ID: 922162617

View in Genome Browser
Species Human (GRCh38)
Location 1:223089525-223089547
Sequence CTGACTGAGCACAGGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922162617_922162629 13 Left 922162617 1:223089525-223089547 CCCCCATCCCTGTGCTCAGTCAG No data
Right 922162629 1:223089561-223089583 ACGCAGCCGGGTCAGAGCCCTGG No data
922162617_922162625 0 Left 922162617 1:223089525-223089547 CCCCCATCCCTGTGCTCAGTCAG No data
Right 922162625 1:223089548-223089570 CCCTGGCCTCAAAACGCAGCCGG No data
922162617_922162631 15 Left 922162617 1:223089525-223089547 CCCCCATCCCTGTGCTCAGTCAG No data
Right 922162631 1:223089563-223089585 GCAGCCGGGTCAGAGCCCTGGGG No data
922162617_922162627 1 Left 922162617 1:223089525-223089547 CCCCCATCCCTGTGCTCAGTCAG No data
Right 922162627 1:223089549-223089571 CCTGGCCTCAAAACGCAGCCGGG No data
922162617_922162634 30 Left 922162617 1:223089525-223089547 CCCCCATCCCTGTGCTCAGTCAG No data
Right 922162634 1:223089578-223089600 CCCTGGGGCCCCGCTTGCTCAGG No data
922162617_922162630 14 Left 922162617 1:223089525-223089547 CCCCCATCCCTGTGCTCAGTCAG No data
Right 922162630 1:223089562-223089584 CGCAGCCGGGTCAGAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922162617 Original CRISPR CTGACTGAGCACAGGGATGG GGG (reversed) Intergenic
No off target data available for this crispr