ID: 922161552

View in Genome Browser
Species Human (GRCh38)
Location 1:223082118-223082140
Sequence CAGGCGGATTAGCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922161547_922161552 8 Left 922161547 1:223082087-223082109 CCATAATGGAGTCTATGGAATAA No data
Right 922161552 1:223082118-223082140 CAGGCGGATTAGCAGGAGGAAGG No data
922161542_922161552 26 Left 922161542 1:223082069-223082091 CCTTACCCTCTGAGTGCTCCATA No data
Right 922161552 1:223082118-223082140 CAGGCGGATTAGCAGGAGGAAGG No data
922161544_922161552 21 Left 922161544 1:223082074-223082096 CCCTCTGAGTGCTCCATAATGGA No data
Right 922161552 1:223082118-223082140 CAGGCGGATTAGCAGGAGGAAGG No data
922161545_922161552 20 Left 922161545 1:223082075-223082097 CCTCTGAGTGCTCCATAATGGAG No data
Right 922161552 1:223082118-223082140 CAGGCGGATTAGCAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922161552 Original CRISPR CAGGCGGATTAGCAGGAGGA AGG Intergenic
No off target data available for this crispr