCTAAACATCCATTTTGTGAAT 0: 1
1: 0
2: 0
3: 30
4: 309
Right 922150523 1:222999243-222999265 GTGAATAACTAGAATTAGAAGGG 0: 1
1: 0
2: 1
3: 45
4: 309
922150517_922150523 14 Left 922150517 1:222999206-222999228 CCACATAAGCACAATGATTCCCC 0: 1
1: 0
2: 1
3: 5
4: 131
Right 922150523 1:222999243-222999265 GTGAATAACTAGAATTAGAAGGG 0: 1
1: 0
2: 1
3: 45
4: 309
922150518_922150523 -5 Left 922150518 1:222999225-222999247 CCCCTAAACATCCATTTTGTGAA 0: 1
1: 0
2: 2
3: 22
4: 216
Right 922150523 1:222999243-222999265 GTGAATAACTAGAATTAGAAGGG 0: 1
1: 0
2: 1
3: 45
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922150523 Original CRISPR GTGAATAACTAGAATTAGAA GGG Intronic
901398099 1:8996530-8996552 GTTAATACCTAGGATTGGAATGG + Intergenic
902452587 1:16506796-16506818 TTGAATAATTAGAAATGGAAAGG + Intergenic
902912382 1:19609468-19609490 GTAAATATCTAGGAGTAGAATGG - Intronic
906759274 1:48359528-48359550 TTGAATAATAAGTATTAGAAGGG - Intronic
906987510 1:50700363-50700385 GTGCTTTACTAGAATTACAAAGG - Intronic
907738088 1:57135579-57135601 CTAAATAACTAGTAATAGAATGG - Intronic
907942692 1:59104771-59104793 GTAAATAACTATAAGGAGAAGGG - Intergenic
908079049 1:60555204-60555226 GTAAATACCTAGCAATAGAATGG - Intergenic
908934177 1:69354480-69354502 GTGAATAACAAGAAAAAGATGGG - Intergenic
909195662 1:72619027-72619049 TTAAATACCTAGGATTAGAATGG - Intergenic
909685841 1:78347450-78347472 GTGTATACCTAGAAGTGGAATGG + Intronic
910125210 1:83833118-83833140 GAAAATAACTAGTATTAGCAAGG - Intergenic
910592769 1:88945187-88945209 GGGAATAAATATAATTATAAAGG + Intronic
911172914 1:94788959-94788981 GTGAATAACTAGAATACATAAGG + Intergenic
912596436 1:110881614-110881636 GTAAATACCTAGGAGTAGAATGG + Intronic
913239300 1:116815407-116815429 GTGCAGAAATAGAACTAGAAGGG - Intergenic
913343048 1:117779359-117779381 GTAAATACCTAGGAGTAGAAAGG - Intergenic
913422350 1:118685243-118685265 GACAATAACTAGAATTAGCAGGG - Intergenic
914409221 1:147408798-147408820 TTGAATAACTAGGAGTGGAATGG + Intergenic
915532773 1:156512941-156512963 GTGAGTAACTGGAATTACAGGGG + Intergenic
916198268 1:162245512-162245534 GTAAATACCTAGAAGTAGAATGG - Intronic
917000926 1:170357826-170357848 GTAAATACCTAGGAGTAGAAAGG - Intergenic
918356617 1:183710872-183710894 GTGGATAACTAGAAGGAAAAGGG + Intronic
918710540 1:187722566-187722588 GAGAATCACTAATATTAGAAAGG + Intergenic
918883777 1:190163647-190163669 GGAAATAAATAGAATTAGACTGG + Intronic
919418929 1:197346754-197346776 GTTAATAATTAGAAATAGTAAGG + Intronic
919515574 1:198517889-198517911 GTGACAAACTAGAATCAGCAAGG - Intergenic
919527995 1:198678955-198678977 GTGAGTGACTAGAATTATAAAGG + Intronic
919905992 1:202078680-202078702 GAGAATCACTTGAATTGGAAAGG - Intergenic
921078310 1:211717660-211717682 GTAAATACCTAGGAGTAGAAAGG + Intergenic
921482885 1:215683711-215683733 GTGAATAAGAAGAAAGAGAAAGG - Intronic
921784482 1:219212898-219212920 GTAAATAAGTAGGAGTAGAATGG + Intergenic
922150523 1:222999243-222999265 GTGAATAACTAGAATTAGAAGGG + Intronic
922874543 1:228929875-228929897 GTAAATACCTAGAAGTGGAATGG - Intergenic
922993494 1:229937390-229937412 GTGAATGCCTAGAATTAGGATGG - Intergenic
923940816 1:238823671-238823693 GTGAAAACCCAGAATTAGGAAGG - Intergenic
924593239 1:245423007-245423029 GAGAATCACTTGAATTAGGAAGG + Intronic
1064046451 10:12020866-12020888 GTGGATAATTATAATTTGAAAGG - Intronic
1064495146 10:15901724-15901746 GTAACTAACATGAATTAGAAAGG + Intergenic
1065284422 10:24174028-24174050 GAGATCAACTGGAATTAGAATGG - Intronic
1066152101 10:32633653-32633675 CTAAATCAATAGAATTAGAAAGG - Intronic
1067308763 10:45092668-45092690 TAGAATAACTAGAATTATACAGG - Intergenic
1067329838 10:45304711-45304733 GATATTAACTAGCATTAGAATGG + Intronic
1068376159 10:56183977-56183999 GTGAATAAGTAGAATTATATAGG + Intergenic
1069261956 10:66409806-66409828 CTGATTATATAGAATTAGAAAGG + Intronic
1069312364 10:67054112-67054134 GTGAATATGTGGAATTATAAAGG - Intronic
1069573974 10:69512942-69512964 GTAAATATCTAGAAGTAGAATGG + Intergenic
1070243346 10:74705648-74705670 GTAAATACCTAGAAATAGAACGG + Intronic
1070272893 10:74975345-74975367 TTTAATAAATAGAATTATAAAGG - Intronic
1070292800 10:75131247-75131269 GAGAAGAAGCAGAATTAGAATGG - Intronic
1071031239 10:81184321-81184343 ATGAATAACAAAAATTAGCAAGG - Intergenic
1071173121 10:82891939-82891961 TTTGATAACTAGAAATAGAAGGG - Intronic
1074159067 10:110822220-110822242 TTGGATAACTAAAATTAGACTGG + Intronic
1074800422 10:116995123-116995145 GTGAACAACAAGACTTAAAATGG - Intronic
1075526709 10:123193216-123193238 ATGAATACATTGAATTAGAAAGG - Intergenic
1076270336 10:129147112-129147134 GTGAATAAGTGGAATATGAAAGG - Intergenic
1076938905 10:133587235-133587257 GTGAATACCTAGGAGTACAATGG + Intergenic
1078343307 11:10518228-10518250 GTGAATACCTAGACATGGAATGG - Intronic
1080785536 11:35471875-35471897 GAGAAAAAATAGAAATAGAAAGG + Intronic
1081590535 11:44419800-44419822 AGGAACAACTAGAATTGGAAAGG + Intergenic
1083136518 11:60682980-60683002 TTGAAAAACTAGGAATAGAATGG + Intergenic
1083230897 11:61318226-61318248 CTGAATAAATATAATGAGAAGGG - Intronic
1085839488 11:79995096-79995118 GTGGACAAATGGAATTAGAAAGG - Intergenic
1085881184 11:80468161-80468183 TTGGAAAACTAGGATTAGAAAGG + Intergenic
1086029890 11:82341650-82341672 GTGAATGACAATAATCAGAATGG - Intergenic
1086387198 11:86321434-86321456 GTTAATATCTAGGAGTAGAATGG + Intronic
1086995310 11:93349606-93349628 AAGAAGAGCTAGAATTAGAAGGG + Intronic
1088173889 11:107028670-107028692 ATAAATAACTAGTAATAGAAGGG - Intergenic
1090500192 11:127253737-127253759 GTGAAGAAGTAAGATTAGAAAGG + Intergenic
1090624546 11:128594542-128594564 ATGAATGACTGGAAATAGAATGG + Intergenic
1091863630 12:3810100-3810122 TTGAATCATTTGAATTAGAAAGG - Exonic
1093901595 12:24641186-24641208 GTAAATATCTAGAAATAAAATGG - Intergenic
1094581523 12:31738047-31738069 GTGAAAAAATAGAATTACTAAGG - Intergenic
1094775045 12:33716859-33716881 TTGAGGAACTAGAATTAGAGTGG - Intergenic
1095129679 12:38524907-38524929 GTGAATAAAAAGGATCAGAAAGG - Intergenic
1096275372 12:50202978-50203000 GTGAATAAATGGCATTTGAAAGG + Intronic
1097017080 12:55994899-55994921 GTGATTAAATAGCAATAGAAGGG - Exonic
1097766972 12:63537036-63537058 GTGAATACATAGTATTGGAAAGG - Intergenic
1097783320 12:63731981-63732003 GTGAATACATAGTATTGGAAAGG - Intergenic
1098689072 12:73464496-73464518 AGAAATAACTAGAATCAGAATGG - Intergenic
1098841590 12:75484391-75484413 GTGAATAAACAGACTTAGAGAGG + Intronic
1099412100 12:82343700-82343722 TGGAATAACTGGAATTACAAGGG + Intronic
1099693150 12:85986605-85986627 GTGAATAGTTAGAAGTAGTAAGG - Intronic
1099708285 12:86185584-86185606 GTGACTATCCACAATTAGAATGG - Intronic
1100913583 12:99392335-99392357 GAGGAGAACTAAAATTAGAATGG - Intronic
1101112898 12:101503873-101503895 GTAGATAACTTGAATCAGAATGG - Intergenic
1101200078 12:102426491-102426513 GTGAATAACAATATCTAGAAAGG - Intronic
1103886168 12:124202261-124202283 GTGAAAAACAATAATTATAAGGG + Intronic
1104299228 12:127548934-127548956 GTAAATACCTAGAAGTAGAATGG - Intergenic
1104664815 12:130640478-130640500 GTTAATAACTAGCATTAAAACGG - Intronic
1105727305 13:23177256-23177278 GTAAAAAGTTAGAATTAGAAAGG + Intergenic
1106093056 13:26616123-26616145 GTAAATATCTAGGAGTAGAATGG + Intronic
1107110351 13:36690993-36691015 GTGAATAACGACTATTTGAAAGG - Intronic
1107180854 13:37457369-37457391 GTTAATAATTAGAATTATGATGG - Intergenic
1107424629 13:40280971-40280993 GTGAAGAGCTATAACTAGAAAGG + Intergenic
1109173320 13:59123536-59123558 ATGGAAAACTAGAACTAGAATGG + Intergenic
1109210854 13:59534302-59534324 GTTTATAAATAGAATAAGAAAGG - Intergenic
1109558127 13:64008215-64008237 GAGAATAATTATTATTAGAAAGG + Intergenic
1109600032 13:64613385-64613407 GTGAATAGGTAGAAATAGAGAGG - Intergenic
1110071451 13:71183830-71183852 GTAAATACCTAGAAGTAGAATGG - Intergenic
1110077464 13:71265902-71265924 GGCAATAAATACAATTAGAAGGG - Intergenic
1111872453 13:93849875-93849897 GTGAATTATTAGAATTATTAAGG + Intronic
1112110882 13:96297333-96297355 GTGAAAATGTAGAAATAGAAAGG - Intronic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1113022360 13:105901826-105901848 GTGACTTACTAGAAATTGAAGGG - Intergenic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1116214815 14:42000682-42000704 GTGAATAACAAGCATTGGCAAGG - Intergenic
1116327611 14:43551315-43551337 TTTAAAAACTAGAAATAGAAGGG - Intergenic
1118093353 14:62508020-62508042 GAGAATGACTTGAATTAGGATGG + Intergenic
1118995462 14:70831639-70831661 GTAAATACCTAGAAATGGAATGG + Intergenic
1120738471 14:88081336-88081358 GTGAATGACTAGAATAATGAAGG - Intergenic
1121183129 14:91944437-91944459 GTATATACCTAGAAGTAGAATGG - Intronic
1121480040 14:94260064-94260086 GTAAATACCTAGGAATAGAATGG + Intronic
1121758516 14:96423512-96423534 GTGAGTGACTAGAATGATAAAGG + Intronic
1121854822 14:97258219-97258241 GTAAATACCTAGGAGTAGAATGG - Intergenic
1121927145 14:97938126-97938148 TTGAATAACTAGAAGTAGGAAGG + Intronic
1123167486 14:106340046-106340068 CTGAGTATCTAGAATTAGAGGGG - Intergenic
1123170102 14:106364759-106364781 CTGAATATCTAGAATTAGAGGGG - Intergenic
1123193770 14:106596944-106596966 TTGAATATCTAGAACTAGAGGGG - Intergenic
1124223199 15:27867307-27867329 GTGAAAAAAAAGAATTAGCAAGG + Intronic
1124465129 15:29931514-29931536 TTGAACATATAGAATTAGAATGG - Intronic
1125733995 15:41910909-41910931 GTAAGTAACTAAAATAAGAAAGG + Intronic
1125885238 15:43224534-43224556 ATAAATACCTAGAAGTAGAATGG - Intergenic
1126260144 15:46680115-46680137 ATCAATAACAAGAATTAAAAAGG + Intergenic
1126899168 15:53294545-53294567 GTGAATAAGTACAATAAGAGAGG - Intergenic
1127180510 15:56411431-56411453 GTGGATAATGAGGATTAGAAAGG + Intronic
1130573198 15:85067413-85067435 GTGAATAATAAGAATTATTAAGG + Intronic
1130621519 15:85467760-85467782 GTGAATAACTAAAATAATAATGG + Intronic
1130972582 15:88745020-88745042 GAGACTAACTAGAGTAAGAAAGG - Intergenic
1131690212 15:94819043-94819065 GTGAATAAAAATAATGAGAAAGG - Intergenic
1133439898 16:5812290-5812312 TTGAGTAGCTAGAAGTAGAAAGG + Intergenic
1133872894 16:9706123-9706145 GTAAATACCTAGGAGTAGAATGG - Intergenic
1134900138 16:17930563-17930585 GTGAATACCTAGGACTAGGATGG - Intergenic
1135432166 16:22394682-22394704 GTAAATACCTAGGAGTAGAATGG + Intronic
1137671098 16:50279733-50279755 GTCACTAACTAGCATTAGAATGG + Intronic
1137858751 16:51823920-51823942 ATAAATATGTAGAATTAGAATGG + Intergenic
1138929010 16:61629585-61629607 GTGAATAAATAGATTCAGAGAGG + Intergenic
1139111008 16:63890865-63890887 GGGAAAAAATAGATTTAGAATGG - Intergenic
1140057024 16:71534445-71534467 GAGAATCACTTGAATCAGAAAGG - Intronic
1140388015 16:74559634-74559656 AAGAATGTCTAGAATTAGAAGGG - Intronic
1143927758 17:10387699-10387721 GTAAATACCTAGGAATAGAATGG + Intergenic
1144432618 17:15208669-15208691 GTAAATACCTAGAAATAAAATGG - Intergenic
1145828559 17:27896680-27896702 GAGAATAAGTAAAAGTAGAAGGG + Intergenic
1146204289 17:30888566-30888588 GTGAGTAAATAGAATTAAACTGG + Intronic
1148571639 17:48674651-48674673 GACAATAACTAGTATTAGCAAGG + Intergenic
1152533478 17:80936336-80936358 GTGAATATCCAGGAGTAGAATGG - Intronic
1203161196 17_GL000205v2_random:51752-51774 GTTAATAACTTGATTTAGAATGG - Intergenic
1153094029 18:1381162-1381184 GTGAATAATTAGTTTTAGGAAGG + Intergenic
1153143809 18:2005598-2005620 CAGAATAACTAGAATTATAAAGG + Intergenic
1153361319 18:4200284-4200306 GTGAATAACTGAAATTATGAGGG - Intronic
1154171389 18:12054676-12054698 TTGGCTAACTAGAAATAGAAAGG + Intergenic
1156711475 18:39951925-39951947 GTAGAAAACTAGAATTAGAAGGG - Intergenic
1158231036 18:55255484-55255506 GTGAAAAACTAGAATCCTAATGG - Intronic
1158791814 18:60789137-60789159 GAGAATAAATAAAATAAGAATGG - Intergenic
1158986632 18:62824219-62824241 GTAAATACCTAGGATTGGAATGG - Intronic
1159160302 18:64636172-64636194 GTAAATACCTAGAAGTGGAATGG - Intergenic
1159362644 18:67425211-67425233 GTGAAAAACAGGAATTAAAAAGG + Intergenic
1160601000 18:80012636-80012658 GTGGATAACTAGACTAAGTATGG - Intronic
1164868205 19:31622632-31622654 GTGAAGAAATAGATTTACAAAGG - Intergenic
1167861505 19:52287832-52287854 CGAAATAACTACAATTAGAAAGG - Intronic
925205450 2:2002106-2002128 GTCAATAAAAAGAAGTAGAATGG - Intronic
925752062 2:7097640-7097662 GAGATTAACCAGAATTAGACAGG + Intergenic
926414816 2:12639117-12639139 GTGTATAACTAAGATCAGAATGG - Intergenic
926665221 2:15514350-15514372 CTGAATAAATAGAAATATAAGGG + Intronic
927407131 2:22783647-22783669 GTGAAGAAGCAGAATTTGAATGG - Intergenic
927599335 2:24426732-24426754 ATGAATAACTAAAATATGAAGGG + Intergenic
928288349 2:30013816-30013838 GAAAATTACTAAAATTAGAAAGG + Intergenic
929305660 2:40358539-40358561 GAGAATAAATAGGATTAGACTGG - Intronic
929310965 2:40423961-40423983 TGGAATAACTAGCATTTGAATGG - Intronic
930408932 2:50998804-50998826 GTGCAAAACAAGAATTTGAAAGG - Intronic
930790274 2:55319273-55319295 GTTAATAAATATATTTAGAATGG - Intronic
931334906 2:61329810-61329832 GTAAATAATTGGAATTAGAAGGG + Intronic
932249309 2:70228155-70228177 GTAAATAATTATTATTAGAATGG - Intronic
932488095 2:72098305-72098327 GTAAATACCTAGGAGTAGAATGG + Intergenic
932857284 2:75249250-75249272 CAAAAGAACTAGAATTAGAAGGG - Intergenic
933002700 2:76945917-76945939 GTGAAGAACAAGAATGAGAAGGG - Intronic
933148917 2:78890954-78890976 GAGAATAAGTAGCATTTGAAAGG + Intergenic
933606661 2:84390533-84390555 GTAAATACCTAGAAGTAGAATGG - Intergenic
933980249 2:87543415-87543437 CTGATTAACTTGAATTACAAAGG + Intergenic
935901407 2:107797587-107797609 GTGAAGAGCTAGAATTAATATGG - Intergenic
936000432 2:108822932-108822954 TGGAATAACTCAAATTAGAAAGG + Intronic
936313577 2:111407376-111407398 CTGATTAACTTGAATTACAAAGG - Intergenic
936617680 2:114064895-114064917 GTTAATAATTCAAATTAGAATGG - Intergenic
937144794 2:119635294-119635316 GTGAATAGCTAGGAATGGAATGG - Intronic
937626182 2:124046463-124046485 GTTAATATCTAGAATTTGCAAGG + Intronic
938925478 2:136037314-136037336 GTAAATACATAGGATTAGAATGG + Intergenic
939878896 2:147607781-147607803 GTGTATAAAGAGAATTAAAACGG - Intergenic
940353254 2:152712493-152712515 CTGAATAAATAGAATTAGGGAGG + Intronic
941039856 2:160609103-160609125 GTTGGTAACTAGAATGAGAAAGG + Intergenic
941413879 2:165194630-165194652 TTGAATATCTAGAGTTAGAAAGG - Intronic
941442136 2:165551581-165551603 GCGAACAGCTAGAATTAGACAGG - Intronic
942210961 2:173669651-173669673 GTAAATACCTAGGAGTAGAATGG - Intergenic
942902125 2:181133491-181133513 GTAAATACCTAGAACTGGAATGG + Intergenic
943904267 2:193477510-193477532 GTAAATACCTAGGAGTAGAATGG - Intergenic
944272030 2:197795116-197795138 GTGAAAAACTAGAAATAAATTGG + Intergenic
944387033 2:199178904-199178926 GTAAATAGCTGGAAGTAGAATGG - Intergenic
946997397 2:225410173-225410195 GCAAAAAACTAGAAATAGAAAGG + Intronic
947192177 2:227518306-227518328 ATAAATACCTAGAAGTAGAATGG + Intronic
948539785 2:238682434-238682456 TTGAATTTCTAGAAGTAGAATGG + Intergenic
948761365 2:240193694-240193716 CTGAATGGCTAGAATTTGAAAGG - Intergenic
948911486 2:241006491-241006513 GTGAGTAAATAGATTGAGAATGG + Intronic
1170384763 20:15804423-15804445 GTGAATATTTGTAATTAGAAAGG - Intronic
1171367222 20:24633537-24633559 GTGATCAACTAGAATCAAAAGGG - Intronic
1173332725 20:42088456-42088478 CTCCAGAACTAGAATTAGAAGGG + Intronic
1176341600 21:5702919-5702941 GTTAATAACTTGATTTAGAATGG + Intergenic
1176473854 21:7135071-7135093 GTTAATAACTTGATTTAGAATGG + Intergenic
1176503227 21:7621537-7621559 GTTAATAACTTGATTTAGAATGG - Intergenic
1176535921 21:8100988-8101010 GTTAATAACTTGATTTAGAATGG + Intergenic
1177266689 21:18794821-18794843 TTTAGAAACTAGAATTAGAAAGG - Intergenic
1178773137 21:35524195-35524217 ATGAATATCTAGAAATAAAATGG - Intronic
1179388696 21:40967730-40967752 ATTAATTAATAGAATTAGAATGG + Intergenic
1180241048 21:46506075-46506097 GTCAATACCTAGAAGTAGAATGG + Intronic
1181948023 22:26533427-26533449 GTGAATAAATAAAAATAAAAAGG + Intronic
1203240868 22_KI270733v1_random:17383-17405 GTTAATAACTTGATTTAGAATGG + Intergenic
949224322 3:1675250-1675272 GAGAATGACTACAATTAAAAAGG - Intergenic
950643667 3:14364407-14364429 TAGCAGAACTAGAATTAGAACGG - Intergenic
951252039 3:20405082-20405104 GTGAATAAACAGATATAGAATGG - Intergenic
952310464 3:32184540-32184562 GTTAATAACAAGAGTTAGTAAGG + Intergenic
952861170 3:37813462-37813484 GTGAAAAACTAAATTTAGCAAGG - Intronic
955962780 3:64358049-64358071 ATGAATTCCTAGAAATAGAAGGG + Intronic
956465176 3:69513190-69513212 TCAAAAAACTAGAATTAGAAAGG + Intronic
956920061 3:73918758-73918780 GTAAATAAGTAGATTGAGAATGG - Intergenic
958059045 3:88454106-88454128 TTGAATAACTAAAATTTAAAAGG - Intergenic
958193465 3:90212540-90212562 CTGAGTAACTGGAATTATAAGGG - Intergenic
960475661 3:118123170-118123192 ATAAATAACTAAAAGTAGAAAGG + Intergenic
960781065 3:121317980-121318002 ATAAATAAGAAGAATTAGAAGGG - Intronic
960825282 3:121776360-121776382 GTAAATATCTAGGAGTAGAATGG + Intronic
961853671 3:129847681-129847703 TTGAATAATTAGAAATGGAATGG + Intronic
962003443 3:131324467-131324489 TAGAATAACTAGATTTACAAAGG - Intronic
962061841 3:131936262-131936284 GTGAATAAATAGACTTATAAAGG + Intronic
963135090 3:141895711-141895733 GTAAATATCTAGAAGTAGATTGG + Intronic
963382719 3:144552336-144552358 GTGAATAACTCCAATTAATATGG - Intergenic
963587474 3:147210833-147210855 GTGAACAACTGGAATTGAAATGG - Intergenic
965945141 3:174231869-174231891 GAGAAAACCTAGACTTAGAAAGG - Intronic
966738005 3:183205412-183205434 GTAAAAAAATAGAATTAGACTGG + Intronic
967495620 3:190142054-190142076 GTGGACAACTAGAAGGAGAAGGG - Intergenic
969295495 4:6268599-6268621 GAGAATTACTAAAAGTAGAAAGG - Intergenic
970396260 4:15670269-15670291 GTAAATACCTAGGAGTAGAAAGG + Intronic
970461031 4:16275129-16275151 GTGAGTTACTAGAATAAGCAGGG + Intergenic
973902868 4:55495564-55495586 GTGAATGACTACAATAAGGAGGG - Intronic
974701770 4:65458719-65458741 TTGAATACCTACTATTAGAAAGG - Intronic
975538614 4:75478941-75478963 GTGAATTCATAGAAGTAGAATGG + Intergenic
975701789 4:77074890-77074912 TTAAATAACTGGAATTTGAAAGG - Intronic
976369961 4:84276371-84276393 GAGAGTAACTAGAAGTAGAAAGG - Intergenic
978366105 4:107984333-107984355 GTGAATGACAAGACTTAAAATGG - Intergenic
980597800 4:134977425-134977447 GTGTATAACTGGAAGAAGAAAGG - Intergenic
981042032 4:140232108-140232130 GAGAATAACAAGGATGAGAAAGG + Intergenic
981062508 4:140440162-140440184 TTGAATAACTAGGAGTGGAATGG + Intergenic
981241700 4:142484470-142484492 ATGAAACACTAGAATTAGAAGGG + Intronic
982735383 4:159001011-159001033 GTAAATAACTAGAAGTGGAATGG + Intronic
982740979 4:159056713-159056735 GTGAAGAACAAGAATTTGATAGG + Intergenic
983054702 4:163087841-163087863 GTGAATGACTATAGTTGGAATGG - Intergenic
983410209 4:167386556-167386578 ATTAATAGCTAGAACTAGAAAGG - Intergenic
984901278 4:184588920-184588942 TTGAATAGCTAGGAGTAGAATGG + Intergenic
984986125 4:185331308-185331330 GAGAATAATTAGAATAACAATGG - Intronic
987726759 5:21712173-21712195 CTGAAGCACTAGAATTAGAAGGG + Intergenic
987810245 5:22825854-22825876 GCAAATACCTAGAAATAGAATGG + Intronic
988026459 5:25697875-25697897 GTGAGTAACTAAAATTAGACTGG + Intergenic
988035670 5:25824116-25824138 TTGAAAAATTAAAATTAGAATGG + Intergenic
988247030 5:28699202-28699224 GTAAACACCTAGAAATAGAATGG + Intergenic
991062168 5:62388555-62388577 GTGAATAACAAGAAATGGTACGG + Exonic
993586758 5:89740662-89740684 GTAAATACCTAGAAATGGAACGG + Intergenic
993909944 5:93669122-93669144 AAGAACAACTAGAATTAGGAAGG - Intronic
995279365 5:110316194-110316216 CTGAATAACAAGCATCAGAATGG - Intronic
996742103 5:126809177-126809199 GTGTCTAAATAAAATTAGAATGG - Intronic
996782711 5:127205817-127205839 ATGAATAATTAGGATTTGAAAGG - Intergenic
997044904 5:130303308-130303330 GCAAATAACAAGAATTAAAAAGG - Intergenic
997491258 5:134278578-134278600 AAGAATAACTAGAGATAGAAAGG - Intergenic
998597198 5:143544348-143544370 ATGAATAACTAGATTTGCAATGG + Intergenic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
999926776 5:156387460-156387482 ATGCATAACTTGAATTAGCAAGG - Intronic
1000959306 5:167580451-167580473 GTTAATGACTAAAATGAGAATGG - Intronic
1001418023 5:171562133-171562155 GTGAATACCTAGGATTAGGATGG + Intergenic
1002389980 5:178902613-178902635 GTGATTAATTAAAATTTGAATGG + Intronic
1003719166 6:8681316-8681338 GAGAATATCTAGAGTAAGAATGG + Intergenic
1003786802 6:9495825-9495847 GTAAATACCTAGAAGCAGAATGG - Intergenic
1004122076 6:12833640-12833662 GTAAATAACTGGGATGAGAAAGG - Intronic
1004762406 6:18682676-18682698 GGAAATTTCTAGAATTAGAATGG + Intergenic
1005436989 6:25823324-25823346 GTAAATAACTAGCAGTGGAATGG + Intronic
1007515051 6:42404373-42404395 GTGAAAAAGTAGGACTAGAATGG - Intronic
1007835517 6:44671129-44671151 GTGAAAATCTTGAATTACAAAGG - Intergenic
1008278219 6:49565456-49565478 GTGAATAACTAAAAAAACAATGG - Intergenic
1008758481 6:54825555-54825577 GTGAATAATAAGTATTAGAGAGG - Intergenic
1009754371 6:67917458-67917480 GTCAATGATGAGAATTAGAAAGG - Intergenic
1010073733 6:71774974-71774996 ATAAATACCTAGAATTGGAATGG + Intergenic
1011917448 6:92526122-92526144 ATGAATAACTATAATTTGACTGG + Intergenic
1012640279 6:101601937-101601959 GAAAATAACTATAATTAGACAGG - Intronic
1014912645 6:127112824-127112846 ATGAATAACTAGAATCAGAATGG - Intergenic
1015373684 6:132485522-132485544 GTGGATAAATAGAAGTAGAACGG + Intronic
1017368108 6:153669069-153669091 TTCAGTAACCAGAATTAGAAGGG - Intergenic
1018332658 6:162748088-162748110 GTGATTGACTAGAGTTAGAGAGG - Intronic
1018348550 6:162929457-162929479 ATTAATAACCAGAATTATAAGGG - Intronic
1020485948 7:8720925-8720947 GTAAAGAACCAGAAATAGAAGGG + Intronic
1021834064 7:24649721-24649743 GTGAATACCAAGAATACGAATGG - Exonic
1022266840 7:28764839-28764861 GAGAATAATGAGATTTAGAAGGG + Intronic
1022608345 7:31839693-31839715 GTGAATACCTAGAAGCAGAATGG + Intronic
1023761882 7:43471795-43471817 ATGAATAAATAAAATGAGAAGGG + Intronic
1024051919 7:45629458-45629480 GTAAATACCTAGAAGTAGAATGG + Intronic
1026707123 7:72703763-72703785 GAGAATCACTTGAATTCGAAAGG + Intronic
1027450482 7:78325793-78325815 GTGAATAAAGAGAACTAGAAGGG + Intronic
1027817371 7:82993142-82993164 TTGAATATATAGAATTATAAAGG - Intronic
1028279944 7:88911362-88911384 GAGAATGACTAGAATTTGAATGG - Intronic
1028409995 7:90520191-90520213 GTAAATATCTAGGAGTAGAATGG - Intronic
1029899575 7:104024548-104024570 GGGAATAAAAAGAATCAGAAAGG + Intergenic
1029993990 7:104988727-104988749 GTTAGCAACTAGAATTACAATGG - Intergenic
1033724487 7:144099367-144099389 TTGAAAAACTAAAATTAGTAGGG + Intergenic
1033892402 7:146031353-146031375 ATGAATACCTAGGATTTGAAAGG + Intergenic
1033995530 7:147341482-147341504 GTGAATAAATAGATTAAAAATGG + Intronic
1035940453 8:3894724-3894746 TTGATTAACTAGAATTACTAAGG + Intronic
1037357873 8:18041858-18041880 GTAAATACCTAGGATTGGAATGG + Intergenic
1037414958 8:18640112-18640134 ATGAAATACTAGAACTAGAATGG - Intronic
1038356531 8:26834388-26834410 GTGAAAAACTAAAATGAGATGGG + Intronic
1039221427 8:35335285-35335307 CTAAATAACCAGAAATAGAATGG + Intronic
1042658612 8:71129425-71129447 GAGAATACCAAGAATTACAAAGG - Intergenic
1042697593 8:71572888-71572910 GTAAATACCTAGGATTAGAATGG + Intronic
1043548889 8:81346126-81346148 GACAATAACAAGTATTAGAAAGG - Intergenic
1044787706 8:95812398-95812420 GTAACAAACTAGAAATAGAAGGG - Intergenic
1046196389 8:110868393-110868415 GAGAATACCTAAAATTAAAATGG - Intergenic
1046556724 8:115782633-115782655 GTAAATACCTAGGAGTAGAATGG + Intronic
1046577103 8:116043969-116043991 GTCAATATCTAGAATAAAAAGGG - Intergenic
1046912432 8:119643882-119643904 GTGAGTAACCAGATTAAGAAAGG + Intronic
1048245152 8:132787934-132787956 TAGAAGAACTAGAAATAGAAGGG - Intronic
1048307096 8:133292096-133292118 GTGAATAACTGGAAGTCCAAAGG + Intronic
1048694025 8:137003844-137003866 TTGAATAAATAGAATTAAATTGG + Intergenic
1050131865 9:2421113-2421135 GTGAATAACTGAAATTTGAGCGG + Intergenic
1050754406 9:8983165-8983187 GTGATTAGCAATAATTAGAATGG + Intronic
1050835093 9:10067310-10067332 GTAAATAGCTACAATTATAATGG + Intronic
1051432121 9:16990104-16990126 GTAAATAACTAGGAACAGAATGG + Intergenic
1051794937 9:20856468-20856490 ATTAATAACTAGAATAAAAATGG - Intronic
1051965694 9:22826925-22826947 GCAAATATCTAGAAGTAGAATGG + Intergenic
1052426363 9:28310172-28310194 GTAAATACCTAGAATTTGAATGG - Intronic
1052737373 9:32356144-32356166 GTAAATACCTAGAAGTGGAATGG + Intergenic
1055825993 9:80325533-80325555 ATGAACAAATAGAATTAGATGGG + Intergenic
1056668808 9:88605465-88605487 GTAAATATGTAGAATTAAAATGG - Intergenic
1057110773 9:92468890-92468912 GTGAATAACAAGAATAAGTATGG + Intronic
1057166133 9:92927476-92927498 GTAAATACCTAGAAGTGGAATGG + Intergenic
1057571699 9:96208727-96208749 ATGACTAATTAGAAATAGAAAGG - Intergenic
1057573362 9:96220194-96220216 GTAAATACCTAGGAGTAGAATGG - Intergenic
1059827928 9:118053336-118053358 GTGAACAACCAGAATGAGATTGG - Intergenic
1062185014 9:135213472-135213494 GTGAAGAACAAGAGTTGGAAGGG + Intergenic
1203457198 Un_GL000220v1:471-493 GTTAATAACTTGATTTAGAATGG + Intergenic
1186643060 X:11477488-11477510 GTAAATACCTAGAAGTAAAATGG - Intronic
1187084928 X:16032170-16032192 TAGAATAACTAAAAGTAGAAGGG - Intergenic
1187804039 X:23098584-23098606 ATGAATAAATATAATTAAAATGG + Intergenic
1188261349 X:28028380-28028402 GGAAATAACTAAAATCAGAAAGG - Intergenic
1189692318 X:43630356-43630378 ATAAATACCTAGAAGTAGAATGG - Intergenic
1191752592 X:64559343-64559365 GTAAATACCTAGAATTTGAAAGG - Intergenic
1193396415 X:80988843-80988865 GTGAATAAAGATGATTAGAAGGG - Intergenic
1194594811 X:95844550-95844572 GAGAATCACTTGAACTAGAAAGG - Intergenic
1195402764 X:104479329-104479351 ATGAATAAACAGAATTAGATTGG - Intergenic
1195737082 X:108023139-108023161 CTGAAAAACTAGGAATAGAAGGG - Intergenic
1196078314 X:111602141-111602163 GTAAATACCTAGAAATGGAATGG + Intergenic
1196335562 X:114528604-114528626 GAGAATAACTATAATTTCAAAGG - Intergenic
1197659988 X:129160210-129160232 CTGCCAAACTAGAATTAGAAGGG - Intergenic
1199039021 X:143088513-143088535 GTGGATATCTAGAATTACAATGG + Intergenic
1201495460 Y:14588111-14588133 GTGAATAATTATAATTAGCTAGG + Intronic