ID: 922161542

View in Genome Browser
Species Human (GRCh38)
Location 1:223082069-223082091
Sequence TATGGAGCACTCAGAGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922161542_922161549 10 Left 922161542 1:223082069-223082091 CCTTACCCTCTGAGTGCTCCATA No data
Right 922161549 1:223082102-223082124 TGGAATAAACTGACAGCAGGCGG No data
922161542_922161550 19 Left 922161542 1:223082069-223082091 CCTTACCCTCTGAGTGCTCCATA No data
Right 922161550 1:223082111-223082133 CTGACAGCAGGCGGATTAGCAGG No data
922161542_922161548 7 Left 922161542 1:223082069-223082091 CCTTACCCTCTGAGTGCTCCATA No data
Right 922161548 1:223082099-223082121 CTATGGAATAAACTGACAGCAGG No data
922161542_922161552 26 Left 922161542 1:223082069-223082091 CCTTACCCTCTGAGTGCTCCATA No data
Right 922161552 1:223082118-223082140 CAGGCGGATTAGCAGGAGGAAGG No data
922161542_922161546 -10 Left 922161542 1:223082069-223082091 CCTTACCCTCTGAGTGCTCCATA No data
Right 922161546 1:223082082-223082104 GTGCTCCATAATGGAGTCTATGG No data
922161542_922161551 22 Left 922161542 1:223082069-223082091 CCTTACCCTCTGAGTGCTCCATA No data
Right 922161551 1:223082114-223082136 ACAGCAGGCGGATTAGCAGGAGG No data
922161542_922161553 27 Left 922161542 1:223082069-223082091 CCTTACCCTCTGAGTGCTCCATA No data
Right 922161553 1:223082119-223082141 AGGCGGATTAGCAGGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922161542 Original CRISPR TATGGAGCACTCAGAGGGTA AGG (reversed) Intergenic
No off target data available for this crispr