ID: 922161545

View in Genome Browser
Species Human (GRCh38)
Location 1:223082075-223082097
Sequence CTCCATTATGGAGCACTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922161545_922161551 16 Left 922161545 1:223082075-223082097 CCTCTGAGTGCTCCATAATGGAG No data
Right 922161551 1:223082114-223082136 ACAGCAGGCGGATTAGCAGGAGG No data
922161545_922161550 13 Left 922161545 1:223082075-223082097 CCTCTGAGTGCTCCATAATGGAG No data
Right 922161550 1:223082111-223082133 CTGACAGCAGGCGGATTAGCAGG No data
922161545_922161553 21 Left 922161545 1:223082075-223082097 CCTCTGAGTGCTCCATAATGGAG No data
Right 922161553 1:223082119-223082141 AGGCGGATTAGCAGGAGGAAGGG No data
922161545_922161549 4 Left 922161545 1:223082075-223082097 CCTCTGAGTGCTCCATAATGGAG No data
Right 922161549 1:223082102-223082124 TGGAATAAACTGACAGCAGGCGG No data
922161545_922161552 20 Left 922161545 1:223082075-223082097 CCTCTGAGTGCTCCATAATGGAG No data
Right 922161552 1:223082118-223082140 CAGGCGGATTAGCAGGAGGAAGG No data
922161545_922161548 1 Left 922161545 1:223082075-223082097 CCTCTGAGTGCTCCATAATGGAG No data
Right 922161548 1:223082099-223082121 CTATGGAATAAACTGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922161545 Original CRISPR CTCCATTATGGAGCACTCAG AGG (reversed) Intergenic
No off target data available for this crispr